ID: 1095947152

View in Genome Browser
Species Human (GRCh38)
Location 12:47759691-47759713
Sequence TGGGGCGAAGAGGCCCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095947152_1095947156 -8 Left 1095947152 12:47759691-47759713 CCAGCGCGGGCCTCTTCGCCCCA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1095947156 12:47759706-47759728 TCGCCCCACTCCTGAGAGGGTGG 0: 1
1: 0
2: 0
3: 5
4: 122
1095947152_1095947164 9 Left 1095947152 12:47759691-47759713 CCAGCGCGGGCCTCTTCGCCCCA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1095947164 12:47759723-47759745 GGGTGGAGAGACAGTGGCCGGGG 0: 1
1: 0
2: 1
3: 34
4: 392
1095947152_1095947166 29 Left 1095947152 12:47759691-47759713 CCAGCGCGGGCCTCTTCGCCCCA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1095947166 12:47759743-47759765 GGGACAGCGACCCGTAATTCAGG 0: 1
1: 0
2: 0
3: 1
4: 24
1095947152_1095947162 7 Left 1095947152 12:47759691-47759713 CCAGCGCGGGCCTCTTCGCCCCA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1095947162 12:47759721-47759743 GAGGGTGGAGAGACAGTGGCCGG 0: 1
1: 0
2: 5
3: 76
4: 723
1095947152_1095947161 3 Left 1095947152 12:47759691-47759713 CCAGCGCGGGCCTCTTCGCCCCA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1095947161 12:47759717-47759739 CTGAGAGGGTGGAGAGACAGTGG 0: 1
1: 0
2: 7
3: 76
4: 666
1095947152_1095947163 8 Left 1095947152 12:47759691-47759713 CCAGCGCGGGCCTCTTCGCCCCA 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1095947163 12:47759722-47759744 AGGGTGGAGAGACAGTGGCCGGG 0: 1
1: 0
2: 7
3: 44
4: 481

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095947152 Original CRISPR TGGGGCGAAGAGGCCCGCGC TGG (reversed) Intronic
900615628 1:3564533-3564555 TGGGGAGAGGAGGCCAGTGCTGG - Intronic
901638046 1:10679537-10679559 TGGGGAGGAGGGGCCCGCGGGGG - Intronic
901679861 1:10906624-10906646 TGGGGCACAGAGGCCACCGCAGG - Intergenic
903261521 1:22134141-22134163 GGGGGCAGAGAGGCCTGCGCTGG - Intronic
904528977 1:31155474-31155496 GGGGGCGCAGAGGGCGGCGCCGG + Intergenic
905653365 1:39671300-39671322 TGGGGGGCAGAGTCCAGCGCTGG + Intronic
906198774 1:43946525-43946547 TGGGCCGCAGCGCCCCGCGCCGG + Intergenic
908315460 1:62927962-62927984 AGGGGCTAAGAGCCCCGCTCTGG + Intergenic
916080887 1:161231350-161231372 TGTAGCGAAGAGGCCCGCAGAGG + Exonic
916101761 1:161399234-161399256 TCGGCCGAAGAGGCCGGAGCCGG + Intergenic
917835605 1:178939222-178939244 TGGGACGAAGATGCCAGAGCGGG + Intergenic
917975117 1:180233351-180233373 CGGAGCGACGAGGCCCGCACCGG - Intronic
920254277 1:204643878-204643900 TGGTGGGAAGAGGCCAGGGCAGG - Intronic
1064179310 10:13100551-13100573 TGCGGCCAAGAGGCCGGCCCTGG - Intronic
1071546786 10:86535638-86535660 GGGGGCGGGGAGGCCCGGGCAGG - Intergenic
1073063702 10:100746330-100746352 TGGGACGGAGAGCCCCGAGCCGG - Intronic
1073113320 10:101075845-101075867 TGGGGAGAAGAGGCACTGGCAGG + Intergenic
1073136811 10:101224751-101224773 TGTGCCGAGGAGGCGCGCGCGGG + Intergenic
1075032049 10:119030080-119030102 TGGGGCGCTGGGGCCGGCGCTGG + Exonic
1076343661 10:129766330-129766352 TGGGCTGGAGAGGCCCGTGCAGG + Intronic
1076747366 10:132521203-132521225 TGGGGCGGAGGGGCCAGGGCTGG + Intergenic
1078563973 11:12397978-12398000 GGGGGCAGAGAGGCCCGTGCTGG - Intronic
1083758756 11:64804734-64804756 TGGGGCGAGGAAGCCCGGGAAGG - Exonic
1083990778 11:66244483-66244505 TGGGGCGCAGATGGCCGGGCTGG - Exonic
