ID: 1095945130

View in Genome Browser
Species Human (GRCh38)
Location 12:47749369-47749391
Sequence AGGTGCTGCTGCTGGGGTTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 894
Summary {0: 1, 1: 1, 2: 8, 3: 98, 4: 786}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095945130_1095945138 15 Left 1095945130 12:47749369-47749391 CCCCAACCCCAGCAGCAGCACCT 0: 1
1: 1
2: 8
3: 98
4: 786
Right 1095945138 12:47749407-47749429 AGTCCTGCTTGTCCACACGCAGG 0: 1
1: 0
2: 0
3: 6
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095945130 Original CRISPR AGGTGCTGCTGCTGGGGTTG GGG (reversed) Exonic
900104405 1:976174-976196 AGGAGCTGGGGCTGGGGCTGTGG + Exonic
900149300 1:1171213-1171235 AGGGGAGGCTGCAGGGGTTGGGG + Intergenic
900165616 1:1243245-1243267 AGGAGTGGCTGCTGGGGCTGGGG + Intronic
900188387 1:1343315-1343337 AGGTGCAGCTGCTGCTGCTGAGG - Intronic
900457657 1:2785357-2785379 CAGTGCTGTTTCTGGGGTTGGGG - Intronic
900551623 1:3259279-3259301 AGGGGCTGCAGCTGGGGCTGGGG + Intronic
900584575 1:3426303-3426325 AGGGGCTGGTGCTGGGGTGGAGG - Intronic
900644304 1:3702141-3702163 AGATGCTGGTGCTTGGATTGGGG + Intronic
900895743 1:5481753-5481775 AGGTGGTTCTGCTGGAGGTGTGG - Intergenic
900927174 1:5713011-5713033 AGGTGCTGTTGTAGGGGCTGGGG - Intergenic
901192146 1:7418976-7418998 AGGAGCTGCTGCAGGGTTTCTGG - Intronic
901296685 1:8166239-8166261 AGTGGCTGCTGCAGGGGGTGGGG + Intergenic
901836209 1:11925797-11925819 CGGTGCTGCTGCTGCGGGAGGGG - Exonic
901842171 1:11960634-11960656 TGGTGCTGCTCCTGGGGTTGGGG - Exonic
902681877 1:18049448-18049470 TGGTGATGCTGCTGGGCTGGTGG + Intergenic
902982651 1:20137082-20137104 AGTTGCTTCTAATGGGGTTGGGG + Intergenic
902995738 1:20223417-20223439 GGGTGCTGATGGTGGGGATGGGG - Intergenic
903144554 1:21362577-21362599 AGGGGCTGTGGGTGGGGTTGCGG + Intergenic
903376512 1:22869794-22869816 AGGCCATGGTGCTGGGGTTGGGG - Intronic
903761324 1:25700845-25700867 TGGTGCTGCAGATGGGGTTGGGG + Intronic
903786383 1:25863900-25863922 AGCTGCTGCTCGTGGGGGTGAGG - Intronic
903911642 1:26731227-26731249 GGCTGCTGCTGCTGAGGGTGAGG - Exonic
904003111 1:27349717-27349739 AGGAGCTGCTGCTGAGCATGCGG - Exonic
904305290 1:29585049-29585071 AGGGGCTGTTGCTGGAGCTGTGG + Intergenic
904333569 1:29783264-29783286 AGGTGCTTCAGCTTTGGTTGTGG + Intergenic
904507095 1:30966158-30966180 TTGGGCTGCTGCTGGGGCTGGGG + Exonic
904529953 1:31161765-31161787 AGGTGCTGGGGATGAGGTTGGGG + Intergenic
904857539 1:33510366-33510388 AGGTGCTTCTGCTGGAGTGAGGG + Intergenic
905169403 1:36100174-36100196 TGGTGCTGGTGCTGGGGTGTGGG - Exonic
905202144 1:36322576-36322598 GGGTGCTGCTGCGGGGGTCCCGG + Exonic
905262714 1:36730818-36730840 AGGTGCTGATCCTGGGGGTGCGG + Intergenic
905908876 1:41640260-41640282 AGCTGCTGGGGCGGGGGTTGGGG + Intronic
906156432 1:43616783-43616805 CTGTGCTGCTGCTGAGGTTATGG + Intronic
906460918 1:46034724-46034746 AGGTGAAGCTGTTGGGGGTGGGG - Exonic
906613538 1:47219836-47219858 AGCTGCCGCAGCTGGAGTTGGGG + Exonic
906797850 1:48711806-48711828 GGGTGCTGCTTCTGGGGTCCAGG - Intronic
907664896 1:56426155-56426177 AGCTGCTGCTGTTGGGGAGGGGG - Intergenic
908439713 1:64141604-64141626 TGGTGCTGCTGATGGGGTAGGGG - Intronic
910898589 1:92095021-92095043 GGGTCTTGCTGATGGGGTTGGGG + Intronic
910966903 1:92816973-92816995 AGGTGCTGCTGTGGAGGGTGAGG - Intergenic
911359884 1:96863091-96863113 CTGTGCTGCTGCTGGGGGCGTGG + Intergenic
912229619 1:107776907-107776929 AGAATCTGCTGCTGGAGTTGTGG - Intronic
912719215 1:112005590-112005612 AGATGCTGCTGAGGGAGTTGTGG + Intergenic
913538145 1:119793959-119793981 CAGTGCTGTTGCTGGGGTGGAGG + Intergenic
914213991 1:145608015-145608037 AGGTGCTGCAGCCGGGACTGCGG - Exonic
914465935 1:147928418-147928440 AGGTGCTGCAGCCGGGACTGCGG - Exonic
914899878 1:151706256-151706278 TGCTGCTGCTGCTGCTGTTGAGG + Exonic
915043141 1:152985270-152985292 ACCTGCTGCTGCTGAGGCTGAGG - Exonic
915909861 1:159908252-159908274 ATCTGGTGCTGCTGGGGGTGAGG + Intergenic
916240587 1:162634956-162634978 GGCTGCTGCTCCTGGGGTGGGGG + Intronic
916505159 1:165422135-165422157 AGCTGGTCCTGCTGGAGTTGAGG - Intronic
916609168 1:166373442-166373464 ATGTGCTGGTGCTGGGGGTGAGG + Intergenic
917124157 1:171670976-171670998 TGGCGCTGCTGCTGGGGCAGCGG + Intergenic
917136804 1:171795956-171795978 AGGAGCTGCTAGTGGGGCTGAGG - Intronic
917834673 1:178931953-178931975 AGCCGCTGCTGGTGGGGTTCGGG - Intergenic
917977224 1:180247982-180248004 AGCTGCTGCTGCTAGCCTTGTGG + Intronic
918067157 1:181109197-181109219 GGGGGCTGCTGATGGGGATGGGG - Intergenic
918257860 1:182766239-182766261 AGATGCTGGTGCTGGGGGTAGGG - Intergenic
919706638 1:200682476-200682498 TGGGGCTACAGCTGGGGTTGTGG + Intergenic
920372707 1:205489677-205489699 AGGTGCAGCTGCAGGACTTGGGG - Intergenic
920524764 1:206658612-206658634 AAGTGCAGCCGCAGGGGTTGGGG - Intronic
920664003 1:207946912-207946934 TGTTGATGCTGCTGGGGATGAGG + Intergenic
920967458 1:210712916-210712938 TGGCTCTGCTGCTGGGGTTGGGG - Intronic
921217549 1:212950657-212950679 TGCTGCTGCTGCTGGGCCTGGGG - Exonic
921266590 1:213425825-213425847 TGCTGCTGCTGCTGCGGTGGCGG + Intergenic
922074519 1:222230148-222230170 GGATGCTGCAGCTGGGGTTGGGG + Intergenic
922232698 1:223700351-223700373 GGGTGCTGGTGCTGGTGTGGAGG - Intergenic
922366113 1:224865236-224865258 AGGGGCTGGGGCTGGGGCTGGGG - Intergenic
922571220 1:226635705-226635727 GGGTTGTGCTGCTGGGGTGGGGG - Intronic
924623909 1:245685004-245685026 AGGGGCAGCTGCTGAGGTGGGGG + Intronic
1063017402 10:2092716-2092738 AGTTGCTGCTCCTGGAGGTGTGG - Intergenic
1063017651 10:2094688-2094710 TGAACCTGCTGCTGGGGTTGAGG - Intergenic
1063335864 10:5212860-5212882 AGGTGATGCTGCTGCTGTTCAGG + Intronic
1064972818 10:21083372-21083394 GGGTGCTGCTACTGGGGTGGAGG - Intronic
1067694472 10:48524595-48524617 AGAGGATGCTGGTGGGGTTGGGG - Intronic
1067715120 10:48684932-48684954 AGGGGCTGCAGCTGGGGATAGGG + Intronic
1067841422 10:49682548-49682570 AGTTGCTGCTGCTGGCGCAGGGG + Intronic
1068296796 10:55080977-55080999 TGCTGCTGCTGCTGGGGGTGGGG + Intronic
1068556611 10:58465495-58465517 AGGAGCTGCTGCTGACATTGTGG - Intergenic
1069515515 10:69073811-69073833 AGCTGCTTGTGCTGGGGTGGTGG + Intergenic
1069739649 10:70679320-70679342 AAGTGCTTCCTCTGGGGTTGTGG + Intronic
1069880812 10:71591893-71591915 TGGCGCTGCTGCTGGGACTGAGG + Intronic
1069895716 10:71679036-71679058 GGGTGTTCCAGCTGGGGTTGGGG + Intronic
1070280246 10:75043492-75043514 GCGTGCTGCTGGTGGGGTTCGGG - Intronic
1070391277 10:75972869-75972891 AGGGGCTGGGGCTGGGGCTGGGG + Intronic
1070553824 10:77513127-77513149 AGGTGGTGATGGTGGGGGTGGGG - Intronic
1071858638 10:89650376-89650398 AGGTCGTGCAGCTGGGGATGTGG + Intergenic
1071869875 10:89781822-89781844 CCATGCTGCTGCTGGGGGTGCGG + Intergenic
1071962534 10:90821279-90821301 TGGGGCTGCTGCTGGGGGTTGGG - Intronic
1072102320 10:92240289-92240311 CGCTGCTGCTGCTGGGGCTGGGG + Exonic
1072532549 10:96332803-96332825 GGTTGCTGCTGCTGGTGTTGGGG - Intronic
1072740828 10:97908103-97908125 AGGCACTGCTGCTGAGGATGGGG + Exonic
1072853616 10:98924122-98924144 AGGTACTGCTGTGGTGGTTGTGG + Intronic
1073089251 10:100920247-100920269 AGGGGCTGCTGCTGGTGGTGTGG + Intronic
1073176112 10:101558776-101558798 AGGTGGTGCTGGTGGTGGTGGGG - Intergenic
1073538588 10:104299901-104299923 AGATGCTGATGCTGAGGTTCAGG + Intronic
1075049973 10:119176251-119176273 AGGAGGCGCTGCTGGGGATGAGG + Intronic
1075093245 10:119454957-119454979 TTGTTCTGATGCTGGGGTTGGGG - Exonic
1075580483 10:123614112-123614134 AGGCTCTGCTCCTGGGGTTGAGG + Intergenic
1075889662 10:125936459-125936481 AGGAGGTACTTCTGGGGTTGTGG - Intronic
1076275021 10:129191474-129191496 AGGGGCTGGGGCTGGGGCTGGGG - Intergenic
1076546315 10:131247789-131247811 AGGTGGTGCTGCTGGTGGTGGGG - Intronic
1076687338 10:132204058-132204080 AGATGCTGCTGGGGGTGTTGTGG + Intronic
1077052920 11:575879-575901 AGGAGCTGCGGGCGGGGTTGCGG + Intergenic
1077073172 11:687073-687095 TGGTGCTGGTGGAGGGGTTGAGG - Intronic
1077528994 11:3086482-3086504 AGGGGCTGTGGCTGGGGTGGAGG - Intergenic
