ID: 1095950049

View in Genome Browser
Species Human (GRCh38)
Location 12:47776849-47776871
Sequence GACTCAGCAGTTTCTGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095950049_1095950053 17 Left 1095950049 12:47776849-47776871 CCTAACCCAGAAACTGCTGAGTC 0: 1
1: 0
2: 0
3: 10
4: 216
Right 1095950053 12:47776889-47776911 ACCTTATTTTTCTCCCAAGCTGG 0: 1
1: 0
2: 1
3: 14
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095950049 Original CRISPR GACTCAGCAGTTTCTGGGTT AGG (reversed) Intronic
901668482 1:10839813-10839835 GGCTGAGCACTTTCTGTGTTAGG - Intergenic
902476130 1:16688964-16688986 GACTAAGGAGGTTCTGGGTAGGG - Intergenic
904568762 1:31445047-31445069 GGCTCAGCTGCATCTGGGTTGGG + Intergenic
906490759 1:46266730-46266752 GGCTCAGAAGGTTCTGAGTTGGG + Intronic
908629348 1:66085155-66085177 GACTCAGGAGGTCCTGGGTAGGG - Intronic
909092312 1:71241741-71241763 GACTCAGAGGATTCTGGCTTTGG - Intergenic
910551085 1:88476101-88476123 CTCTCAGTAGTTTCTGAGTTTGG - Intergenic
911012194 1:93292170-93292192 TACTCAGCAGTGACTGGGTATGG - Intergenic
916511024 1:165472435-165472457 GACCCAGCAGATTCTGGGCAAGG + Intergenic
920453959 1:206083545-206083567 GACACAGAAGCTTCTGGGTAGGG + Intronic
921126666 1:212184042-212184064 GACACAACAGTTTCAGGATTTGG + Intergenic
921682422 1:218050214-218050236 GAGTGAGAAGTTTGTGGGTTTGG - Intergenic
921806381 1:219460071-219460093 GACACAGCTGTTTCTAAGTTGGG - Intergenic
923379759 1:233404486-233404508 GAATGTGTAGTTTCTGGGTTTGG - Intergenic
923456829 1:234171973-234171995 CAGTCATCAGTTTCTGGGGTTGG - Intronic
1063384899 10:5610017-5610039 AGCCCAGCAGTTTCTGGGTGGGG - Intergenic
1064425108 10:15223436-15223458 CAAACAGCAGATTCTGGGTTAGG + Intronic
1064634603 10:17351069-17351091 CACTCAGCAGTTTCAGGGAAAGG - Intronic
1064697155 10:17978942-17978964 GATTCAGTAGATTCTGGGTTGGG - Intronic
1065699611 10:28411945-28411967 ACCTCAGCAGATTCTGGGTCAGG + Intergenic
1066006835 10:31153668-31153690 GACTCAGCACTTTGTGGAGTGGG - Intergenic
1067307348 10:45076768-45076790 GACTCAGGATTTTCTGGTTGTGG + Intergenic
1076750280 10:132538773-132538795 GTGTCAGAAGTTCCTGGGTTAGG - Intronic
1077520209 11:3028761-3028783 TTCCCAGCAGATTCTGGGTTAGG + Intronic
1078855184 11:15201178-15201200 CACTCAGCACTTCCTGGGTGGGG + Intronic
1080503532 11:32892333-32892355 CGCTCAGCTGTTTCTGGATTGGG + Intergenic
1081792639 11:45799171-45799193 GACTGCGTAGTTTCTGGGTCTGG - Intergenic
1082124662 11:48417799-48417821 GACTCAGCATTTCCAGAGTTTGG - Intergenic
1082251392 11:49984948-49984970 GACTCAGCAGTGCCAGAGTTTGG + Intergenic
1082717472 11:56632579-56632601 GAAGCAGAAGTTTCTGGGGTTGG - Intergenic
1083252087 11:61475029-61475051 GGCTCAGAAGAATCTGGGTTGGG + Intronic
1084232203 11:67761286-67761308 GACTCAGCAATGCTTGGGTTTGG - Intergenic
