ID: 1095944556

View in Genome Browser
Species Human (GRCh38)
Location 12:47746573-47746595
Sequence TCATGCCCACAGGTAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 162}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095944556_1095944558 -7 Left 1095944556 12:47746573-47746595 CCAGGCTCTACCTGTGGGCATGA 0: 1
1: 0
2: 2
3: 14
4: 162
Right 1095944558 12:47746589-47746611 GGCATGAATTACCTCCCAAAAGG 0: 1
1: 0
2: 1
3: 16
4: 128
1095944556_1095944563 16 Left 1095944556 12:47746573-47746595 CCAGGCTCTACCTGTGGGCATGA 0: 1
1: 0
2: 2
3: 14
4: 162
Right 1095944563 12:47746612-47746634 AATAAAAGGCCCATTGAGTCAGG 0: 1
1: 0
2: 0
3: 11
4: 148
1095944556_1095944569 28 Left 1095944556 12:47746573-47746595 CCAGGCTCTACCTGTGGGCATGA 0: 1
1: 0
2: 2
3: 14
4: 162
Right 1095944569 12:47746624-47746646 ATTGAGTCAGGGAGTGGGCGAGG 0: 1
1: 0
2: 2
3: 7
4: 249
1095944556_1095944559 2 Left 1095944556 12:47746573-47746595 CCAGGCTCTACCTGTGGGCATGA 0: 1
1: 0
2: 2
3: 14
4: 162
Right 1095944559 12:47746598-47746620 TACCTCCCAAAAGGAATAAAAGG 0: 1
1: 0
2: 1
3: 25
4: 239
1095944556_1095944565 22 Left 1095944556 12:47746573-47746595 CCAGGCTCTACCTGTGGGCATGA 0: 1
1: 0
2: 2
3: 14
4: 162
Right 1095944565 12:47746618-47746640 AGGCCCATTGAGTCAGGGAGTGG 0: 1
1: 0
2: 1
3: 19
4: 204
1095944556_1095944564 17 Left 1095944556 12:47746573-47746595 CCAGGCTCTACCTGTGGGCATGA 0: 1
1: 0
2: 2
3: 14
4: 162
Right 1095944564 12:47746613-47746635 ATAAAAGGCCCATTGAGTCAGGG 0: 1
1: 0
2: 0
3: 12
4: 122
1095944556_1095944566 23 Left 1095944556 12:47746573-47746595 CCAGGCTCTACCTGTGGGCATGA 0: 1
1: 0
2: 2
3: 14
4: 162
Right 1095944566 12:47746619-47746641 GGCCCATTGAGTCAGGGAGTGGG 0: 1
1: 0
2: 0
3: 17
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095944556 Original CRISPR TCATGCCCACAGGTAGAGCC TGG (reversed) Intronic
900514810 1:3076603-3076625 CCTCGCCCACAGGTAGTGCCAGG + Intronic
903917455 1:26774748-26774770 TTATGCCAACAGGCAGAGCACGG + Exonic
904238242 1:29127694-29127716 ACCTGCCCACAGGCACAGCCAGG + Intergenic
904415521 1:30359053-30359075 CCATTCCTCCAGGTAGAGCCTGG + Intergenic
905028123 1:34865245-34865267 TGATGCCCACAGTAAGGGCCTGG - Intergenic
907115289 1:51962783-51962805 CCATGTCCTCAGGGAGAGCCGGG - Intronic
911768098 1:101703175-101703197 TGCTGCCCAGAGGTAGAGCTAGG + Intergenic
913215162 1:116613948-116613970 ATATGCCCAGAGGCAGAGCCTGG - Exonic
915644994 1:157264117-157264139 TCATGGCCAAAGGTAGACACAGG + Intergenic
916728374 1:167543951-167543973 ACATGCCCAAAGGCAGTGCCTGG - Intronic
922061405 1:222096183-222096205 TCATGCCCACACATACACCCAGG + Intergenic
923658609 1:235939716-235939738 TCATTCACACAGGTAGAGGAGGG + Intergenic
924266383 1:242286391-242286413 TGCTGCCCACAGGAAGAGACAGG - Intronic
1062800467 10:375688-375710 TCCTGACCACAAGCAGAGCCAGG + Intronic
1062910612 10:1209425-1209447 CCATGCCCACACCTACAGCCTGG + Intronic