1077556328 11:3227828-3227850 GGGGGCTGCAGCTGGGGTCGGGG + Exonic
1077623348 11:3747972-3747994 ATATGCTGCTGCTAAGGTTGGGG + Intronic
1077877465 11:6320245-6320267 AGGTGTTGCTGGTGGTGTCGTGG + Exonic
1078105324 11:8354732-8354754 AGGAGCAGCAGCTGGGGCTGGGG + Intergenic
1078375517 11:10790233-10790255 AAGTGATGGTACTGGGGTTGGGG + Intergenic
1078855202 11:15201253-15201275 AGGTGTTGGTGCTGGGGTTCAGG + Intronic
1079084360 11:17434504-17434526 TGTTGCTGTTGCTGTGGTTGTGG - Intronic
1079102059 11:17547915-17547937 GGGTGCTGCGGCTGGGGAGGGGG - Intronic
1079149288 11:17883530-17883552 AGATGAAGCTGCTGGGGTTCAGG + Intronic
1080912008 11:36610823-36610845 TGCTGCTGCTGCTGCTGTTGTGG + Intronic
1081383881 11:42447951-42447973 AGGTGCTGCTGTTGAGGATATGG + Intergenic
1081574298 11:44309728-44309750 GGCTGCTGCTGCTGCGGCTGCGG + Exonic
1081783106 11:45727234-45727256 AGGTGATGCTGGTGGGATTTGGG - Intergenic
1081808170 11:45901130-45901152 AGGTGGGGCGGCTGGGGCTGCGG + Intronic
1081876223 11:46410151-46410173 AGGAGGTGCTGCTCTGGTTGAGG + Intronic
1081893828 11:46567796-46567818 GGGTGCTGCTGATTGGTTTGGGG - Intronic
1081914705 11:46723430-46723452 TGGTGCTGCTGTCGGGGTTGCGG - Exonic
1083200940 11:61120748-61120770 AGCTGCTTCTGCTGGGGGAGGGG - Intronic
1083742621 11:64718869-64718891 TTTTGCTGCTGCTGAGGTTGTGG - Intronic
1083803223 11:65058486-65058508 AGGTGTTGGGGCTGGGGCTGGGG - Exonic
1083959341 11:66005734-66005756 AGGTCCTGCTGCAGGTGTTCGGG - Intergenic
1084195089 11:67520030-67520052 AGGTGCGGCCACTGGGGCTGAGG - Exonic
1084323510 11:68386325-68386347 AGGTGCTGCTGCTGGCCCGGCGG + Exonic
1084325174 11:68396086-68396108 AGTGGCTGCTGCTGGGGTTGTGG + Intronic
1084328191 11:68413984-68414006 AGTTGCGGCTGCTGGGGTCCAGG - Exonic
1084489776 11:69471939-69471961 AGGGGCTGGGGCTGGGGCTGGGG - Intergenic
1084849733 11:71929091-71929113 AGGTGGTGCTGCTGGGGAACGGG + Exonic
1085426183 11:76406529-76406551 AGAAGCTGCAGCTGGGTTTGGGG - Exonic
1085467578 11:76734630-76734652 AGGTGCACCTTCTGGGCTTGTGG + Intergenic
1087038797 11:93778794-93778816 AGGTGCTGCTGGAGAGGATGTGG - Intronic
1087077814 11:94141979-94142001 ACCTGGGGCTGCTGGGGTTGGGG + Intronic
1087188568 11:95230147-95230169 AGTTCCTGAGGCTGGGGTTGGGG - Intronic
1087383276 11:97436484-97436506 AGGTGTTGCTGATGTGTTTGGGG - Intergenic
1087512815 11:99119778-99119800 AGCAGGTGCTGGTGGGGTTGTGG - Intronic
1087529768 11:99364866-99364888 AGGTGCTGTTGAGGGGTTTGGGG + Intronic
1087740870 11:101885228-101885250 AGGACTGGCTGCTGGGGTTGGGG - Intergenic
1088606831 11:111540881-111540903 CCGTGCTGCTGGTGGGGCTGCGG + Exonic
1088733593 11:112706507-112706529 AGGAGCACCTTCTGGGGTTGTGG + Intergenic
1089129829 11:116202932-116202954 AGATGCTCCTGCTGGGGTAGAGG + Intergenic
1089249003 11:117144289-117144311 AGGAGCTGCTGCTGGTGCTGGGG + Exonic
1089584560 11:119502261-119502283 CGGGGCTGCTGCTGCGGATGGGG + Intergenic
1089626028 11:119751578-119751600 AGGCGCTGCTGATGGGGCAGGGG + Intergenic
1090136495 11:124204475-124204497 GGCTGCAGCTGCTGGGGGTGGGG + Intergenic
1090211367 11:124923150-124923172 TGTTACTGGTGCTGGGGTTGTGG + Intronic
1090347614 11:126083870-126083892 ATGTGCACCTGCTGGGGCTGTGG - Intergenic
1090901730 11:131038030-131038052 AAGTGCTGCAGGTGGAGTTGGGG - Intergenic
1091274708 11:134342446-134342468 AGAGGCTGCTGCTGGGGCCGGGG - Intronic
1091300667 11:134505301-134505323 AGGGGCTGGGGCTGGGGCTGTGG - Intergenic
1091301262 11:134509673-134509695 AGGTGGCGGTGCTGGGGCTGAGG - Intergenic
1091398788 12:170505-170527 AGGGGCTCCTGCGGGGGTCGGGG + Intronic
1091624217 12:2110229-2110251 AGGTGCTGCTGCTGGGGACCAGG - Intronic
1091780121 12:3208389-3208411 AGGTGCAGCTGCAGGCCTTGGGG - Intronic
1092181332 12:6448946-6448968 AGGGGCTGGGGCTGGGGCTGGGG - Intronic
1092279644 12:7089667-7089689 AGGTGCTGGCACTGGGGCTGGGG + Exonic
1092287422 12:7136827-7136849 AGGTGCTGCCACTGGGGAGGTGG + Exonic
1092387572 12:8047956-8047978 TGCTGCTGCTGCTGCTGTTGAGG - Exonic
1092517646 12:9232341-9232363 AGGTGAGACTGCTGGGGTTTAGG - Intergenic
1092656479 12:10690098-10690120 GGCTGCTGCTTCTGGAGTTGAGG + Intergenic
1094026985 12:25969583-25969605 AGGTGCTGATGGTGGAGGTGGGG + Intronic
1094666166 12:32523222-32523244 AGGAGAGGCTGCTGAGGTTGGGG + Intronic
1095844825 12:46733086-46733108 TGTTGCTGCTACTGGGGATGGGG + Intergenic
1095921203 12:47532919-47532941 AGCTCCTGCAGCTGGGATTGAGG - Intergenic
1095945130 12:47749369-47749391 AGGTGCTGCTGCTGGGGTTGGGG - Exonic
1095947853 12:47763953-47763975 AGGTGGTGATGCTGGGCTGGAGG + Intronic
1095953137 12:47792159-47792181 AGGGGCTGGGGCTGGGGTAGGGG - Intronic
1095960751 12:47832972-47832994 AGGGGCAGCTTCTGGGGCTGAGG - Intronic
1096051783 12:48615887-48615909 AGGTGCAGCTGCTGTCTTTGTGG - Intergenic
1096053190 12:48629006-48629028 GGCTGCTGTCGCTGGGGTTGGGG - Intergenic
1096183664 12:49564991-49565013 TGGTGCTGAGGCTGGGGCTGGGG - Intronic
1096215307 12:49795105-49795127 TGGCGATGCTGCTGGTGTTGCGG + Exonic
1096812760 12:54182285-54182307 AGGTGCAGCTGCTGGGGGTGCGG - Exonic
1096870806 12:54590907-54590929 AGCAGCTGGTGCTGGGGTAGAGG + Intergenic
1097053578 12:56237631-56237653 ATGTGCTCCTGCAGGGGCTGGGG + Exonic
1097118847 12:56717786-56717808 AGGAGTTGCAGCTGGGGTTGTGG + Intronic
1097118873 12:56717855-56717877 AGGAGTTGCAGCTGGGGTTGTGG + Intronic
1097118898 12:56717924-56717946 AGGAGTTGCAGCTGGGGTTGTGG + Intronic
1097118922 12:56717993-56718015 AGGAGTTGCAGCTGGGGTTGTGG + Intronic
1097118946 12:56718062-56718084 AGGAGTTGCAGCTGGGGTTGTGG + Intronic
1097118971 12:56718131-56718153 AGGAGTTGCAGCTGGGGTTGTGG + Intronic
1097119046 12:56718338-56718360 AAGAGTTGCAGCTGGGGTTGTGG + Intronic
1097119072 12:56718410-56718432 AGGAGTTGCAGCTGGGGGTGTGG + Intronic
1097119121 12:56718551-56718573 AGGAGTTGCAGCTGGGGGTGTGG + Intronic
1097119146 12:56718620-56718642 AGGAGTTGCAGCTGGGGGTGTGG + Intronic
1097119172 12:56718689-56718711 AGGAGTTGCAGCTGGGGGTGTGG + Intronic
1097555991 12:61138349-61138371 AGGTGCTGCTGCTGAGGAAATGG + Intergenic
1098893189 12:76030693-76030715 GGGTGGAGCTGCTGGGGCTGAGG + Exonic
1098914877 12:76246851-76246873 AGCTGCCACTGCTGTGGTTGGGG - Intergenic
1099531285 12:83784557-83784579 AGGTTCTCCTGTGGGGGTTGTGG + Intergenic
1100887865 12:99092295-99092317 AGGGGGTGCGGCTGGGGTTGGGG + Intronic
1101412904 12:104483929-104483951 AGGGTCTGCTGCTGGGGTCAGGG + Intronic
1101716811 12:107319254-107319276 AGGCGCTGCTGCTGCGTTCGCGG + Exonic
1101953821 12:109196826-109196848 AGCAGCTGCTGATGGGGCTGGGG - Intronic
1102289308 12:111685905-111685927 AGCTGCTGCTGCTGAGGCGGCGG - Exonic
1102421678 12:112808338-112808360 AGCTGCCGCGGCTGGGGCTGAGG - Intronic
1102973892 12:117192229-117192251 TGGTGCTGGTGCTGGGGCGGGGG - Intergenic
1103535658 12:121632131-121632153 AGGGGCTGTGGTTGGGGTTGAGG + Intronic
1103682237 12:122703179-122703201 AGGTGTTGCCGCCGGTGTTGGGG - Exonic
1103683974 12:122716633-122716655 AGGTGTTGCCGCCGGTGTTGGGG - Exonic
1103724293 12:122990105-122990127 AGGAGCTGAGGCTGGGGTGGGGG - Intronic
1104049967 12:125188314-125188336 AGGGGCTGCTGCTGGGGCCGAGG + Intronic
1104624622 12:130340676-130340698 TGGTGCTGCTGCTGCTGCTGGGG + Intronic
1104841624 12:131828568-131828590 TGCTGCTGCTGCTGGCGCTGGGG + Exonic
1104878551 12:132053499-132053521 TGGGGCTGTGGCTGGGGTTGGGG - Exonic
1105007493 12:132730352-132730374 AGTTGCTGTTGCTGGGGTCACGG - Intronic
1105007506 12:132730415-132730437 AGTTGCTGTTGCTGGGGTCACGG - Intronic
1105028882 12:132868990-132869012 AGTGACTGCTGCTGGGGCTGAGG + Intronic
1105028892 12:132869029-132869051 AGTGACTGCTGCTGGGGTCGAGG + Intronic
1105432710 13:20351828-20351850 AGGTGCCTGTGCTGGGGGTGAGG - Intergenic
1105564482 13:21530768-21530790 TGGTGCTGCTGCTGGGGCGGTGG - Intronic
1106816286 13:33410851-33410873 TTGTGCTGATGCTTGGGTTGAGG - Intergenic
1106892985 13:34266606-34266628 ACTTGCTGCTTCTGGGGTGGGGG + Intergenic
1107184823 13:37505826-37505848 TGCAGCTGCTGCAGGGGTTGGGG - Intergenic