1084650056 11:70484180-70484202 GGCTCAGCAGTCTGTGGCTTTGG - Intronic
1085716447 11:78877760-78877782 GGCCAAGCAGTTTCTGAGTTTGG - Intronic
1086133055 11:83420696-83420718 GACTCAGCAATACTTGGGTTTGG - Intergenic
1086827802 11:91520655-91520677 AACTCAGCAGTTTCACTGTTAGG - Intergenic
1087193426 11:95280631-95280653 CACTCAGCAGATTCTGGGCTTGG + Intergenic
1088719553 11:112579887-112579909 GACACAGCAGTGACTGTGTTTGG + Intergenic
1091760372 12:3083536-3083558 GAGTGAGCAGTTTCTTGGTAGGG + Intronic
1093720399 12:22436282-22436304 AGATCAGCAGTTTCAGGGTTTGG + Intronic
1093732067 12:22576241-22576263 GACTCACCAGCGTCTGTGTTTGG - Intergenic
1095950049 12:47776849-47776871 GACTCAGCAGTTTCTGGGTTAGG - Intronic
1096362324 12:50998693-50998715 CTCTAAGGAGTTTCTGGGTTGGG + Intronic
1096635904 12:52959285-52959307 GACTCAGCAGTTGGTGGGGTAGG + Intergenic
1097689528 12:62721477-62721499 GCCTCAACAGTTTCTAGGTCTGG + Intronic
1099174400 12:79403798-79403820 GACTCAGCAGATTTGGGGTAGGG - Intronic
1104420077 12:128627807-128627829 GACCCAGCACTTTCTGGGCACGG - Intronic
1104657279 12:130582700-130582722 GATTCAGCAGGTCCTGGGTTTGG - Intronic
1108374196 13:49798050-49798072 GTCCCAGCAGATTCTGTGTTTGG - Intergenic
1108410025 13:50136081-50136103 GACTCATCACCCTCTGGGTTGGG - Intronic
1112998226 13:105600032-105600054 CACTCAGCGGTTTCTGTGTCTGG + Intergenic
1114890849 14:26921018-26921040 GAGTCAGCATTGACTGGGTTAGG + Intergenic
1115967753 14:38911611-38911633 GACTTAGCAGTTCCAGGCTTTGG + Intergenic
1116378039 14:44228955-44228977 CACTAAGCAGTTTCAGAGTTGGG - Intergenic
1117182761 14:53208958-53208980 AACTCAGCATTCTTTGGGTTTGG + Intergenic
1118147417 14:63155712-63155734 GACTCATCACTTTCTGTGTGAGG + Intergenic
1118470429 14:66070055-66070077 GGCTCATCAGTTTCTGCTTTGGG - Intergenic
1119617982 14:76111456-76111478 GACTCAGCAGCAGCTAGGTTGGG - Intergenic
1119902392 14:78272478-78272500 GACTCTTCAGTTCCTGGGCTGGG + Intronic
1120121267 14:80682197-80682219 GCTTTAGAAGTTTCTGGGTTTGG - Intronic
1120140460 14:80924985-80925007 GAATCACAAGTTTCTGGTTTTGG + Intronic
1121859859 14:97307398-97307420 GAGATAGCAGTTTCTGGATTAGG + Intergenic
1124949330 15:34302243-34302265 GACTGACCAGTTTGTGGATTTGG - Intronic
1125684590 15:41556357-41556379 GAATCCACAGTTTCTGAGTTTGG - Intergenic
1128036050 15:64527722-64527744 GACTCACAAGTTTCTAGTTTGGG - Intronic
1128207621 15:65867242-65867264 GACTCAACTGTTTCTGCTTTGGG + Intronic
1129231318 15:74198734-74198756 AGCTCAGCAGGTGCTGGGTTTGG - Intronic
1130437675 15:83918316-83918338 GACTCAGTAGTTCCTAGCTTTGG + Intronic
1130564452 15:84981797-84981819 GACTCAGCCGCTCCTGGGTAAGG + Intronic
1130759253 15:86800888-86800910 GAAGCAGCAGTTGCTGAGTTAGG + Intronic
1130959756 15:88652055-88652077 GACCCAGCATCTTCTGGGTGGGG - Intronic