1084182953 11:67455685-67455707 TGGCGAGAAGAGGCCGGCCCAGG - Exonic
1085456223 11:76666678-76666700 TGGGGCTAAGGGGACCGCACAGG + Intronic
1088921141 11:114260536-114260558 TGGGGAGAGGAGGCCCGCTCCGG + Intronic
1090264451 11:125345152-125345174 TGGGGTGAAGAGGCAGGCGAGGG + Intronic
1091453774 12:590259-590281 TGGAGCGGAGAGCCACGCGCGGG + Intronic
1092002541 12:5044199-5044221 GGAGGCGATGAGGCCCGGGCAGG + Exonic
1095947152 12:47759691-47759713 TGGGGCGAAGAGGCCCGCGCTGG - Intronic
1100469081 12:94873925-94873947 AGGGGCGAAGCGGCCCGAGGAGG - Intergenic
1102218998 12:111181606-111181628 TGGTGCACAGAGGCCCTCGCCGG - Intronic
1102394651 12:112575500-112575522 GGGGGCGGGGAGACCCGCGCAGG + Intronic
1103960778 12:124607820-124607842 TGGGGCGCAGAGGCACGGACAGG + Intergenic
1104785349 12:131444956-131444978 TGGGGCCAAGAGGCCTGGGTGGG + Intergenic
1104983247 12:132583158-132583180 TGGGGCGGGGATGCGCGCGCGGG - Exonic
1105459158 13:20567334-20567356 ACGGGCGAAGAGGCCCTCGGCGG - Intronic
1113939279 13:114010216-114010238 TGGGGAGCAGAGGCCCCCACTGG - Intronic
1118822422 14:69354013-69354035 GGGAGCGAAGGGGCCTGCGCTGG - Exonic
1119438460 14:74612613-74612635 AGGGGCGCCGAGGCCCGCGTAGG + Intergenic
1120882945 14:89428782-89428804 TGGGGCGTGGAGGCCTGCGCAGG - Intronic
1122318231 14:100838027-100838049 TGTGGAGAAGAGGCCCGGGAGGG + Intergenic
1124857600 15:33405883-33405905 TGGGGCAAAGAGGCCCACAGTGG + Intronic
1129878757 15:78993770-78993792 TGGGGCCCAGAGGCCTGCACTGG + Intronic
1141990201 16:87604921-87604943 TGGGGCGCTGAGGGCCGGGCGGG + Intronic
1143543013 17:7580685-7580707 TGGGGCGAAGAGGAAGGCGCAGG - Intronic
1144050076 17:11490786-11490808 TGGGGCTAAGAGGCCCAGGGAGG + Intronic
1146957305 17:36942990-36943012 TGGAGTGCAGAGGCCCGGGCAGG - Exonic
1148879493 17:50714831-50714853 TGGGGTCAAGGGGCCCGCACTGG + Intergenic
1151814897 17:76466970-76466992 TGGGGCGGAGAGGCAGGTGCTGG + Intronic
1151961796 17:77409515-77409537 TGGGGCCAGGAGGCAGGCGCTGG + Intronic
1152357442 17:79813815-79813837 TGGGGCGAGGGGGGGCGCGCCGG - Intergenic
1152573121 17:81129091-81129113 CGGGACGAAGGGGCCAGCGCTGG + Intronic
1158649330 18:59272616-59272638 TGGGGCGACGAGGCCCGGGAGGG + Intronic
1160497834 18:79385451-79385473 TGGGGCGATGAGGCAGGCCCCGG - Intergenic
1160703146 19:517831-517853 TGGGGAGGGGAGGCCCGGGCTGG + Intronic
1160703454 19:518598-518620 GGGGGAGGAGAGGCCCGGGCTGG + Intronic
1160703467 19:518629-518651 GGGGGAGGAGAGGCCCGGGCTGG + Intronic
1161006866 19:1941434-1941456 GGGGGCGAAGGGGCCGGGGCGGG - Intronic
1161293895 19:3509900-3509922 TGCTGCGAAGAGGCAGGCGCTGG + Intronic
1162946913 19:14049390-14049412 TGGGCCAAAGAGGCCCACGTGGG - Intronic
1165873736 19:38991287-38991309 TGGGGAGAAGGGACCCTCGCAGG + Intronic
1166306775 19:41939978-41940000 TGTGTCCAAGAGGCCGGCGCGGG - Intergenic
925033096 2:666573-666595 TGGGGCGGCGAGGCCCACGCAGG - Intergenic
925047061 2:780492-780514 TGGAGCAAAGAGGCCAGAGCAGG + Intergenic
927591387 2:24360636-24360658 TGGGGCGAGGAGCCACGCCCGGG - Exonic
932162359 2:69473206-69473228 GGGGGAGAAGAGGCCTGGGCAGG - Exonic
945251155 2:207767676-207767698 TGGGGCAACGAGGCCATCGCGGG - Exonic
1175285321 20:57833666-57833688 TGGGGGGAAGAAGCCCTCGGTGG + Intergenic
1175285478 20:57834179-57834201 TGGGGAGAAGGAGCCCTCGCTGG + Intergenic
1176414653 21:6467653-6467675 TGGGGGGGAGGGGCCCGGGCTGG - Intergenic
1178673929 21:34615019-34615041 TGGGGCGCACAGGGTCGCGCGGG - Exonic