1107265338 13:38546520-38546542 AGGAACTGCAGCTTGGGTTGAGG + Intergenic
1107665861 13:42689785-42689807 AGGGGCTGGGGCTGGGGGTGGGG + Intergenic
1107817523 13:44257225-44257247 AGGAGCATCTGCTGGGGGTGGGG + Intergenic
1108360067 13:49661105-49661127 AGTTGCTGGTGTTGAGGTTGGGG + Exonic
1108552364 13:51559363-51559385 AGATGCTTGAGCTGGGGTTGAGG + Intergenic
1109305598 13:60637482-60637504 AGGTGCTGCTGTTGAGCTTTTGG + Intergenic
1109583502 13:64370394-64370416 AGTTGCTGGAGCTGGGGTTGGGG + Intergenic
1110933023 13:81246898-81246920 AGGTGCGGCTGCTGGAGCAGGGG + Intergenic
1111721231 13:91947805-91947827 TGCTGTTGCTGCAGGGGTTGGGG - Intronic
1113372676 13:109737324-109737346 AGCTGCTGCTGCAGGGGGTTGGG + Intergenic
1113391426 13:109900922-109900944 AGCTCCTGCTGCTGGCGTGGAGG + Intergenic
1113403605 13:110018303-110018325 AGAGGCTGCTGCTGAGGCTGAGG - Intergenic
1113903033 13:113806981-113807003 AGGGGCAGCGGCTGAGGTTGAGG - Intronic
1114183303 14:20382769-20382791 AGGGGCTGGTGCTGGGGCAGAGG - Intronic
1114199915 14:20510509-20510531 TGATGCTGCTGCTGGGCCTGGGG + Exonic
1114261901 14:21043030-21043052 TGCTTCTGCTGCTGGGGCTGTGG + Exonic
1114263634 14:21057927-21057949 TGCTGCTGCTTCTGGGGCTGTGG + Exonic
1114447156 14:22797646-22797668 GGAGGCTGCTGCTGGGGTGGGGG + Intronic
1114555010 14:23556813-23556835 AGGAGCGGCTGCAGGAGTTGGGG + Exonic
1114626367 14:24132618-24132640 ACGTGCTGCTGCTGGGCCTCTGG + Exonic
1116065698 14:39979987-39980009 AGGCTCTGCTTCTGGGGCTGGGG + Intergenic
1116725270 14:48554779-48554801 TGCTGCTGCTGCTGGGGGTGTGG + Intergenic
1117592345 14:57284110-57284132 AGGTGCTACAGCTGAAGTTGTGG + Intronic
1117755396 14:58969558-58969580 AGGTGGTGGTGCTGGGGATTTGG + Intergenic
1118308327 14:64674394-64674416 AGGGTCTGGTGGTGGGGTTGGGG + Intergenic
1118774448 14:68964998-68965020 AGATGAAGCTGCTGGGGTTCTGG - Intronic
1119724494 14:76913899-76913921 GGGTGCTTCTGCTGGCCTTGAGG - Intergenic
1121115464 14:91339773-91339795 CGGTCCTGCTGCTGAGGTTCTGG - Intronic
1121465287 14:94111789-94111811 AGGGGCTGGTGCTGGGGGCGAGG + Intronic
1121554903 14:94829126-94829148 AGGTGAGGCTGCAGGGGCTGGGG - Intergenic
1121568219 14:94926365-94926387 AGGTGCTGCTCCTGAGGAAGCGG + Intergenic
1122321449 14:100858302-100858324 AGGTGCTGCTGCAGTGGCAGGGG + Intergenic
1122364081 14:101183907-101183929 AGCTGCTGGGTCTGGGGTTGGGG - Intergenic
1122687065 14:103514102-103514124 AGGTGCTGCTGCTGTGACTTGGG + Intergenic
1122767343 14:104081541-104081563 AGGTGCTGCTGCTGGAGCGGAGG + Intergenic
1122875811 14:104664409-104664431 AGGGGCTGCAGGTGGGGTGGGGG - Intergenic
1123015137 14:105369929-105369951 AGGTGCTGTTGCAGGCGTGGGGG - Intronic
1202905434 14_GL000194v1_random:68854-68876 AGGTCCTGCATCTGGGGTAGGGG + Intergenic
1123735593 15:23180046-23180068 AGGAGCTGCTGCCGGGGCGGGGG + Intergenic
1124286309 15:28403029-28403051 AGGAGCTGCTGCCGGGGCGGGGG + Intergenic
1124296394 15:28508607-28508629 AGGAGCTGCTGCCGGGGCGGGGG - Intergenic
1126673369 15:51136571-51136593 CTGTGCTGAAGCTGGGGTTGGGG + Intergenic
1127601677 15:60543789-60543811 AGGGGCTGCAGCTGGAGTTGAGG + Intronic
1128220914 15:65967916-65967938 ATGTGCTGCTCCAGGGGCTGGGG - Intronic
1128333772 15:66773192-66773214 AGGTGCTGGAGCTGAGGTGGGGG + Intronic
1128732673 15:70031669-70031691 TGGAGCTGGTGCTGGGGTTGTGG + Intergenic
1128739831 15:70075989-70076011 AGGGGCTGAGGCTGGGGCTGGGG + Intronic
1128998475 15:72314363-72314385 AAGTACTACTGTTGGGGTTGGGG - Intronic
1129359575 15:75016272-75016294 AGGAGTGGGTGCTGGGGTTGAGG + Intronic
1129412997 15:75360096-75360118 AGGTGCTGCAGCTGGGCTGCTGG + Exonic
1129532261 15:76277858-76277880 AGGAGCTGGTGGTGGGGTAGGGG - Intronic
1129660353 15:77549688-77549710 TGGCTCAGCTGCTGGGGTTGGGG + Intergenic
1129714932 15:77841606-77841628 TGGGGCTGCTGGTGGGGTTAGGG + Intergenic
1129829933 15:78661982-78662004 AGGTGCTTATGCTGGGGTGGGGG + Intronic
1130928442 15:88402430-88402452 AGCTGCTGCTGCTGGGGTAGGGG + Intergenic
1130981492 15:88814825-88814847 AGGTGCTGGTGCAGGGCTGGGGG + Intronic
1131120945 15:89823095-89823117 CAGGGCTGCTGCTGGGGCTGGGG + Intergenic
1131279582 15:91009699-91009721 AGGAGCTGGTGGTGGGGGTGGGG + Intronic
1131303617 15:91221789-91221811 AGGTCCTCCTGGTGGGGATGTGG - Intronic
1131569738 15:93522565-93522587 AGGCTCTGCTGCTGGGGTGAGGG + Intergenic
1131745553 15:95443394-95443416 GGGTGGGGCTGCTGGGGCTGTGG + Intergenic
1131873369 15:96781991-96782013 AGGTGCTCCTGCTAGGGTTTTGG + Intergenic
1132500911 16:284332-284354 AGAGGGTGCTCCTGGGGTTGTGG + Intronic
1132858677 16:2058950-2058972 GGGTCCTGCTGCGGGGGCTGCGG + Intronic
1132897434 16:2235795-2235817 AGGTGCTGCTGCGGGGGCCTGGG - Exonic
1133000632 16:2849785-2849807 AGGTGATGCTGGTGGGGCAGAGG + Intergenic
1133138570 16:3728952-3728974 ATGGGCTGCTGCTGGGGAAGGGG + Exonic
1133281865 16:4671201-4671223 AGGTGCTGCTGGTTGGGTGGGGG + Intronic
1134102473 16:11461790-11461812 TGGTGCTGGAGCTGGGGTAGTGG - Intronic
1134138552 16:11696925-11696947 AGGTGGTGTGGCTGTGGTTGTGG - Intronic
1134227105 16:12399712-12399734 TGGGGCAGCTGCTGGGGTCGGGG + Intronic
1134439445 16:14289421-14289443 GGGCTCTGATGCTGGGGTTGGGG + Intergenic
1134531843 16:14989720-14989742 CGGTGCTGCTGCTGCGGGAGGGG - Intronic
1134606977 16:15579014-15579036 AGTTGCTGCAGCTGAGGCTGGGG + Intronic
1134692793 16:16202031-16202053 AGGTGCTGCAGATGAGGTTGCGG - Exonic
1135716751 16:24777112-24777134 GGCTGCTGCTGCTGCGGCTGCGG - Exonic
1136340591 16:29640564-29640586 AGGTGCTGCAGATGTGGGTGGGG + Intergenic
1136554819 16:31001482-31001504 GGGTGCTGGGGCTGGGGCTGGGG + Intronic
1136574892 16:31117693-31117715 GGGAGCTGCTGCGGCGGTTGCGG + Exonic
1137405345 16:48184724-48184746 AGGCCCTGCTGCTGGGAGTGGGG - Intronic
1137958051 16:52852894-52852916 GGTTGCTGCTGCCGGGGTTGAGG - Intergenic
1138185247 16:54971781-54971803 AGATACTGCTGCTGGAGTAGGGG + Intergenic
1138290219 16:55840350-55840372 AGGTGGTGGTGATGGGGATGTGG - Intergenic
1138530407 16:57631506-57631528 AGGAGGTGGTGCTGGGGTTTGGG - Intronic
1138977213 16:62222009-62222031 AGAGGCTGGGGCTGGGGTTGGGG + Intergenic
1139140847 16:64260708-64260730 AGTTGCTGGTGTTGAGGTTGGGG + Intergenic
1139323121 16:66131333-66131355 AGGTGCTGCTTCAAGGGATGTGG - Intergenic
1139628262 16:68209473-68209495 AGGTGTTGCTGCTGGAGGTGTGG + Intronic
1139917697 16:70438652-70438674 TGGGGCTGGGGCTGGGGTTGGGG + Intronic
1140497326 16:75400528-75400550 AGGTGCTGCTGAAGGGGATCTGG - Intronic
1141389567 16:83653164-83653186 AGTGGCTGCTCCTGGGGGTGGGG + Intronic
1141426987 16:83951176-83951198 AGGGGCTGGGGCTGGGGCTGGGG - Exonic
1141598603 16:85112226-85112248 AGGGCCTGCTGCTTGGGGTGGGG - Intronic
1141620904 16:85236015-85236037 TGGGGCTGCGGCTGGGGCTGGGG + Intergenic
1141868947 16:86771352-86771374 AGGGACTCCAGCTGGGGTTGAGG - Intergenic
1141967069 16:87452810-87452832 AGGTGCAGGTGCTGAGGCTGGGG + Intronic
1142167132 16:88598104-88598126 AAGGGCAGCTGCTGGGGTGGGGG - Intronic
1142199638 16:88754948-88754970 AGGTTCAGCTGCTGGGCCTGGGG - Intronic
1142284982 16:89167980-89168002 AGGGGCTGCTGGTGGGGGCGGGG - Intergenic
1142376742 16:89710621-89710643 AGCTGCTGCAGCTGGGGCTCCGG + Exonic
1142733615 17:1880057-1880079 AGGAGGAGCTCCTGGGGTTGGGG + Intronic
1142780289 17:2176244-2176266 AGGTGCTCCTGGTTGGGATGAGG - Intronic
1142811176 17:2396309-2396331 TGGCGCTGCTGCTGGTGGTGGGG - Intronic
1142849012 17:2695407-2695429 AGGTGCTGGAGCTGGTGCTGCGG - Exonic
1143174484 17:4948418-4948440 CGGCGCTGCTGCTGGGGCCGCGG + Exonic
1143256279 17:5560297-5560319 AGGTGCTGCTATAGGGGTTGGGG + Intronic
1143369257 17:6428306-6428328 AGCTGCTGCAGGTGGGGCTGGGG - Exonic
1144275918 17:13667938-13667960 GGTTGCTGCTGCCGGGGCTGAGG + Intergenic
1144398123 17:14865771-14865793 AGGTGCAGCAGCTCTGGTTGTGG - Intergenic
1144588169 17:16501409-16501431 AGATGCTGCTGGTCAGGTTGAGG + Intergenic
1144723838 17:17491385-17491407 AGCTGCTGCTGCTGCTGTTCGGG - Exonic
1144765498 17:17730385-17730407 AGGCAGTGCTGATGGGGTTGTGG + Intronic
1144996924 17:19276111-19276133 AGGTGTGGCTGGTGGGGTGGTGG + Intronic