1131160164 15:90100473-90100495 AATTAAGAAGTTTCTGGGTTAGG + Intronic
1131751193 15:95509823-95509845 GTCTCAGCATTTTCTGTGCTTGG - Intergenic
1132933104 16:2468658-2468680 GAGACAGCAGGTTCTGGGCTGGG + Intergenic
1133156940 16:3881732-3881754 GACTCACGGGTTTCTGGCTTAGG - Intergenic
1134273541 16:12755840-12755862 GAATCAGAAGTTGCTGGGTACGG + Intronic
1135706762 16:24681863-24681885 GACTCAGCAGTTTCATCTTTAGG - Intergenic
1135933301 16:26757757-26757779 GACTCCTAAGTTTCTGGCTTAGG + Intergenic
1137055489 16:35744425-35744447 GACTCAGCAGTGCTTGGGGTTGG + Intergenic
1137467724 16:48726086-48726108 GACTCTGAAGGTTTTGGGTTTGG + Intergenic
1137490040 16:48924749-48924771 GACTCAGGACTTCCTGGGTCTGG - Intergenic
1137768525 16:50996297-50996319 GACTCCGCAGTTTCTGAATGTGG + Intergenic
1137830550 16:51539393-51539415 GAGTCACCAGTTGATGGGTTGGG - Intergenic
1138836783 16:60447110-60447132 GAATCAGCATTTTGTGGGGTTGG - Intergenic
1139625175 16:68182328-68182350 GACAGAGCATTTTCTGGGCTAGG + Intronic
1141715455 16:85724389-85724411 GACTCTGGACTTGCTGGGTTGGG + Intronic
1145863449 17:28226115-28226137 GACTCAGCTGCTTCTGGTTGGGG + Intergenic
1145981780 17:29016932-29016954 GAGTCAGCTGCTTCTGGGTCTGG - Intronic
1147236413 17:39060973-39060995 GACTCAGTAGTTCTGGGGTTGGG + Intergenic
1153065170 18:1037137-1037159 GACTCAGCAATTTCTAGCTCAGG + Intergenic
1154492150 18:14930637-14930659 GCCTCAGCACTTCCTGGGTGTGG - Intergenic
1155843903 18:30681809-30681831 GAGGCAGCAGATTCTGGGTTTGG - Intergenic
1157175383 18:45447032-45447054 GTCTCAGCACTTTCTAGTTTGGG + Intronic
1157548048 18:48561416-48561438 GTCTCAGCAATTTCTGGGAATGG - Intronic
1164829889 19:31312233-31312255 GAATCAGCAGATGCTGGCTTAGG + Intronic
1165003019 19:32780466-32780488 GACTCAGCAGTTTGTGTGAAGGG - Intronic
1165495769 19:36151363-36151385 GACTGACCAGGATCTGGGTTGGG - Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
1202710149 1_KI270714v1_random:14817-14839 GACTAAGGAGGTTCTGGGTAGGG - Intergenic
925856917 2:8138009-8138031 CACTCAGCGGTTTCTGCGTGGGG - Intergenic
929665764 2:43832602-43832624 GACTCAGCAGGTCTTGGGTGCGG - Intronic
930189399 2:48441736-48441758 GATGCTGCAGTTTCTGGGTAGGG + Intronic
930439197 2:51385421-51385443 GAGTGAGCAGTATCTGGATTTGG + Intergenic
931503341 2:62895849-62895871 GATTCAGAAGTTTCTAGCTTTGG + Intronic
933902364 2:86859219-86859241 GACCCATCAGTTGCTGGGCTCGG - Intronic
935232626 2:101112243-101112265 GACACAGCAGTGACTGGGTTTGG - Intronic
935778181 2:106490049-106490071 GACCCATCAGTTGCTGGGCTCGG + Intergenic
936323354 2:111485008-111485030 AATTCAGCAGTTTCTGGGACAGG + Intergenic
943426618 2:187745740-187745762 GGCTCTGCAGTTTCTGGCATTGG - Intergenic
945940198 2:215941621-215941643 CAATCAGCAGTTTCTGCATTTGG + Intergenic