1066718449 10:38312164-38312186 TGCTGCCCACAGGAAGAGACAGG + Intergenic
1067562756 10:47315277-47315299 CCATGCCCACAGCTGGACCCAGG - Intergenic
1073291348 10:102414785-102414807 ACTGGCCCACAGGCAGAGCCGGG - Intronic
1073469768 10:103715312-103715334 TCAAGCTCACAGGCAGAGCTGGG + Intronic
1074561423 10:114538833-114538855 CCATGCACACAGGTAGCCCCTGG + Intronic
1074879910 10:117647713-117647735 TCATGGCCAGAGGTCCAGCCTGG - Intergenic
1076237184 10:128872316-128872338 TCATGCCCTCAGCCAGAGCTGGG - Intergenic
1076387070 10:130065010-130065032 TCTGGCCCACAGGCAGAGACAGG + Intergenic
1077236050 11:1482471-1482493 TCCTGACCACAGCCAGAGCCTGG - Intronic
1078755365 11:14203928-14203950 TCATTCCAACAGGGAGAGCAGGG + Intronic
1081998486 11:47378966-47378988 GCAGGGCCACAGGAAGAGCCAGG - Intergenic
1083045288 11:59729060-59729082 ACATGCCCACAGCAAGTGCCTGG + Intronic
1084606558 11:70175660-70175682 TCCTGCCCACATGCAGTGCCCGG - Intronic
1087153290 11:94877755-94877777 TCATCCTGACAGGTAGAGACTGG - Intergenic
1089150245 11:116358506-116358528 CCATGCCCACGGGTAGGGCGTGG + Intergenic
1089593513 11:119560160-119560182 TCCTTCCCACTGGTAGAGACAGG - Intergenic
1091721901 12:2820074-2820096 TCATGCCCACAGATGGAGATGGG + Exonic
1091972127 12:4796433-4796455 TCCTGCCCGGAGGAAGAGCCTGG + Intronic
1094843892 12:34353108-34353130 TCATGCCCACAGGTTGCCTCGGG - Intergenic
1095944556 12:47746573-47746595 TCATGCCCACAGGTAGAGCCTGG - Intronic
1095963471 12:47850837-47850859 CCACCCCCACAGGCAGAGCCCGG + Intronic
1095983875 12:47987166-47987188 TCATGCCCACAGGGTGCTCCTGG - Exonic
1096195351 12:49645968-49645990 GCAGCCCCACAGGTAGGGCCAGG + Intronic
1101576897 12:106006130-106006152 ACATGCCCACAGGTAGGTCAGGG - Intergenic
1102936175 12:116898876-116898898 ACATGCCCACAGTGAGAGTCAGG - Intergenic
1104378139 12:128283384-128283406 TCATGAGCACATGCAGAGCCAGG - Intronic
1105834546 13:24197844-24197866 CCATGCCCACTGAGAGAGCCAGG - Intronic
1106128816 13:26922514-26922536 TCATGGACACCGGGAGAGCCAGG - Intergenic
1110971592 13:81769696-81769718 TAATGCCCACAGGTAGAGTAAGG + Intergenic
1111116014 13:83779260-83779282 GAAAGCCCACAGGTAGAGGCTGG + Intergenic
1117498332 14:56327809-56327831 TCATTCCCACACTTGGAGCCAGG + Intergenic
1117602082 14:57386463-57386485 TCAAGCCCACAGGTAGAGGGAGG + Intergenic
1120943664 14:89973703-89973725 TAATACACACACGTAGAGCCGGG - Intronic
1122389120 14:101368298-101368320 TCCTGCCCACAGGGAGCTCCTGG + Intergenic
1124002492 15:25770641-25770663 TTAGGCCCAGAGGTGGAGCCAGG + Intronic
1128851904 15:70967621-70967643 TCAGGCCCACATCTAGAGCAAGG + Intronic
1129704807 15:77788060-77788082 GCATGCCCACGGGGAGAGGCAGG - Intronic
1130353534 15:83110750-83110772 TCATCCCCACAGGAGGAGCCTGG + Intronic
1130872945 15:87985704-87985726 TCATGCCCACAGGAAGTCACAGG + Intronic
1131438120 15:92439129-92439151 TGATCCCCTGAGGTAGAGCCTGG + Intronic
1132110558 15:99099480-99099502 TCATCCCTACAGGCAGAGGCTGG + Intronic