1145259163 17:21344364-21344386 AAGTGTGGCTGCTGGGGCTGAGG + Intergenic
1145963807 17:28902918-28902940 AGGCGCTGCTGCTGGGCGCGGGG - Exonic
1146062798 17:29615847-29615869 GTGTGCTGCTGCTGGGGCGGAGG + Exonic
1146373598 17:32280294-32280316 AGGTGCTCCTGATGGGGTCTGGG - Intronic
1146374702 17:32286174-32286196 AGGTGCTGGGGCTGTGGCTGTGG - Intronic
1146489009 17:33266547-33266569 ATGTGCTGCAACTGGGGGTGGGG - Intronic
1146952242 17:36914863-36914885 AGGTGCTGCTTCAGGGGCTGGGG + Intergenic
1147363688 17:39946640-39946662 GGGTGCTCCTGCTGGGCTGGAGG + Intergenic
1147625721 17:41898633-41898655 ATGTGCTCCCGCTGGCGTTGAGG + Exonic
1147746619 17:42698834-42698856 AGGGGCTGGGGCTGGAGTTGGGG - Exonic
1147886779 17:43689663-43689685 CACTGCTGCTGCTGGGCTTGTGG - Intergenic
1147915454 17:43882859-43882881 AGGTGGTGCTGGTGAGGGTGGGG - Intronic
1147925145 17:43941364-43941386 AGGGGCTGGGGCTGGGGCTGGGG + Intronic
1148132213 17:45268919-45268941 AGGTGCTGCTGATGGGCATGTGG - Intronic
1148134540 17:45283851-45283873 AGGTCCTGGTGCTGGCTTTGAGG + Intronic
1148190055 17:45672136-45672158 AGGGGCAGCTGCTGGAGCTGGGG - Intergenic
1148346805 17:46908692-46908714 AGGTGCTGACCCTGGGGATGTGG - Intergenic
1148437989 17:47696954-47696976 AGGAGCTGCAGCTGGGCTTAGGG - Intronic
1149286692 17:55172964-55172986 AGGTGCTCCAGCAGGGGTTTTGG - Intergenic
1149310137 17:55385475-55385497 AGATGCTGCTCCTGGTGTTGAGG - Intergenic
1151156115 17:72123884-72123906 GGGGGCTGCTGCGGGGGTGGCGG - Exonic
1151162291 17:72175820-72175842 AGGGGGTGGTGCTGGGGGTGGGG - Intergenic
1151277399 17:73045966-73045988 GAGTGGTGATGCTGGGGTTGGGG - Intronic
1151292082 17:73157577-73157599 AGGAGCTGCTGCTGGGGGGTGGG - Intergenic
1151314126 17:73311543-73311565 GGGTGCCGCTGAGGGGGTTGGGG - Intronic
1152033104 17:77855765-77855787 AGAGGCAGCTGATGGGGTTGAGG + Intergenic
1152146498 17:78571873-78571895 CGGTGCTGCTGCTGGTGGTTTGG - Intronic
1152294761 17:79460344-79460366 GGAAGCTGCTGCTGGAGTTGAGG - Intronic
1152460451 17:80439494-80439516 CTGGGCTGCTGCCGGGGTTGGGG - Intergenic
1152484131 17:80578686-80578708 AGGTGCTGCTGCTAGGGCTGGGG + Intronic
1152526943 17:80893738-80893760 TGGCGCTGCTGCTGGTGCTGAGG - Exonic
1152661703 17:81545424-81545446 GGCTGCTGCTCCTGGGGTAGAGG + Intronic
1152683414 17:81681930-81681952 AGGTGGTGCAGCTGGGGGTCCGG - Intronic
1152687229 17:81700644-81700666 AGGGGCTGGGGCTGGGGCTGGGG - Intronic
1152816395 17:82410588-82410610 AGGTTCCTCTGCAGGGGTTGTGG - Intronic
1152930539 17:83107494-83107516 AGGTGCCCCTGCTGGGATGGGGG + Intergenic
1153006855 18:504761-504783 GGCTGCTGCTTCTGGGGGTGGGG - Intergenic
1153075506 18:1157479-1157501 AGCTGCCACTGCTGGGGGTGGGG - Intergenic
1154109846 18:11557833-11557855 AGGGGCAGCTCCTGGGGCTGAGG + Intergenic
1154217906 18:12428998-12429020 AGGTGCAGGGGATGGGGTTGGGG + Intronic
1154263901 18:12862671-12862693 AGGTTTTGCTGCCGGGGGTGAGG + Intronic
1155337331 18:24777964-24777986 GGGTGCTTCTACTGGGGATGAGG + Intergenic
1155525733 18:26714589-26714611 AGAGGCTGCCGCTGGGGGTGTGG + Intergenic
1155627348 18:27849857-27849879 AGGTGCTGCTGCTGCTGCTGGGG + Intergenic
1155961975 18:32002668-32002690 AGGTCCTGTTGCGGGGTTTGAGG - Intergenic
1156305515 18:35874966-35874988 AGGGGCTGTTGCAGGGTTTGAGG - Intergenic
1156642528 18:39119649-39119671 TGAGGCTGCTGCTGGGATTGTGG - Intergenic
1156661203 18:39348750-39348772 ATATGCTGCTGCAGGAGTTGAGG + Intergenic
1157687034 18:49650953-49650975 AGGTGCGGCGGCTGGGGGTTCGG + Intergenic
1159022553 18:63155490-63155512 GGGTCCAGCTGCTGGGGTGGAGG + Intronic
1159069746 18:63610583-63610605 AGGGGCTGGGGCTGGGGCTGGGG + Intergenic
1159400548 18:67927666-67927688 AGATGCTGCTGCTAAGGTTGTGG + Intergenic
1159478848 18:68960457-68960479 AGCTGCTCTTCCTGGGGTTGGGG + Intronic
1160060086 18:75521894-75521916 AGGTGCTGCGGCAGGGCTGGAGG - Intergenic
1160441481 18:78896162-78896184 TGCTGCTGCTGCTGCGGCTGAGG - Intergenic
1160674545 19:382731-382753 TGTTGCTGTTGCTGGGGCTGTGG + Intergenic
1161042532 19:2117638-2117660 AGGTGGTGCTTCTGGTGTCGGGG - Intronic
1161398540 19:4057840-4057862 GGGTGCTGCCGGTGGGGTTCGGG - Intronic
1161412510 19:4124198-4124220 AGGCGCGGCGGCTGGGGGTGGGG - Intergenic
1161453385 19:4358839-4358861 AGGTGTCACTGCTGGGGATGAGG + Intronic
1161785475 19:6322605-6322627 AGGAGCTGAGTCTGGGGTTGAGG - Intronic
1162321099 19:9970930-9970952 TGGTGCTGAGGCGGGGGTTGGGG - Intronic
1162545292 19:11325403-11325425 AGCTGCAGCTGCTGGGCTGGGGG + Exonic
1162570102 19:11466587-11466609 AGGTGTGGCTGCTGGAGTTGCGG - Exonic
1162789066 19:13053799-13053821 ACCTGCCACTGCTGGGGTTGAGG + Intronic
1162861017 19:13505898-13505920 CGCAGCTGCTGCTGGGGTTCGGG + Intronic
1162904942 19:13817809-13817831 AGGTGGCACTGCTGGGGCTGGGG + Exonic
1162919141 19:13890004-13890026 AGGAGCTGATGCTGGGGTACAGG + Exonic
1163125677 19:15243097-15243119 TGATGCTGCTGCTGGGGTGGAGG + Exonic
1163365126 19:16871653-16871675 AGTGGCTGCTGATGGGGATGGGG - Intronic
1163500259 19:17672093-17672115 AGGTGCTGGTGGTGGGGGAGGGG - Intronic
1163740602 19:19009569-19009591 GGGTCCTGCTGCTGGGGCCGTGG - Intronic
1163823106 19:19507572-19507594 AGGAGCTGGAGCTGGGGCTGGGG - Exonic
1165077798 19:33290461-33290483 GGGACCTGCTGCTGGGGGTGGGG - Intergenic
1165313370 19:35041282-35041304 AGAGGCTGGGGCTGGGGTTGGGG + Intronic
1165403979 19:35618889-35618911 AGGTGCTGATACTGGGGCTTCGG + Exonic
1165631313 19:37304470-37304492 CGCTGCTGCTGCTGGGAGTGGGG + Intergenic
1165833019 19:38738462-38738484 AGGTGCGGCTGCTGCGGCTGCGG - Exonic
1165927485 19:39335927-39335949 AAGAGCTGGGGCTGGGGTTGGGG - Intronic
1166599909 19:44084499-44084521 TGGCCCTGCTGCTGGGGGTGAGG + Intronic
1166944890 19:46390559-46390581 AGGTGGAGCAGCTGGGGCTGGGG + Exonic
1167557843 19:50206607-50206629 AGCTGGAGCTGCTGGGCTTGGGG + Intronic
1167578938 19:50330898-50330920 AGCGGCTGCGGCTGGGGCTGCGG + Intronic
1167752398 19:51388837-51388859 AGGAGCTACTCCTGGGATTGTGG + Exonic
1168335943 19:55597827-55597849 CGGTGCTGGTGCAGGGGTTGGGG + Exonic
1168436165 19:56319054-56319076 AGTTGATTCTGTTGGGGTTGGGG - Intronic
1168543787 19:57233533-57233555 AGAACCTGCTGCTGGGGTTCAGG + Exonic
924987783 2:287785-287807 TGGGGCTGCTGCTGGTGCTGGGG - Exonic
925106443 2:1296415-1296437 AGAGGCTGCTGCTGGGGCAGGGG - Intronic
925183620 2:1832465-1832487 CCGTGCAGCTGCTGGGGCTGGGG + Intronic
925191954 2:1892246-1892268 TGCTGCTGCTGCTGGGGCTGGGG + Exonic
925256666 2:2495507-2495529 AGTTGCTGCTCCTGGGATGGGGG + Intergenic
925286674 2:2720921-2720943 AGGTGCAGGTGCTGGAGGTGTGG - Intergenic
925286805 2:2721431-2721453 AGGTGCAGATGCTGGTGGTGTGG - Intergenic
925286869 2:2721669-2721691 AGGTGCAGGTGCTGGTGGTGTGG - Intergenic
925728499 2:6898288-6898310 AGGTGGTGGTGGTGGGGGTGGGG - Intergenic
926706552 2:15841704-15841726 AGATTCTGATCCTGGGGTTGTGG + Intergenic
926803831 2:16686198-16686220 AGGAGATGTTGCTGGGGTTGGGG + Intergenic
927187170 2:20490219-20490241 GGATGCTGCTGCTGGAGGTGTGG + Intergenic
927616061 2:24597499-24597521 AGGGGCTGGGGCTGGGGCTGGGG + Intronic
927674351 2:25093603-25093625 TGATGCTGCTGCTGAGGTTTGGG + Intronic
927937123 2:27082398-27082420 AGGGGCTGAGGCTGGGGCTGGGG - Exonic
928282911 2:29964459-29964481 AGGGGCTGCTGCTGGGGCTCAGG - Intergenic
928607223 2:32953962-32953984 AGGAGCTGCCGATGGGGTGGGGG + Intronic
929526002 2:42703466-42703488 AGTTCCTGCTGCTGGTGTGGGGG - Intronic
929779227 2:44947053-44947075 TGCTGGTGCTGCTGGGGATGGGG - Intergenic
929974361 2:46617236-46617258 TGCTGCTGCTGCTGCTGTTGCGG + Exonic
930155938 2:48107699-48107721 AGGGGCTGCAGCAGGGGCTGAGG - Intergenic
931309611 2:61065912-61065934 AGGCGCTGCGGACGGGGTTGCGG + Exonic
931440243 2:62285179-62285201 GAGTGCTGCTGATTGGGTTGAGG + Intergenic
931704845 2:64938668-64938690 AGGTGCTGCTCTAGGTGTTGGGG + Intergenic
932594118 2:73083636-73083658 AAGGGCATCTGCTGGGGTTGAGG - Intronic
932822791 2:74915653-74915675 AGATGCTGCTTCTGGGTCTGAGG + Intergenic
933285561 2:80381161-80381183 GGGTGTTGGTGCTGGGGTTGGGG + Intronic