946089473 2:217207977-217207999 GACTCAGCTGCTTCTGTGTGCGG + Intergenic
947518934 2:230829146-230829168 GACTCAGCTCTTCCTGGCTTGGG + Intergenic
947807772 2:232980458-232980480 GACTCAGGAGGTCCTGGGTGGGG + Intronic
1169109857 20:3025483-3025505 GAAGCAGGAGATTCTGGGTTGGG + Intronic
1171045695 20:21808174-21808196 GACTCCCAAGTTTCTGGTTTTGG + Intergenic
1174999441 20:55610873-55610895 GACTCTATAGTTTCTGGGTATGG + Intergenic
1175084435 20:56446752-56446774 GATTCAACAGTCTCTGGGGTTGG - Intronic
1179809881 21:43864328-43864350 GCCTCCGCAGGTTCTGGGATCGG + Intergenic
1181584249 22:23844539-23844561 GACACAGCTGTTTCTGGGAGGGG - Intergenic
1183440977 22:37823032-37823054 AACATACCAGTTTCTGGGTTTGG + Intergenic
1185129271 22:49028428-49028450 GTCCCAGCACTGTCTGGGTTGGG + Intergenic
949935080 3:9110217-9110239 GACTCTCCAGTTTTTGGTTTGGG + Intronic
950640528 3:14345516-14345538 GACTCAGCTGGCTCTGGGTTGGG + Intergenic
951036890 3:17942503-17942525 GATTGAGAAGTTACTGGGTTGGG + Intronic
951190265 3:19760721-19760743 GATACAGAAGTTTCTGGTTTGGG + Intergenic
951753127 3:26059270-26059292 GATTCAGCAGTTACTGTGGTTGG + Intergenic
957950316 3:87117455-87117477 GAAACAGCAGCTTCTGGCTTAGG - Intergenic
959747286 3:109791472-109791494 GAGTTAGCAGTTTCTGGTATGGG + Intergenic
960018955 3:112927312-112927334 AACTCAGCAGTTTCTGGCCTTGG - Intronic
961880954 3:130060876-130060898 GACTCAGCAATGCTTGGGTTTGG - Intergenic
964721549 3:159772109-159772131 GACTCATCAATTTCTGATTTTGG + Intronic
965996720 3:174892028-174892050 AACTAAGCAGTTTCTGCTTTAGG - Intronic
966125419 3:176570765-176570787 GACTATAAAGTTTCTGGGTTTGG - Intergenic
966627809 3:182037379-182037401 GAATCAGAAGTTTTTGGTTTTGG + Intergenic
967740384 3:192997256-192997278 GACTCAGCAATGCCTGGGGTTGG - Intergenic
967917592 3:194590332-194590354 GACCCTGCAGTGACTGGGTTTGG + Intronic
968771467 4:2510278-2510300 AAATCAGCAGTGTCTGGGCTGGG + Intronic
969748957 4:9095850-9095872 GACTCAGCACTCTTGGGGTTGGG - Intergenic
971539251 4:27795199-27795221 GTCTCAGCATATTCTAGGTTTGG + Intergenic
973791182 4:54379578-54379600 TCCCCAGGAGTTTCTGGGTTTGG + Intergenic
973822609 4:54676238-54676260 AACTCAGCAGGTTCTTGGGTGGG - Intronic
974582096 4:63815991-63816013 GAAACAGCAGTTGCTGGGTTGGG - Intergenic
974808362 4:66912857-66912879 GATTCAGCAGGTTTTGGGTAAGG - Intergenic
975786535 4:77895134-77895156 GACTCAGAAGTTTTTGAGATGGG + Intronic
977934054 4:102780580-102780602 TAGTCAGCAGTTTCAGGGTCAGG - Intergenic
982064503 4:151641332-151641354 GACTCAGCATGTTTTGGTTTTGG + Intronic
984168887 4:176337331-176337353 AAGTCAGCAATATCTGGGTTTGG + Intergenic
984349082 4:178568785-178568807 CAATCAGTTGTTTCTGGGTTTGG - Intergenic
985197691 4:187449828-187449850 GCCTCAGCACTATCTGTGTTGGG + Intergenic