1134131173 16:11651219-11651241 TCATCCCCACAGCTACAGCTGGG + Intergenic
1134263398 16:12672332-12672354 TAATGTCCACAGGTACAGCCCGG - Intronic
1134296861 16:12953991-12954013 TAATCCCCACAGGTTGAGGCAGG - Intronic
1135937284 16:26792069-26792091 ACATGCCCACATGTAGAGCCTGG - Intergenic
1135983285 16:27165379-27165401 TCCTGCCCACTGCTAGTGCCAGG + Intergenic
1136252053 16:29011767-29011789 TCAGGCCCAGAGGTAGGGCGAGG - Intergenic
1137352670 16:47727198-47727220 ACATGCCCACAGGTAGTCTCAGG + Intergenic
1139545863 16:67649242-67649264 CCCTGCCCACAGGGAGACCCTGG + Exonic
1139659469 16:68411101-68411123 TCATGCCCACAGGGACATTCTGG - Intronic
1139711637 16:68780757-68780779 TCATGCCCACAGTTACCTCCAGG + Intronic
1140235220 16:73152926-73152948 TCCTGACCACAGGCTGAGCCGGG + Intergenic
1141749311 16:85947645-85947667 TGCTGCCCACGGGTGGAGCCAGG + Intergenic
1141813267 16:86390939-86390961 TCAAGGTCACAGGCAGAGCCAGG - Intergenic
1141903408 16:87007229-87007251 TCAAGCCCACAGGTCCACCCAGG + Intergenic
1142094491 16:88232224-88232246 TCCTGCCCTCAGGTTGAGGCTGG - Intergenic
1142551654 17:744315-744337 TCATGGCCAGAGGCAGAGCCAGG + Intergenic
1143509208 17:7386327-7386349 TAGTCCCCCCAGGTAGAGCCAGG + Intronic
1144384060 17:14732445-14732467 TCATGCCCACATGCCCAGCCTGG + Intergenic
1147217052 17:38906875-38906897 TCATGGGCACAGGTAGAGTGTGG + Intronic
1148464187 17:47855227-47855249 TCAAGCCCACAGGTACACACAGG - Intronic
1152494142 17:80659207-80659229 TCATGCACACAGGGTGACCCTGG + Intronic
1152760506 17:82104912-82104934 TCATGCCCCCAGGCTGAGACGGG - Intronic
1152932648 17:83118033-83118055 TCCTTCCAAAAGGTAGAGCCCGG + Intergenic
1153609703 18:6871222-6871244 TCCTCCACACAGGTACAGCCAGG - Intronic
1153842346 18:9018007-9018029 CCGTGCCCACAGGAAGAGCTGGG + Intergenic
1155732392 18:29177628-29177650 TCATGCCTACAGGATGACCCTGG - Intergenic
1160173979 18:76578600-76578622 TCAGCCGCACAGGTAGAGTCTGG - Intergenic
1161196866 19:2991756-2991778 TCATGCCCAAATGTAGTGACTGG + Intronic
1164914351 19:32038370-32038392 TCATTCCCGGATGTAGAGCCTGG + Intergenic
1165378224 19:35459097-35459119 TCAGGCCCCCAGGTTGGGCCAGG - Intergenic
1166961135 19:46496350-46496372 TCTTGCTCACAGGTGGTGCCTGG - Exonic
925587117 2:5475241-5475263 TCCGGCCCACATGCAGAGCCTGG + Intergenic
927519281 2:23689365-23689387 TCTTGCCCACAGTCTGAGCCAGG - Intronic
932212727 2:69945729-69945751 GGATGACCACAGGAAGAGCCAGG + Intergenic
934295423 2:91739197-91739219 ATATGCCCAGAGGCAGAGCCTGG + Intergenic
935177898 2:100665183-100665205 CAATCCCCATAGGTAGAGCCAGG + Intergenic
935223719 2:101035955-101035977 TCATGGACACAGGAACAGCCCGG - Intronic
938900613 2:135796171-135796193 GCATGCCCACAGGGAGACCTGGG + Intronic
945673636 2:212831552-212831574 CCATTCCCAGGGGTAGAGCCCGG - Intergenic
946190007 2:218003094-218003116 TCAAGGCCACCGGTGGAGCCTGG - Intergenic
946740190 2:222793721-222793743 TCATGCACACAGGAAATGCCAGG - Intergenic