933586535 2:84185615-84185637 AGGTGGTGGTGCTCTGGTTGAGG - Intergenic
934605698 2:95693659-95693681 AAGTGCTGCTGGGGAGGTTGTGG + Intergenic
935332096 2:101984877-101984899 ATGTCCTGCTGCTGGGGTCTGGG + Intergenic
935431827 2:102984317-102984339 AGGTCCTGGGGCTGGGGATGGGG + Intergenic
936684440 2:114811479-114811501 TGATGCTGATGGTGGGGTTGTGG - Intronic
936987543 2:118325895-118325917 CGGTTCTGCCTCTGGGGTTGAGG - Intergenic
937021876 2:118664763-118664785 AGCTCTTGCTGCTGGGGTGGTGG - Intergenic
938076300 2:128340477-128340499 TGGTGCTGGTGCTGGTGGTGGGG + Intergenic
938076540 2:128341242-128341264 TGGTGCTGGTGCTGGTGGTGGGG + Intergenic
938142550 2:128808763-128808785 AGGTTGGGCTGCTGAGGTTGCGG + Intergenic
939244939 2:139610732-139610754 TGCTGCTGCTGCTGGGGGAGGGG + Intergenic
941018866 2:160387215-160387237 AGCTGCAGCAGCTGGGGATGCGG + Intronic
942044397 2:172090912-172090934 TGGTGGGGCTGCTGGGGGTGGGG + Intergenic
943441268 2:187931334-187931356 AAGGGCTGCTGCAGGGTTTGAGG + Intergenic
943972421 2:194428088-194428110 AGGTGCTGGGGCAGGGGTGGGGG + Intergenic
944735092 2:202555895-202555917 AGGTTCTGCTGCTTGGGGAGAGG - Exonic
944935222 2:204560844-204560866 AGGTCCTGCTGTTGGAGTGGAGG + Intronic
945478380 2:210314971-210314993 AGGTGCCGGTGCCGGGGCTGGGG + Exonic
946165110 2:217858964-217858986 AGGGGCTGGGGCTGGGGCTGGGG - Intronic
946275997 2:218632268-218632290 AGGTTCTGCTCCTGGGGCTCAGG - Exonic
947722587 2:232378828-232378850 TGCTGCTGCTGCTGGGCCTGAGG + Exonic
947736076 2:232456216-232456238 TGCTGCTGCTGCTGGGCCTGAGG + Exonic
948116172 2:235495258-235495280 AAGTGCTGCCGCTGGGGGCGAGG + Intronic
948311913 2:236993829-236993851 AGGTGATGCTGGTGGGGTGCTGG - Intergenic
948497258 2:238359373-238359395 AGGGGTGGCTGCTGGGGTTGGGG - Intronic
948575836 2:238949082-238949104 TGGTGCTGGTGCTGTGGATGAGG + Intergenic
948686871 2:239675466-239675488 AGGTGATGGTGCTGGGGGAGTGG + Intergenic
948788155 2:240363797-240363819 AGGTGCAGCTGCTGTCCTTGGGG - Intergenic
948808166 2:240461837-240461859 AGGGGCTGCTGGTGGAGATGGGG - Intronic
949018750 2:241728607-241728629 AGGTGCTGCTGCTGGGGACATGG + Exonic
1168827214 20:821995-822017 AGGTGCTGCAGTAGGGGATGGGG - Intergenic
1169201435 20:3712193-3712215 AGGGGCTGGGGCTGGGGCTGAGG + Intergenic
1169211014 20:3766441-3766463 AGGTGCTGGGGGTGGGGGTGGGG + Intronic
1169667202 20:8050614-8050636 AGGTGCGAATGCTGTGGTTGGGG - Intergenic
1169758843 20:9069171-9069193 TGGAGCTGCTGCCGGGGATGCGG - Intronic
1171532968 20:25864203-25864225 TGTTGCTGGTGCTGGGGCTGGGG - Intronic
1171878493 20:30599250-30599272 TGGGGCTGCTGCTGGGATTCAGG + Intergenic
1172012053 20:31851268-31851290 AGATGCTGATGCGGGGGTGGGGG + Intronic
1172507782 20:35476761-35476783 AGGTGGTTCTGCTGGAGGTGTGG - Intronic
1172624632 20:36340192-36340214 AGGAGCTGATGTTGGGGATGTGG - Intronic
1173533291 20:43787290-43787312 AGGTGTGGTTGCTGGGGTTGGGG + Intergenic
1173594151 20:44247870-44247892 AGGTGCTGCTGCTGCGGGGAGGG + Intronic
1174161685 20:48555519-48555541 AGGTGCTGATGCTGGAGTTATGG - Intergenic
1174317057 20:49712030-49712052 AGAAGATGCTGCTGGGGTAGGGG - Intronic
1174544438 20:51314739-51314761 AGATGCAGCTTCTGGGGTTAAGG + Intergenic
1174546058 20:51326044-51326066 AGCTGCTGGGGATGGGGTTGGGG + Intergenic
1174548924 20:51347020-51347042 AGGTGCTGGTGCTGATGCTGAGG + Intergenic
1175246563 20:57585854-57585876 AGGTGCTGCTGCTGTCGCTGGGG - Intergenic
1175268405 20:57716570-57716592 GTGTTCTGCTGCTGGGTTTGAGG + Intergenic
1175321730 20:58092954-58092976 AGGGCCTGCAGCTGGGGGTGGGG + Intergenic
1175459892 20:59144684-59144706 TGGTGCCTCTGCTGGGTTTGAGG - Intergenic
1175502407 20:59459943-59459965 AGGTCCTGCAGCAGGGGCTGTGG - Intergenic
1175768995 20:61611185-61611207 AGGGGCTGGGGCTGGGGCTGGGG - Intronic
1175891212 20:62316841-62316863 GGGCGCTCCTGCTGGGGCTGAGG + Intronic
1175900765 20:62359098-62359120 AGGTGCTACAGGTGGGGTAGCGG - Intronic
1175902038 20:62363777-62363799 AGGTGCTGGGCCTGGGGGTGGGG - Intronic
1176013183 20:62911443-62911465 AGCTGCTGCTGTGGGGGTGGCGG + Exonic
1176024197 20:62977530-62977552 AGGTGCTACTGCAGGGGATGCGG + Intergenic
1176088756 20:63309743-63309765 AGCCGCTGCTGCTGGAGTAGCGG - Exonic
1177168193 21:17626697-17626719 AAGTGCAGCTGCTGGGAATGGGG + Intergenic
1177227247 21:18273060-18273082 AGGTGGTGCTGCTGGACTGGAGG + Intronic
1178998880 21:37435325-37435347 AGCCGCTGTTGCTGGGGTTCAGG + Intronic
1179113428 21:38467473-38467495 AGGTGCTTCTGCGGGTGTGGAGG + Intronic
1179123337 21:38569046-38569068 GGGAGCTGCTGCTGGGGTCTGGG - Intronic
1179446179 21:41432370-41432392 TGGAGGTGCTGCTGGGGTTGGGG + Intronic
1179478476 21:41662937-41662959 GGGTGCAGCTGCTGGGGACGGGG + Intergenic
1179559054 21:42201229-42201251 AGGTGCTGGTGCTCGTGCTGGGG - Intronic
1179634408 21:42698186-42698208 AGGTGTTGCTGGTGGGGTGTGGG - Intronic
1179636092 21:42710475-42710497 AGATGCTGCTGGTGGGAATGTGG - Intronic
1179724660 21:43335425-43335447 AGGTGGTGCTTCTGGGGGAGGGG + Intergenic
1179819010 21:43925621-43925643 AGGCGCTGGGGCTGGGGCTGAGG - Intronic
1179979417 21:44888499-44888521 AGGGGAGGCTGCTGGGGGTGAGG + Intronic
1180064382 21:45405280-45405302 AGATGCGGCTGCGGGGGTCGCGG + Intronic
1180763206 22:18224118-18224140 AGGTGTTGCTGCTGCAGTGGTGG + Intergenic
1180772440 22:18400429-18400451 AGGTGTTGCTGCTGCAGTGGCGG - Intergenic
1180803819 22:18650045-18650067 AGGTGTTGCTGCTGCAGTGGCGG - Intergenic
1180806945 22:18719404-18719426 AGGTGTTGCTGCTGCAGTGGCGG + Intergenic
1181217900 22:21345214-21345236 AGGTGTTGCTGCTGCAGTGGCGG + Intergenic
1181288173 22:21769878-21769900 ATGTGCTGCTGTTGGGGTGGTGG + Intronic
1181395262 22:22616773-22616795 GGACGCTGCTGCTGGGGTGGGGG - Intergenic
1182276322 22:29190981-29191003 AGGAGCTGGTGGTGGGGTGGGGG - Intergenic
1182791667 22:32958200-32958222 AGCTGCTGTTGATGTGGTTGTGG - Intronic
1183261693 22:36799390-36799412 TGGAGGTGATGCTGGGGTTGGGG + Intergenic
1183420209 22:37707441-37707463 AGATGCTGCTGCTGGGGTTGGGG + Intronic
1183440508 22:37820421-37820443 AGAAGCTGGGGCTGGGGTTGGGG - Intergenic
1183519274 22:38287153-38287175 GGGAGCTGCTGCTGGGGGAGGGG - Intergenic
1183702662 22:39458554-39458576 AGCTGCAGCTCCTGGGGGTGGGG - Intronic
1183782153 22:40005898-40005920 ATGCTCTGCTGCTGGGGTGGGGG + Intronic
1184101626 22:42344070-42344092 CGGTGCCGCTGCTGGGGGTGAGG + Intergenic
1184155168 22:42662490-42662512 AGGTGCTGCCCCTTGGGCTGCGG + Intergenic
1184205628 22:43000672-43000694 AGTTGCTGATGTGGGGGTTGGGG - Intronic
1184293660 22:43510868-43510890 AGCTGCTGGGGCTGGGGCTGGGG - Intergenic
1184300166 22:43553987-43554009 TGGTGCTGCTGCTGGCAGTGTGG - Intronic
1184347575 22:43923172-43923194 GGGTGCTGGGGCTGGGGTCGGGG - Intergenic
1184422818 22:44391716-44391738 AGGGGCTGCAGGTGGGGCTGGGG - Intergenic
1184501752 22:44878846-44878868 AGCTGCTGTTGCTGGAGTAGAGG + Intergenic
1184519719 22:44986177-44986199 CGGTGATGCTGCTGGTGATGGGG - Intronic
1184739015 22:46416382-46416404 GGGTGTTGGTGCAGGGGTTGGGG - Intronic
1184770337 22:46593468-46593490 AGGCCCTGCGGCAGGGGTTGGGG - Intronic
1185388732 22:50548000-50548022 AGGGGATGCGGCTGGGGTTGGGG - Intergenic
1185388753 22:50548048-50548070 AGGGGATGCGGCTGGGGTTGGGG - Exonic
1203234280 22_KI270731v1_random:141417-141439 AGGTGTTGCTGCTGCAGTGGCGG - Intergenic
949745764 3:7290673-7290695 AGGTTATGCTGCTGGGGTTGGGG - Intronic
949867529 3:8558861-8558883 AGGGGATGCTGGTGTGGTTGGGG - Intronic
950103928 3:10376590-10376612 AGGTGCTACTGCAGGTGCTGCGG + Intronic
950170654 3:10837079-10837101 AGGGGCTGGCCCTGGGGTTGGGG + Intronic
950297105 3:11841733-11841755 CAGTGCTGCTGCTGGAGTTGGGG - Intronic
950695779 3:14700107-14700129 TGCAGCTGCTGCTGGGGATGGGG + Intronic
950945489 3:16941434-16941456 AGCTGGTGCTGCTGAGGCTGGGG - Intronic
951204208 3:19909205-19909227 CTCTGCTGCTGCCGGGGTTGGGG - Intronic
951942435 3:28094315-28094337 AGGTGCTGCTGATTGGCTGGGGG + Intergenic
952426096 3:33175499-33175521 CGGTGTTGCTGTTGGTGTTGAGG - Intronic