989309324 5:39996162-39996184 GACTCACAAATTTCTGGCTTGGG - Intergenic
992180540 5:74193129-74193151 GTCTCACCAGTTCCTGGCTTTGG - Intergenic
992260753 5:74967810-74967832 GACACAGCAGTGTCTGGGGGAGG - Intergenic
992703262 5:79362218-79362240 GACTTTGAAGTTTCTGGATTTGG - Intergenic
995321573 5:110840492-110840514 AAAGCAGCAGTTTCTGGGTGAGG - Intergenic
995649506 5:114353879-114353901 GACTATGCTGTTTCTGGGTATGG + Intergenic
996204283 5:120711943-120711965 GACACAGAATTTTCTGGGTGTGG - Intergenic
998507099 5:142680881-142680903 GATTCTGCATTTTCTGGGTGGGG - Intronic
998929123 5:147161060-147161082 GAATCAGAATTTTCTGGGCTGGG + Intergenic
998998737 5:147895818-147895840 GAGTCAGGAGTGTCGGGGTTGGG + Intronic
999503598 5:152171583-152171605 GACTCAGCAGTTTCTTTGCTCGG - Intergenic
1000287920 5:159843911-159843933 CAATCAGCACTTTCTGGGATAGG - Intergenic
1002460459 5:179370746-179370768 GACTCTGCCGTTGCTGGGTGTGG - Intergenic
1002478614 5:179484676-179484698 GACTCCGCAGCTTCTGGCCTGGG - Intergenic
1003105282 6:3210622-3210644 TCCTCAGCACTGTCTGGGTTGGG - Intergenic
1004884192 6:20036155-20036177 GATTCAGAGGTCTCTGGGTTGGG + Intergenic
1006452354 6:34112525-34112547 GACTCACCAGTTTCTCTGTGGGG + Intronic
1006822964 6:36913244-36913266 CACACAGCAGGGTCTGGGTTGGG + Intronic
1008497152 6:52145112-52145134 GATTCAGCACTTTCTTGGTGTGG - Intergenic
1008806794 6:55439519-55439541 GACTCCGCAGTATCCGGATTAGG - Exonic
1010020901 6:71158819-71158841 GAATCAGCAGGTTTTGGGTGGGG - Intergenic
1010298585 6:74231189-74231211 TACTAAACAGGTTCTGGGTTTGG - Intergenic
1010960791 6:82143482-82143504 GACTCAGCTTTTCCTGGATTAGG - Intergenic
1012560339 6:100572326-100572348 GAATCAGCAGATTCAGTGTTTGG - Intronic
1012616334 6:101283618-101283640 GACTTAGCAGTTCCAGGCTTTGG + Intergenic
1013646471 6:112146482-112146504 GAATCAGCAGTTCCTGGAGTGGG + Intronic
1013651363 6:112198310-112198332 GACCTAGCAGGTTCTTGGTTTGG + Intronic
1014490054 6:122051931-122051953 AGCTCAGCAGTGTTTGGGTTTGG + Intergenic
1014837337 6:126174252-126174274 GACTTAGACTTTTCTGGGTTTGG - Intergenic
1016499860 6:144707713-144707735 GATTCAGCAGGTTTTGGGTGGGG + Intronic
1020315946 7:6905389-6905411 GACTCAGCAATGCTTGGGTTTGG - Intergenic
1022108489 7:27213570-27213592 GACTGAGCCCTTTCTGGGGTGGG + Intergenic
1023355087 7:39358497-39358519 GATTTTGCAGTTACTGGGTTGGG - Intronic
1025734631 7:64136145-64136167 CACTCATCAATTTCTGGGTGGGG - Intronic
1026160470 7:67864124-67864146 CACTCATCAATTTCTGGGTGGGG - Intergenic
1028067996 7:86412634-86412656 TAGTCAGCAGGTGCTGGGTTAGG + Intergenic
1028122444 7:87071328-87071350 CACTCCTCAGTTTCTGGCTTTGG + Intergenic
1028879581 7:95865024-95865046 GAGTCAGAAATTTCAGGGTTGGG - Intronic
1029980555 7:104874824-104874846 AACTCAGCAGTTTGATGGTTTGG + Intronic