947602469 2:231462887-231462909 TCACCCCCACATGTAGAGCTGGG - Intronic
948208520 2:236175877-236175899 ACATGCCCAGAGGGAGAGCTGGG - Intergenic
1169394552 20:5218180-5218202 AGATGCCCACAGCTAGAGCTTGG - Intergenic
1169400408 20:5274643-5274665 TCAAGCCCAAAAGTAGAGCTGGG + Intergenic
1170540910 20:17387068-17387090 TCATGCAGACAGGTAGATCTGGG + Intronic
1173551512 20:43936126-43936148 TCATTCCCACTGGTAGAGACAGG + Intronic
1174421492 20:50401923-50401945 CCATGTCCACAGTTACAGCCAGG + Intergenic
1175920126 20:62446722-62446744 CCAGGCCCACAGGCAGACCCCGG - Intergenic
1175940517 20:62535573-62535595 TCAGGCCCACAGGCAGACGCAGG - Intergenic
1179150078 21:38802291-38802313 TCATGCCCACAGGGAGTGCAAGG + Intergenic
1179189156 21:39108484-39108506 TCATGCCAAGAGGTAGAGATTGG - Intergenic
1180655688 22:17418901-17418923 TCATTTCCACAGGTACATCCTGG + Intronic
1181271511 22:21661368-21661390 CCATGCCCACAGGGAGAGGCAGG - Intronic
1183934108 22:41252387-41252409 TCATGCCCAAATGCAGTGCCTGG + Intronic
1184152708 22:42648088-42648110 TGATGCCCACAGGTTCACCCTGG + Intronic
1184242309 22:43217629-43217651 ACATGCCCACAGGTACAGTGAGG - Intronic
1184893994 22:47396599-47396621 GCATGCACACATGTACAGCCTGG + Intergenic
1184980443 22:48091739-48091761 TCATGCCCACAGTTGGTGCAGGG - Intergenic
1185380396 22:50505143-50505165 CCTTGCCCACAGGTGGACCCAGG - Exonic
950168531 3:10819819-10819841 TCATGCCCACAGGTAGCCCAGGG - Exonic
951853532 3:27169736-27169758 TCAAACCCAGAGGTAGATCCAGG + Intronic
952549216 3:34457094-34457116 TCATGCCCACAAGTGGTGCATGG + Intergenic
953041073 3:39255408-39255430 TCATGCACACAGGTATCCCCAGG - Intergenic
954134213 3:48574711-48574733 TCATCCCCACAGGGGGAGCCGGG - Exonic
954642641 3:52110744-52110766 ACATGGCCCCAGGCAGAGCCAGG - Intronic
959964184 3:112334953-112334975 TCATGGCCTCTGGTAGAGCCTGG + Intronic
962062447 3:131944436-131944458 TCCTGCCCACAGGTTGCTCCTGG + Intronic
962237123 3:133716115-133716137 TCATGCCAGCATGTAGAGGCTGG - Intergenic
963893526 3:150661332-150661354 TGATGCCCACAGGCTGAGGCTGG + Intronic
969698702 4:8752893-8752915 TAAAGCCCACAGATAGATCCAGG + Intergenic
971577770 4:28298610-28298632 TCATGCACACAGGTTCAGGCAGG + Intergenic
971615380 4:28783129-28783151 TCATCCCCACAGGCCCAGCCTGG - Intergenic
971892475 4:32543249-32543271 TCATCCCCACATGTAGAGAGAGG + Intergenic
972609845 4:40646329-40646351 TCATGCCCAAAGTTCCAGCCAGG + Intergenic
975448678 4:74499722-74499744 TTATGGGCTCAGGTAGAGCCAGG + Intergenic
982568298 4:157015254-157015276 TGATGCTGACAGCTAGAGCCAGG - Intergenic
985877403 5:2610323-2610345 TCATGCCCTCAGGCAGCCCCAGG - Intergenic
985884269 5:2664330-2664352 GGATGCCCACAGGGAGAGGCAGG - Intergenic
990169039 5:53027622-53027644 TCATGCCCACTGGTGGACACAGG + Intronic
991025834 5:62028672-62028694 TCAAGCTCAAAGGTAGAACCTGG - Intergenic
992003391 5:72456151-72456173 CCATGCCCAGGGGTAGAGCCAGG - Intronic