1179690153 21:43075975-43075997 TGGGGGGGAGGGGCCCGGGCTGG - Intronic
1180002293 21:45000743-45000765 TGGGGGCAAAAGGCACGCGCTGG + Intergenic
1182370647 22:29808056-29808078 TGGGACAGAGAGGCCCGAGCAGG - Intronic
1183578382 22:38706568-38706590 AGGGGCGAGGGGGCCCGGGCAGG + Intronic
1183937938 22:41274567-41274589 TGGGGCGAGTAGGCCCAGGCTGG - Intronic
1184766060 22:46573208-46573230 TTGGGCGAAGAGTCCCAGGCTGG - Intergenic
1185126923 22:49016579-49016601 TGTGGCCAAGAGGGCCGGGCGGG + Intergenic
1185193664 22:49454712-49454734 TGGGGAGAAGAGGCCAGGGAGGG + Intronic
953897340 3:46812404-46812426 TGGCTCGAAGAGGCCCGGGCAGG - Exonic
953927401 3:46989420-46989442 TGGGGAGAGGATGGCCGCGCTGG + Intronic
954316939 3:49806361-49806383 TGGGGCTATGGGGCCCGCACAGG + Intronic
954329620 3:49882709-49882731 TGGGTCGAAGAGACCAGGGCAGG + Intergenic
961820706 3:129574371-129574393 TGGGCTGCAGAGGCCCCCGCAGG + Exonic
968471638 4:785268-785290 TGGGGCGCAGAGGGGCGCGGTGG + Exonic
969239748 4:5890461-5890483 TGGAGCGGTGAGGCCCGCCCCGG + Intronic
970471551 4:16384482-16384504 TGGGGAGAAGAGGCTTGCGGAGG - Intergenic
982288322 4:153757282-153757304 TGGGGGGATGAGGCCAGCGCTGG - Intronic
986735758 5:10666200-10666222 TGTGGCGAAGAGGCCTGGTCTGG + Intergenic
1000014548 5:157266028-157266050 TGCGGCGAAGGGGCGGGCGCTGG + Intergenic
1001493628 5:172173002-172173024 TGAGGCGAGGAGACCCGCGTGGG + Intronic
1001902703 5:175444683-175444705 CGGGGCGCAGCGGCGCGCGCTGG - Intergenic
1002645004 5:180648775-180648797 TGAGGAGCAGAGGCCCCCGCGGG - Intronic
1002868878 6:1147829-1147851 TGAGCCGAAGAGGCCTCCGCAGG + Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1007394432 6:41569617-41569639 TGGGGCCAGGAGGGCCGAGCTGG + Intronic
1009437661 6:63636226-63636248 AGGGGCGGAGAGGCCCGCGGAGG - Intronic
1019310258 7:357039-357061 AGGGGGGCAGAGGCCCGTGCTGG - Intergenic
1025831443 7:65054680-65054702 TGGGTAGAAGAGGCCAGGGCAGG - Intergenic
1026840880 7:73669384-73669406 AGGAGCTAAGAGGCCCGCTCAGG - Intronic
1029490104 7:100866267-100866289 TGGGGCGAGGGGGCCGGGGCTGG + Exonic
1034339400 7:150341922-150341944 AGCGGAGAAGAGGCCCGGGCCGG - Intergenic
1035159709 7:156942021-156942043 TTGGGTGACGAGGCGCGCGCTGG + Intergenic
1039870368 8:41540547-41540569 TGGTGCGAAGAAGCCCGAGGAGG - Intronic
1043701088 8:83290347-83290369 TGGGGGGGAGAGGCGCGAGCGGG + Intergenic
1044674963 8:94719761-94719783 TGGGGCGCCGGGGCCTGCGCGGG - Intronic
1044722805 8:95167409-95167431 AGGGGTGAAGAGGCGAGCGCGGG - Intergenic
1045858133 8:106788025-106788047 TGGGGCGCAGTGGCTCACGCCGG - Intergenic
1049323517 8:142010079-142010101 TGAGGAGCAGAGGCCCTCGCGGG - Intergenic
1049406645 8:142454569-142454591 TGGGGCAGGGAGGCCCCCGCAGG + Intronic
1049778392 8:144416550-144416572 TGGCGGGAAGAGGCCAGGGCTGG + Intronic
1053003399 9:34589972-34589994 GGGGGCTCACAGGCCCGCGCAGG - Intronic
1056413399 9:86354233-86354255 TGGTGCGAGGAGGCCGGCGGGGG + Intronic
1060735593 9:126064761-126064783 TGGGGCAAAGAGGCATGGGCGGG - Intergenic
1061257388 9:129460583-129460605 CGGCGCACAGAGGCCCGCGCCGG - Intergenic
1061496438 9:130977567-130977589 TGAGGTGGAGAGGCCCGCGGCGG + Intergenic
1062215933 9:135389884-135389906 GGGGGAGAAGAGGCCCCCGGGGG - Intergenic
1062326553 9:136015251-136015273 TGGGGCGCAGGTGCCCACGCGGG - Intronic
1203563762 Un_KI270744v1:77012-77034 GGGGGCCAAGATGCCCGCCCAGG - Intergenic
1189240896 X:39523469-39523491 TGGGGTGAAGAGGCTGGCTCTGG + Intergenic