1029985704 7:104921349-104921371 GCCACAGCTGTTTCTGGATTTGG - Intergenic
1030080927 7:105777024-105777046 CACTCAGAAGTGTCTGGGATAGG - Intronic
1030638941 7:111982277-111982299 GAAACAGGAATTTCTGGGTTTGG - Intronic
1031116949 7:117679303-117679325 GACTCAGCAGTTCCGAGGTAGGG - Intronic
1031804527 7:126292416-126292438 GAATCAGCACCTTCTGGGGTTGG - Intergenic
1032366302 7:131303208-131303230 GAACCAGGAGTTTCTTGGTTTGG + Intronic
1033463725 7:141571375-141571397 GACTCAGTAGGTTCTGGATGGGG - Intronic
1035527558 8:325591-325613 GACTGAGGGGTTTCTGGGCTGGG - Intergenic
1035632578 8:1119980-1120002 GACTCAGCACTTTTAGGGCTGGG + Intergenic
1037039416 8:14211936-14211958 GATTCAGAACTTTCTGGGTATGG - Intronic
1037933224 8:22896537-22896559 GATTCAGCATTTTCTGGCTCTGG + Intronic
1039595664 8:38787961-38787983 GAGACTGCAGATTCTGGGTTGGG - Intronic
1042003646 8:64155743-64155765 TATTCAGCATTTTCTGTGTTTGG - Intergenic
1042790710 8:72602642-72602664 GACTCACAATTTTATGGGTTGGG + Intronic
1042873909 8:73423476-73423498 CACTCAGCAGTGTCGGGCTTGGG - Intronic
1043837627 8:85064544-85064566 GACTCAGCAATGCTTGGGTTTGG - Intergenic
1047898075 8:129388906-129388928 GACACAGCAGTTGCTGGATGGGG + Intergenic
1048610718 8:136019768-136019790 GACTCAGAGTTATCTGGGTTGGG + Intergenic
1051173258 9:14340901-14340923 GACTGACCAGTGTCGGGGTTGGG + Intronic
1051407231 9:16750886-16750908 AACACAGAAGTTTCTGGGCTAGG + Intronic
1053415792 9:37946052-37946074 GACACAGCACTGTCTGGGCTGGG + Intronic
1054814583 9:69462872-69462894 GACTCAGTAGGTTTGGGGTTGGG + Intronic
1055229770 9:74048650-74048672 TACTCAGCATTTTTTGTGTTTGG + Intergenic
1059109589 9:111542867-111542889 GACTTAGCAGTGAATGGGTTGGG - Exonic
1062026831 9:134344416-134344438 GACTCAGCAGCTGCAGGGTGGGG + Intronic
1187284737 X:17894133-17894155 GACTCAGGAGTGACTTGGTTGGG + Intergenic
1187489509 X:19737702-19737724 GCCTCACCAGTTGCTAGGTTGGG + Intronic
1187621856 X:21065090-21065112 TACTCTGCTGTTTCTGAGTTTGG - Intergenic
1187627178 X:21128669-21128691 GACTCAGGAGTTCTTGGGTGAGG + Intergenic
1190465404 X:50721158-50721180 GAGTCAGTAGTTTCTGAGCTAGG - Intronic
1190585021 X:51931399-51931421 GACTCATAAATTTCTGGTTTGGG + Intergenic
1193057915 X:77174239-77174261 GACTCCATAGTTTCTAGGTTAGG + Intergenic
1194728727 X:97429304-97429326 GAGTCAGTGGTTTCTTGGTTAGG + Intronic
1195309365 X:103615731-103615753 GGCTCGGGAGCTTCTGGGTTGGG + Intronic
1196624173 X:117859289-117859311 GAATCACCAGTTTGGGGGTTAGG - Intergenic
1197354666 X:125423174-125423196 GACTCAGCAATTTCACTGTTAGG + Intergenic
1198254023 X:134909361-134909383 GGGTCACCAGTTTCTGGGTGAGG - Intronic
1202179516 Y:22127593-22127615 TCCTGAGTAGTTTCTGGGTTGGG - Intergenic
1202211845 Y:22458801-22458823 TCCTGAGTAGTTTCTGGGTTGGG + Intergenic