992660300 5:78953330-78953352 TCATGCAGCCAGGCAGAGCCTGG - Intronic
997897672 5:137734404-137734426 TGACTCCCACAGGAAGAGCCTGG - Intronic
1000216059 5:159157614-159157636 TCATGGCTACAGGTAGAACTGGG - Intronic
1000415979 5:160984260-160984282 TCATGCCTACAGGAGGAACCAGG - Intergenic
1001273864 5:170336231-170336253 TCATCCCCACATGTAGGGCTGGG - Intergenic
1001728822 5:173932029-173932051 TTATGCCTACATGTAGAGACAGG - Intronic
1002336996 5:178486643-178486665 TGAAGCCCACAGGGAGAGCCGGG + Intronic
1003244808 6:4374745-4374767 GGACACCCACAGGTAGAGCCAGG - Intergenic
1004083958 6:12425691-12425713 CCATCCCAACAGGTAGACCCTGG - Intergenic
1005856451 6:29866688-29866710 TCATGTCCTCAGGGAGACCCAGG - Intergenic
1013052447 6:106549392-106549414 TCATGGCCACAGGTGGAGCCAGG + Intronic
1013606334 6:111752547-111752569 TCCTGGCCACAGGAAAAGCCAGG + Intronic
1022296394 7:29058716-29058738 TCATGCCAACAAGAAGAGCATGG - Intronic
1022314581 7:29233586-29233608 TCAGACCCACAGGAAGATCCAGG - Intronic
1022488033 7:30795299-30795321 TCATGACCACAGTTACACCCAGG - Intronic
1023309142 7:38865767-38865789 TCATGCCCAGGGGAAGAGACAGG + Intronic
1025249325 7:57341540-57341562 CCATGTCCACAGTTACAGCCAGG - Intergenic
1026059008 7:67009618-67009640 TAATGGCCACAGGCAGATCCAGG - Exonic
1026719080 7:72815424-72815446 TAATGGCCACAGGCAGATCCAGG + Exonic
1030304295 7:108003210-108003232 TCATGCGCATACGGAGAGCCGGG + Exonic
1032862716 7:135895952-135895974 ACATGCCCCCAGAAAGAGCCAGG + Intergenic
1033083959 7:138325128-138325150 TCATGCCCAGGGGAAGAGCTTGG - Intergenic
1033168453 7:139062432-139062454 TCCTTCCCACAGGCAGAGGCTGG + Intronic
1035412300 7:158654584-158654606 TCATGCAAACAGGTACAGTCAGG - Exonic
1049387862 8:142353413-142353435 TCCTGCCCACTGGGAGTGCCGGG - Intronic
1049488569 8:142879087-142879109 GCATCCCCACAGGATGAGCCTGG - Exonic
1053160725 9:35811609-35811631 ACAGGCCCAGAGCTAGAGCCTGG + Exonic
1058834847 9:108851930-108851952 CCATGCTCACAGGTAGAGAGAGG - Intergenic
1059352418 9:113675131-113675153 TAATGTTCAGAGGTAGAGCCAGG + Intergenic
1059958710 9:119544617-119544639 TCTGGCCCACAGGGAGAGCCTGG - Intergenic
1060211934 9:121715927-121715949 TAATGCCCACAGGAAATGCCTGG - Intronic
1060398791 9:123335307-123335329 TCATGCCTACAGTTAGAGGAAGG + Intergenic
1061037557 9:128122071-128122093 TGATGGCGACAGGTAGAGCTTGG + Intronic
1061281836 9:129602035-129602057 GCAGGCCCCCAGGTAGACCCAGG + Intergenic
1061814688 9:133187662-133187684 TCAGCTCCAGAGGTAGAGCCCGG - Intergenic
1190585108 X:51932249-51932271 TGGTGCCCACTGGAAGAGCCAGG - Intergenic
1191184048 X:57591829-57591851 GAAAGCCCAGAGGTAGAGCCTGG - Exonic
1191213343 X:57910618-57910640 GAAAGCCCAGAGGTAGAGCCTGG + Exonic
1192222846 X:69209150-69209172 TCCTGCCCACAGTTGGACCCAGG + Intergenic
1192493643 X:71598385-71598407 TCATTCCCACACATAGAGCGGGG - Intronic
1198622342 X:138527679-138527701 TCATTCTCACAGGTAGATGCAGG - Intergenic