952852601 3:37741282-37741304 TGTTGCTGCTGCTGGGGGTGGGG - Intronic
952946758 3:38483003-38483025 TGGACCTGCTGCTGTGGTTGGGG + Intronic
953376724 3:42435043-42435065 ATGAGCTCCTGCTGGGGCTGAGG - Intergenic
953980462 3:47410703-47410725 AGGGGCTGCTGTGGGGGCTGAGG - Exonic
954036651 3:47854492-47854514 GGCTGCTGCTGCTCGGGTTCAGG - Intronic
954115276 3:48463689-48463711 AGGTTATGGAGCTGGGGTTGGGG + Intronic
954197234 3:49003997-49004019 AGGGGCTGCTGCTGCCTTTGGGG + Intronic
954205608 3:49056878-49056900 AGTTGCTGCTGCTGCTGCTGTGG + Exonic
954205610 3:49056884-49056906 TGCTGCTGCTGCTGTGGTGGTGG + Exonic
954214613 3:49117320-49117342 AGGAGCTGGTGCCGGGGCTGCGG - Exonic
954400774 3:50318395-50318417 AGGTACTGGCACTGGGGTTGCGG + Exonic
955327640 3:58021414-58021436 ATGTGCTGCTGCTGGGATGGGGG + Intronic
955513860 3:59707527-59707549 AGGGGCTGGGGCTGGGGTTCAGG + Intergenic
955916497 3:63912725-63912747 TGCTGCTGCCGCTGGGGCTGCGG - Exonic
956097784 3:65735640-65735662 AGGTGCTGCTGTGGGGCCTGGGG - Intronic
956549371 3:70441306-70441328 TGTGGCTGCTGCTGGGGTTGGGG - Intergenic
956746753 3:72316730-72316752 AGGAGCTACTGCCGGGGCTGGGG - Intergenic
957454532 3:80423765-80423787 AGGTGTTGGTGCTAGGGGTGAGG - Intergenic
958465176 3:94448571-94448593 AGCAGATGCTGGTGGGGTTGTGG + Intergenic
958914466 3:100033356-100033378 AGCTGCAGCTGCTGAGCTTGTGG - Intronic
959125912 3:102290394-102290416 TGCAGCTGCTGTTGGGGTTGGGG + Intronic
959151908 3:102618028-102618050 GGGTGCTGCTGATTTGGTTGAGG + Intergenic
959531560 3:107439760-107439782 AGGAGCTGCTGCTGTGGTCAAGG + Intergenic
960157916 3:114316860-114316882 AGGTGCTGCTGCTGCTGCTAAGG - Intergenic
960575221 3:119222562-119222584 AGTTGCTGTGGCAGGGGTTGGGG - Intronic
960758834 3:121049790-121049812 AGCTGCATCTGCTGGTGTTGAGG + Intronic
960948491 3:122983092-122983114 GAGTGCTGCAGGTGGGGTTGGGG - Intronic
961011632 3:123440314-123440336 AGCTGCTGCATCTGGGCTTGTGG - Intronic
961046799 3:123714262-123714284 AGATGCTGCTGGTGGGGTCCTGG + Intronic
961602727 3:128073524-128073546 AGGTGCTGAAGCTCAGGTTGGGG - Intronic
961682780 3:128610127-128610149 AGGAGGTGCTGCTGGGGTATGGG - Intergenic
961821012 3:129575645-129575667 AGTTGGGGCTGCTGGGGATGGGG + Intronic
961967954 3:130925790-130925812 AGCTGCTGTTGCGGGGGGTGGGG + Intronic
962080489 3:132134296-132134318 AGGTGGTGTTGGTGGGGTTTTGG - Intronic
962653542 3:137519515-137519537 ATGTGGTGCTGTTGGGGGTGGGG - Intergenic
962688257 3:137868218-137868240 TGCTGCTGCTGCTGGGGGTCAGG - Intergenic
962852768 3:139320070-139320092 AGCGGCTGCTGCTGGGGTGCAGG - Intronic
962864661 3:139437804-139437826 ACTGGCTGCTGCTGGGGTGGGGG - Intergenic
964130552 3:153281605-153281627 AGGTGAAGCTGCTGGGCTTCTGG + Intergenic
964755183 3:160085950-160085972 TGGGGCTGGGGCTGGGGTTGGGG - Intergenic
965016851 3:163168909-163168931 CTTTGCTGCTGCTGGGGGTGGGG + Intergenic
965617035 3:170604363-170604385 AGTGGCTGCTGGCGGGGTTGTGG + Intronic
966601023 3:181775165-181775187 ATGTACTGCTGGTGTGGTTGAGG - Intergenic
967147827 3:186620867-186620889 TGGTGCTGCTGCTGGGCCAGTGG + Exonic
967217092 3:187220040-187220062 AGCTGGTGGTGCTGGGGCTGAGG + Intronic
967230593 3:187334182-187334204 TGGGGCTGCTGCTTGGGTTTCGG + Intergenic
967847849 3:194058267-194058289 CGGAGCTGATGCTGGGGCTGGGG - Intergenic
967971617 3:195003702-195003724 GGGTGCTGCTGCGGGGGCTGGGG - Intergenic
968107671 3:196014016-196014038 GGGTATTGCTGCTGGTGTTGAGG + Intergenic
968801710 4:2747257-2747279 AGGTGGTACTGCTGGGGATGGGG - Intronic
969497582 4:7534911-7534933 AGGAGGGGCTGCAGGGGTTGGGG + Intronic
969507773 4:7598796-7598818 AGGTGATGGTGTTGGGGGTGGGG + Intronic
970333062 4:15003892-15003914 TGGGGCGGCTGCTGGGGTGGCGG - Exonic
970333157 4:15004261-15004283 TGGTGCTGCTGCTGGAGCTGCGG - Exonic
972828462 4:42787469-42787491 AGCTGCAGCTGCTGGTGCTGGGG + Intergenic
973617274 4:52691604-52691626 GGCAGCTGCTGCTGGGGGTGGGG - Intergenic
973754855 4:54064574-54064596 AGTTGCTGCTGCTGCGGCGGCGG - Exonic
976294110 4:83452469-83452491 AGCTGCGGCTGCTGGTGTGGGGG + Intronic
976731532 4:88266944-88266966 AGGTGCTGCTGATTGGGTGCAGG + Intronic
978030499 4:103936546-103936568 TGCTGCTGCTGCCAGGGTTGAGG - Intergenic
978137025 4:105275116-105275138 CTCTGCTGCTGCTGGGGCTGTGG - Exonic
979649606 4:123114666-123114688 AGCTGCAGCTGCCTGGGTTGTGG - Intronic
979833806 4:125335333-125335355 AGATGTTGATGATGGGGTTGAGG + Intronic
979929305 4:126610967-126610989 AGTTGTTCCTCCTGGGGTTGTGG - Intergenic
980461905 4:133125737-133125759 AGGCCCTGGTACTGGGGTTGTGG - Intergenic
980464264 4:133152415-133152437 TGCTGCTGCTGCTGCGGTGGCGG + Exonic
981250832 4:142598705-142598727 TTGTGCTGCTGCTGAGGTTGGGG - Intronic
981330449 4:143502397-143502419 AGCTGTTGCTGCAGAGGTTGTGG - Intergenic
982088954 4:151864006-151864028 AGTTCCTGGTGCTGGGGCTGTGG + Intergenic
982257815 4:153466964-153466986 GGGTGCTCGTGCTGGGGGTGGGG - Intronic
982765773 4:159346881-159346903 GGTGGCTGCTGCTGGGGCTGTGG - Exonic
983871021 4:172825519-172825541 AGATCCTGCTTCTGGGATTGAGG + Intronic
984314139 4:178104516-178104538 AGGTGGTGCTGAAGGGGATGAGG - Intergenic
984954653 4:185033415-185033437 AGGTGAGGCTGCTGGGGTGGTGG - Intergenic
985629542 5:1007533-1007555 AGGGGAGGCTGCTGGGGTGGGGG + Intergenic
985666435 5:1183757-1183779 AGGGGCTGCTGCAGGGGGTGAGG + Intergenic
985790983 5:1926652-1926674 AGGTGCTGGGGCCGGGGCTGGGG - Intergenic
985868636 5:2536449-2536471 GGGTGCTGCTGCTGTGGGTGAGG - Intergenic
986082614 5:4410009-4410031 AGAGGCTGCTGCTGTGGTGGTGG + Intergenic
986309922 5:6544304-6544326 CGGGGCTGGGGCTGGGGTTGGGG - Intergenic
986590044 5:9359063-9359085 GGGTGCTGCTGCTGAGGATCTGG - Intronic
987300173 5:16590164-16590186 AGGATCAGCAGCTGGGGTTGGGG - Intronic
987464745 5:18258569-18258591 GGGTGCTGATGCTGGTGTTTAGG + Intergenic
987708283 5:21482095-21482117 ACGTGCTGCAGCTGTGGCTGAGG + Intergenic
987708457 5:21482911-21482933 ACGTGCTGCAGCTGTGGCTGAGG + Intergenic
988751154 5:34191234-34191256 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
988751330 5:34192044-34192066 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
988751498 5:34192860-34192882 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
991189864 5:63857602-63857624 AGGGCCTGTTGCAGGGGTTGAGG - Intergenic
991346266 5:65671946-65671968 GGGACCTGCTGCTGGAGTTGGGG - Exonic
991736294 5:69633158-69633180 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
991736461 5:69633965-69633987 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
991736641 5:69634787-69634809 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
991736813 5:69635603-69635625 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
991758250 5:69899540-69899562 ACGTGCTGCAGCTGTGGCTGAGG + Intergenic
991758424 5:69900356-69900378 ACGTGCTGCAGCTGTGGCTGAGG + Intergenic
991758602 5:69901178-69901200 ACGTGCTGCAGCTGTGGCTGAGG + Intergenic
991758772 5:69901985-69902007 ACGTGCTGCAGCTGTGGCTGAGG + Intergenic
991812790 5:70488797-70488819 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
991812962 5:70489604-70489626 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
991813137 5:70490432-70490454 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
991815749 5:70509274-70509296 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
991815916 5:70510081-70510103 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
991816269 5:70511713-70511735 ACGTGCTGCAGCTGTGGCTGAGG - Intergenic
991837653 5:70775422-70775444 ACGTGCTGCAGCTGTGGCTGAGG + Intergenic
991837831 5:70776244-70776266 ACGTGCTGCAGCTGTGGCTGAGG + Intergenic
991838001 5:70777051-70777073 ACGTGCTGCAGCTGTGGCTGAGG + Intergenic
993386412 5:87268002-87268024 CGGTGCCGCTGCTGAGGCTGGGG - Exonic
994042571 5:95274971-95274993 AGGTGAGGCTGCAGTGGTTGCGG - Intronic
995845174 5:116486103-116486125 AGATTCTGGTGCTGTGGTTGGGG + Intronic
996314446 5:122146032-122146054 AACTGCTGCTGCTGGAGTAGAGG + Intronic
996790752 5:127290699-127290721 AGCTGCTGCTGCCGGGGCAGTGG - Intergenic
997382787 5:133449482-133449504 AGGAGCTGTGGCTGGGGTTGGGG + Intronic
997388679 5:133495982-133496004 TGGGGCTCCTGCTGGGTTTGAGG + Intronic
997722238 5:136088508-136088530 AGGCTCTGGGGCTGGGGTTGGGG + Intergenic
998005092 5:138651505-138651527 AGGCGGTGGTGCTGGGGCTGGGG - Intronic
998133066 5:139660782-139660804 GGGAGCAGCTGCTGGGGTTGGGG + Intronic
998137599 5:139682319-139682341 TGGGGCTGGGGCTGGGGTTGGGG - Intronic
998158426 5:139799386-139799408 AGGTGCTGTTGGTGGGGGAGAGG + Intronic
998334076 5:141355428-141355450 AGGTGCCGCTGCGCGGGTTCAGG - Exonic
998388333 5:141771271-141771293 AGGAGCTGGGGCTGGGGGTGGGG + Intergenic
998423120 5:142005481-142005503 GGGTCCTGCTGCTGGGATAGAGG + Intronic
998446699 5:142204379-142204401 AGGACCTCCTGCAGGGGTTGAGG + Intergenic
998767805 5:145507592-145507614 AGGTCATTCTGCTGGGGCTGTGG + Intronic
1000029528 5:157390043-157390065 GGCAGATGCTGCTGGGGTTGAGG - Intronic
1001313949 5:170629713-170629735 GGGTGCTGGTGCCGGGGTTGTGG - Intronic
1001318775 5:170663426-170663448 TGGTGCAGCTGCTGGGGGAGAGG - Intronic
1001430747 5:171660045-171660067 AGGGACTGCAGCTGGGGATGGGG - Intergenic
1002081351 5:176739513-176739535 AGGTGCTGCTGGTGTGGGCGGGG + Intergenic
1002088749 5:176792454-176792476 AGGTGCTGCAGCAGGTGTTGGGG + Intergenic
1002304079 5:178273222-178273244 AGATGCTCCCTCTGGGGTTGAGG - Intronic
1002439794 5:179258345-179258367 AGGTGCTCCTGCTGTGGTTTGGG + Intronic
1002640901 5:180630191-180630213 AGGGTCGGATGCTGGGGTTGGGG + Intronic
1003292373 6:4790356-4790378 AGGTGTTACTGCTGTGGTTTTGG + Intronic
1005738119 6:28767843-28767865 TGTTGCTGCAGCTGGGGTTTAGG + Intergenic
1006183500 6:32167624-32167646 AGGTGCTGCTGCTGGAGGAGAGG + Exonic
1006220891 6:32490300-32490322 AGGTGCTGCAGCTGAGGATACGG - Intergenic
1006440080 6:34048448-34048470 AGGGGCTGGGGCTGGGGGTGGGG + Intronic
1006640788 6:35488567-35488589 AGGTCCTGCTGCTTGAGTCGGGG + Intronic
1007096159 6:39214508-39214530 TGGTGCTGCCTCTGGGCTTGGGG + Intronic
1007627438 6:43254492-43254514 AGGTGGCCCAGCTGGGGTTGGGG + Intronic
1007634116 6:43287715-43287737 GGAGGCTGCAGCTGGGGTTGGGG - Exonic
1008967524 6:57328104-57328126 ATGTGCTGGTGCTGGTATTGTGG + Intronic
1008968739 6:57341795-57341817 AGGTGCTGCTGCATAAGTTGAGG + Intronic
1009157724 6:60243613-60243635 AGGTGCTGCTGCATAAGTTGAGG + Intergenic
1009673742 6:66788940-66788962 AGGTGCTGCAGTTGTGGATGGGG - Intergenic
1011090614 6:83594396-83594418 TGCTGCTGCTACAGGGGTTGGGG + Exonic
1011907429 6:92389191-92389213 AGGTGAAGCTGCTGGGCTTCTGG - Intergenic
1013220637 6:108074571-108074593 TGGGGCTGCTGCTGTGGTCGGGG - Exonic
1013432120 6:110064592-110064614 AGGAGCCCCTGCTGGGGCTGGGG - Intergenic
1013598188 6:111679875-111679897 TGGGGCTGCAGCTGGGGATGGGG + Intronic
1013925738 6:115469141-115469163 TGCTGCTGCTGCTGGGGTGAGGG + Intergenic
1014832387 6:126118238-126118260 AGGGCCTGCTGCTGGTTTTGTGG - Intergenic
1014897871 6:126925800-126925822 TGGTGCTGCTGCTGTGGCGGAGG - Intergenic
1015657922 6:135540678-135540700 AGGTGGTGCTGCTGTACTTGTGG + Intergenic
1016229672 6:141788224-141788246 AGTGTCTTCTGCTGGGGTTGCGG - Intergenic
1016590185 6:145735421-145735443 AGCTGCTGGTGGTGGGGTCGCGG - Exonic
1016775078 6:147896362-147896384 TGGGGCTGGGGCTGGGGTTGGGG + Intergenic
1017019982 6:150132395-150132417 AGTGGCTGCTGCTGGGCCTGAGG + Intergenic
1018174388 6:161166392-161166414 TGGTGATGCTGCTGGAGTGGTGG - Exonic
1018551795 6:165006801-165006823 ACCTGCTGGTTCTGGGGTTGGGG - Intergenic
1018650531 6:165988324-165988346 AGGTGCTGGGGCTGGGGGAGGGG + Intergenic
1018848672 6:167572402-167572424 TGGTGGGGCTGGTGGGGTTGAGG - Intergenic
1019012339 6:168851679-168851701 AGGGGCTGGGGCTGGGGCTGGGG + Intergenic
1019048038 6:169162989-169163011 AGGGGCTGGTGCTGTGGCTGGGG + Intergenic
1019295312 7:270754-270776 AGGAGAGGCCGCTGGGGTTGGGG - Intergenic
1019616720 7:1966360-1966382 AGTTCCAGCTGCTGGGGCTGAGG + Intronic
1019624592 7:2009552-2009574 AGGGGCAGGTGCTGGGGCTGTGG - Intronic
1019683089 7:2363767-2363789 ATTTGCTGCTGCTGGGGGCGGGG + Intronic
1020035151 7:4959645-4959667 AGGGGGTGCTGGAGGGGTTGGGG + Intergenic
1021101100 7:16586556-16586578 TGGTGCTGCTGCTGCGGTGGCGG + Intergenic
1021597995 7:22337204-22337226 GGGTGCTGCTGGTTTGGTTGGGG + Intronic
1022793592 7:33714296-33714318 TGGTGCCGCTGCTGGGTGTGGGG - Intergenic
1022813139 7:33888436-33888458 AGTAGCTGCTTCAGGGGTTGTGG - Intergenic
1022953660 7:35362375-35362397 AGGTGCTGCTGGTGGTGTCTAGG - Intergenic
1023143916 7:37130198-37130220 AGGTGGTGGTGGTGGGGTGGGGG - Intronic
1023353104 7:39339866-39339888 GGTTGGTGCTGCTGGGGCTGAGG - Exonic
1023865413 7:44235978-44236000 TGCTGCTGCTGCTGGGGTTGGGG - Intronic
1023939290 7:44759656-44759678 AGGAGCAGCTCCTGGGGTTTGGG + Intronic
1024238175 7:47413903-47413925 TGCTGCTGCTGCTGCTGTTGTGG - Intronic
1025144169 7:56490603-56490625 AGCTGGGGCTGCTGGGATTGTGG + Intergenic
1025206565 7:56996504-56996526 TGCTGGTGCTGGTGGGGTTGAGG + Intergenic
1025665373 7:63580423-63580445 TGCTGGTGCTGGTGGGGTTGAGG - Intergenic
1025902827 7:65760879-65760901 ATGTATTGCTGCTGGGTTTGGGG + Intergenic
1026113554 7:67477494-67477516 AGATACTGCTGCTAGGGTTAGGG - Intergenic
1026192647 7:68143494-68143516 GGGTGCTACTGATTGGGTTGGGG + Intergenic
1026300055 7:69089924-69089946 GGGGGCTGCTTCTGGGGTTCTGG - Intergenic
1026371723 7:69706193-69706215 AGGAGGTGTAGCTGGGGTTGGGG + Intronic
1026539012 7:71264014-71264036 AGGTGATACTGCTGGTCTTGGGG + Intronic
1026896314 7:74012041-74012063 AGCTGGTGCTGCTGGTCTTGGGG - Intergenic
1026898044 7:74021915-74021937 AGGGGCTCCTGCTGGGCCTGGGG - Intergenic
1027038805 7:74946111-74946133 AGTGGCAGCTGGTGGGGTTGGGG - Intergenic
1027237502 7:76306751-76306773 TTGTGCTGCTTCTGGGGTGGTGG + Intergenic
1027505907 7:79016848-79016870 GGCAGCTGCTGCTGGGGTTGGGG - Intronic
1027628569 7:80574831-80574853 TGGCCCTGCTGCTGGGGTAGTGG + Intronic
1027691687 7:81354580-81354602 TGCTGCTGCTGCTGTGGGTGTGG + Intergenic
1028169621 7:87580856-87580878 ATGTGCTGCTGGTGGGGGAGGGG + Intronic
1028872483 7:95784534-95784556 AGGTGATGCTGCAGAGCTTGTGG + Intronic
1029115740 7:98236206-98236228 AGGTGATGCTGCTGCAGTTTTGG - Intronic
1029380671 7:100212326-100212348 AGGAACTGCTGCTGGTGTAGTGG + Intronic
1029458811 7:100684062-100684084 AGCTGCTGCTGCTGCTGCTGTGG + Exonic
1030320954 7:108166846-108166868 AGGTGCTCCAGCTGGAGATGGGG - Intronic
1030896296 7:115065041-115065063 TGTTGCTGCTGCTGTTGTTGAGG + Intergenic
1031154669 7:118095637-118095659 AGGTGAGGCTGCTGGGGTTTGGG + Intergenic
1031484355 7:122310315-122310337 AGTTCCCGCTGCTGGAGTTGGGG + Intronic
1032011833 7:128352128-128352150 CGCTGCTGCTCCTGGGGCTGGGG - Exonic
1033272329 7:139943911-139943933 AGGGTCAGCTGCTGGGGGTGGGG - Intronic
1034174519 7:149090476-149090498 GGCTGCTTCTGCTGGGGATGTGG - Intronic
1034405946 7:150902543-150902565 AGGTGTGGCTCCTGGGGATGGGG - Intergenic
1034432859 7:151049688-151049710 AGGCCCTGCTCCTGGGGCTGGGG + Intronic
1035000565 7:155609423-155609445 CAGGGCTGCTGCTGGGGATGGGG - Intergenic
1035610444 8:959245-959267 AAGTGCAGCAGCTGGTGTTGTGG + Intergenic
1035729116 8:1842240-1842262 AGGTGCCGCATCTGAGGTTGGGG + Intronic
1036186397 8:6626181-6626203 AGGTGGGGCAGCTGGGGTGGCGG - Intronic
1036353025 8:8023951-8023973 AGGTGGTTTTGCGGGGGTTGTGG - Intergenic
1036999946 8:13705903-13705925 AGGTGCAGCTGCTGGTCTAGTGG + Intergenic
1037755015 8:21704944-21704966 GGGAGGGGCTGCTGGGGTTGGGG + Intronic
1037938050 8:22928299-22928321 AGGGACTGCTGCAGGGGGTGGGG + Intronic
1037963308 8:23115794-23115816 AGGGGCTGCTGCAGGGGGTAGGG - Intronic
1037967708 8:23146763-23146785 AGGGGCTGCTGCAGGGGGTAGGG + Intronic
1037974390 8:23199601-23199623 AGGCCCTGGTGCTGGGCTTGGGG + Intronic
1038302334 8:26364245-26364267 AGGTGCACCTGCTCAGGTTGTGG + Intronic
1038447918 8:27616723-27616745 GGGTGCAGATGCTGGGGATGGGG - Intergenic
1038539458 8:28379867-28379889 AGTTGCTTCTGGTTGGGTTGAGG - Intronic
1038581494 8:28752643-28752665 ACAGGCTGATGCTGGGGTTGGGG - Exonic
1039001028 8:32980089-32980111 GGGTGCTGTTGCTGGGTTGGGGG - Intergenic
1039123571 8:34175654-34175676 TGCGGCTGCTGTTGGGGTTGGGG - Intergenic
1039774689 8:40723817-40723839 AGGTGCTGCTGGTGGAGAGGGGG + Intronic
1039926027 8:41933118-41933140 GGGGGCTGCTGCTGGGGAGGGGG + Exonic
1039926044 8:41933181-41933203 TGCGGCTGCTGCTGGGGTGGTGG + Exonic
1039947306 8:42140812-42140834 AGGTGGTGCTGTTGGGTGTGAGG - Intergenic
1040055864 8:43056431-43056453 TTGTGCTGCTGCTGGGGCGGCGG - Exonic
1040530239 8:48260781-48260803 AGGCGCTGCCGCAGGTGTTGTGG - Intergenic
1041108004 8:54459693-54459715 TGGTGCTGGTGCTGGTGTTGCGG - Exonic
1044205225 8:89485740-89485762 TGGTGCTGCTGCTGGTGGTTTGG - Intergenic
1044730727 8:95226635-95226657 TGCTGCTTCTGCTGGGGGTGAGG + Intergenic
1045004179 8:97902924-97902946 TGGTGCAGATGCTGGGTTTGGGG + Intronic
1045653406 8:104363933-104363955 AGGTGAAGCTGCTGGGCTTCTGG - Intronic
1046751744 8:117933983-117934005 AGGTTTTGCTGGTGGGATTGTGG - Intronic
1046949077 8:120003065-120003087 GGGGGCTGCTGCTGAGGGTGGGG - Exonic
1046985582 8:120384313-120384335 TGGCTCTGTTGCTGGGGTTGGGG + Intronic
1047221147 8:122919125-122919147 CTGTGCTGATGGTGGGGTTGGGG - Intronic
1047928818 8:129706115-129706137 AGGTGATGCTGCTGGAGGAGGGG + Intergenic
1048101337 8:131355365-131355387 AAGAGATGCTGCTGAGGTTGTGG - Intergenic
1048274465 8:133055816-133055838 TGCTGCTGCTGCTGGTGATGAGG - Intronic
1048572030 8:135664451-135664473 AGCAGCTGCTGCTCGGGGTGTGG + Intergenic
1048980236 8:139699409-139699431 AGGTGGTGGGGCGGGGGTTGGGG + Intronic
1049003790 8:139842237-139842259 TGTTGCTGCTGCTGGCCTTGGGG + Intronic
1049222753 8:141435393-141435415 AGGTGCTGTTGCCAGGGTCGGGG - Intergenic
1049354392 8:142180314-142180336 TGATGCTCCTGCTGGGGCTGGGG + Intergenic
1049363987 8:142227531-142227553 AGCTGCTGGTGTTGGGGTTGTGG - Intronic
1049373899 8:142280143-142280165 AGGTGCTGGTGCAGAGGGTGCGG - Intronic
1049551992 8:143264303-143264325 AGCCAGTGCTGCTGGGGTTGGGG - Intronic
1049795749 8:144496601-144496623 AGGTGCAGCCGCTGAGGCTGGGG - Exonic
1049815078 8:144595420-144595442 AGAGGCTGCTGCTGGGAGTGGGG + Intronic
1051921658 9:22274298-22274320 AGCTGCTGCTGCAGGGGTGTGGG - Intergenic
1052393492 9:27909296-27909318 AAGAGATGCTGCTGAGGTTGTGG + Intergenic
1053121076 9:35547909-35547931 AGCAGCTGCTGCTTGGGTGGAGG - Exonic
1053410232 9:37911587-37911609 AGGGGCTGGAGCTGGGGCTGGGG - Intronic
1053624921 9:39859727-39859749 GGTTGCTGCTGCTGGGGTGGGGG + Intergenic
1053879949 9:42583501-42583523 GGTTGCTGCTGCTGGGGTGGGGG - Intergenic
1053892714 9:42710810-42710832 GGTCGCTGCTGCTGGGGTGGGGG + Intergenic
1054218976 9:62390971-62390993 GGTTGCTGCTGCTGGGGTGGGGG - Intergenic
1054231741 9:62518198-62518220 GGTTGCTGCTGCTGGGGTGGGGG + Intergenic
1054336306 9:63813174-63813196 AGGTGCCGCTGCTGGCGTCTAGG + Intergenic
1054816807 9:69483461-69483483 TGGTGCTGGTGTTGGGGCTGAGG + Intronic
1054873874 9:70075247-70075269 TGGTGCTGTTGCAGGGGTTAGGG - Intronic
1054922128 9:70553483-70553505 AGGGGCTGCTACTGTGGTGGTGG + Intronic
1055194021 9:73564543-73564565 AGGGCCTGTTGCTGGGGTAGGGG + Intergenic
1055574429 9:77647662-77647684 AGCTGCTGCTGCTGGGTGAGTGG - Exonic
1056138015 9:83648176-83648198 AGGCGCCTGTGCTGGGGTTGCGG - Intergenic
1056935364 9:90911923-90911945 GGGTGCTTCTGCTGGAGGTGGGG - Intergenic
1056935465 9:90912392-90912414 GGGTGCTTCTGCTGGAGATGGGG + Intergenic
1057222753 9:93266700-93266722 AGGTGGTGCTCCTGGGGTTGGGG + Intronic
1057310647 9:93940897-93940919 AGTTGCTGCTGCTGAGCTGGAGG - Intergenic
1057314460 9:93959509-93959531 TGGTGGTGCTGCTGGGACTGGGG + Intergenic
1058110945 9:101029856-101029878 AGGGGCTGCTGCTGCGGCGGCGG + Intronic
1059350836 9:113663681-113663703 AGTTGGTGGTGCTGGGGTTCTGG + Intergenic
1059623570 9:116036053-116036075 AGGTTGTGCAGCTGGGTTTGTGG - Intergenic
1060211185 9:121711499-121711521 AACAGCTGCTCCTGGGGTTGGGG - Intronic
1060390018 9:123269076-123269098 TTGTGTGGCTGCTGGGGTTGGGG - Intergenic
1060400316 9:123344747-123344769 AGGGGCTGCTGCTGGGGAGAGGG + Intergenic
1060592831 9:124829929-124829951 GCGTGCTCCTGCTGGGGTCGGGG - Intergenic
1061084302 9:128390286-128390308 AGGAGCAGCTGCTGGCGGTGGGG - Exonic
1061208565 9:129177829-129177851 AGGTGCTGGTGCTGGTGGTGGGG + Exonic
1061219610 9:129242625-129242647 CGGTGATGAGGCTGGGGTTGAGG + Intergenic
1061247708 9:129409421-129409443 AGGAGCAGCTGCAGGGTTTGGGG + Intergenic
1061466276 9:130782705-130782727 AGCTGCTGCTGCTGCCGCTGTGG + Intronic
1061466868 9:130787483-130787505 ATCTGCTGCTCCTGGGGGTGAGG - Intronic
1061575877 9:131505739-131505761 ATGTGCTGCTGGTGGGGGCGGGG + Intronic
1061649664 9:132037134-132037156 AGATGCTGCTGCTAGGACTGAGG + Intronic
1061807386 9:133144049-133144071 AGGGTCTGGGGCTGGGGTTGGGG + Intronic
1061871221 9:133521808-133521830 AGGTGATGGGGCTGGGGTGGGGG - Intronic
1061906663 9:133702665-133702687 AAGTGGTGCTGCTGGGGATGGGG - Intronic
1061924747 9:133800449-133800471 GTCTGCTGCTGCTGGGGCTGGGG + Intronic
1062132714 9:134908615-134908637 ATGTGGTGCTGCTGGCTTTGGGG + Intronic
1062564362 9:137157348-137157370 ATGTGGTGGTGCTGGGGGTGTGG - Intronic
1062580955 9:137229024-137229046 AGATACTGCTGCTGGGGCTGTGG + Exonic
1062598152 9:137308328-137308350 AGGAGCTGGGGCTGGGGTGGGGG - Intronic
1062617239 9:137403414-137403436 TGCTGCTGCTGCTGGGCTGGGGG - Intronic
1185641599 X:1591880-1591902 AGGTGACGGGGCTGGGGTTGGGG + Intronic
1185854478 X:3521288-3521310 AGGAGATGCTGGTGGGGTGGGGG - Intergenic
1186419915 X:9417371-9417393 AGTTGTTGCTCCTGGGGTGGAGG - Intergenic
1186489247 X:9958615-9958637 AGGTGCTTCTGCAGGGAGTGGGG - Intergenic
1186748713 X:12598560-12598582 CAATGCTGCTGGTGGGGTTGAGG + Intronic
1187933107 X:24311743-24311765 AGCTGCTGCTGCTGTGGCGGCGG - Intergenic
1189452956 X:41156621-41156643 AGGTGCTGGTGTTGGGTGTGTGG - Intronic
1189848585 X:45157973-45157995 AGATCCTGCTGTTGGGGGTGAGG + Intronic
1189921717 X:45909081-45909103 AGGTGCCGCTACTGGCCTTGGGG + Intergenic
1190064883 X:47233067-47233089 AGCTGCTGCTGCGGCGGCTGTGG + Exonic
1191706480 X:64099489-64099511 TGCTGCTGGTGTTGGGGTTGGGG + Intergenic
1192180549 X:68913140-68913162 TGCTGCTGCTGCTGCGGCTGCGG - Intergenic
1192677535 X:73214324-73214346 AGAAGCTGCCGCTGGGCTTGGGG - Exonic
1193607243 X:83583709-83583731 AGAAGCTGCTACTGGGGGTGGGG - Intergenic
1193958034 X:87886631-87886653 TAGTGCTGCTGCTTGGGGTGGGG + Intergenic
1193970048 X:88039634-88039656 AGGTTTTGTTGCTTGGGTTGGGG - Intergenic
1195095083 X:101494010-101494032 AGGGGCTGAGGCTGGGGCTGGGG + Exonic
1195432663 X:104806734-104806756 GGCTGCTGCTGCTGAGGTTGGGG + Intronic
1195696755 X:107673207-107673229 AGTTGCTTCTGCTGGGCTGGCGG - Intergenic
1196083585 X:111659751-111659773 AGGTGCTTAGGCTGGGGGTGTGG - Intergenic
1196494472 X:116307781-116307803 CAATGCTGCTGCTGGGGTTTTGG + Intergenic
1197449606 X:126595017-126595039 TGCTGCTGTTGCTGGGGTTGGGG + Intergenic
1197733191 X:129829224-129829246 AGGTGCTGCTGATTCTGTTGTGG - Intronic
1197782642 X:130172607-130172629 AGGTGCCGCTGCTCGGGGTAGGG - Intronic
1197987313 X:132279506-132279528 CGCTGCTGCTGCTGGGGTGGGGG + Intergenic
1198142324 X:133816836-133816858 AGGTGCTGTAGGTGGGTTTGGGG + Intronic
1198394222 X:136206645-136206667 AGCTGCTGCTGCCATGGTTGTGG - Intronic
1199439777 X:147854943-147854965 AGCTGCTGCTGTTGGGGGTGAGG + Intergenic
1199861892 X:151808520-151808542 TTGTGTGGCTGCTGGGGTTGAGG + Intergenic
1200060890 X:153483293-153483315 AGGTGCAGCTCCTAGGGTCGGGG - Intronic
1200181205 X:154151704-154151726 AGCTGCTGCTGCTGGATGTGGGG - Intronic
1200186850 X:154188818-154188840 AGCTGCTGCTGCTGGATGTGGGG - Intergenic
1200192501 X:154225956-154225978 AGCTGCTGCTGCTGGATGTGGGG - Intronic
1200198256 X:154263760-154263782 AGCTGCTGCTGCTGGATGTGGGG - Intronic
1200237086 X:154472895-154472917 TATTGCTGCTGCTGGGGTGGGGG - Exonic
1201566339 Y:15368777-15368799 AGTGGCTGCTCCTGGGGTAGGGG - Intergenic
1201590303 Y:15607410-15607432 AGGTGCTACAGGTGGGGATGTGG + Intergenic