ID: 1095951352

View in Genome Browser
Species Human (GRCh38)
Location 12:47783594-47783616
Sequence TGTTCTCGAGAGCCCTGTGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095951346_1095951352 4 Left 1095951346 12:47783567-47783589 CCAGGGCCCATACTGGAGGGGAG 0: 1
1: 0
2: 1
3: 22
4: 192
Right 1095951352 12:47783594-47783616 TGTTCTCGAGAGCCCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 97
1095951348_1095951352 -3 Left 1095951348 12:47783574-47783596 CCATACTGGAGGGGAGAATCTGT 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1095951352 12:47783594-47783616 TGTTCTCGAGAGCCCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 97
1095951338_1095951352 25 Left 1095951338 12:47783546-47783568 CCTGAGGAATGGGGGCCACAGCC 0: 1
1: 0
2: 1
3: 31
4: 280
Right 1095951352 12:47783594-47783616 TGTTCTCGAGAGCCCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 97
1095951342_1095951352 10 Left 1095951342 12:47783561-47783583 CCACAGCCAGGGCCCATACTGGA 0: 1
1: 0
2: 2
3: 14
4: 171
Right 1095951352 12:47783594-47783616 TGTTCTCGAGAGCCCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 97
1095951347_1095951352 -2 Left 1095951347 12:47783573-47783595 CCCATACTGGAGGGGAGAATCTG 0: 1
1: 0
2: 0
3: 10
4: 150
Right 1095951352 12:47783594-47783616 TGTTCTCGAGAGCCCTGTGGGGG 0: 1
1: 0
2: 0
3: 9
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095951352 Original CRISPR TGTTCTCGAGAGCCCTGTGG GGG Exonic
900669886 1:3844970-3844992 TTCTCTCGAGAGGCCTTTGGGGG + Exonic
901206656 1:7501401-7501423 TGTGCTCCAGAGCCCGCTGGAGG + Intronic
902619687 1:17643701-17643723 TTTTCACGAGAGCCCTGTGCAGG - Intronic
903390418 1:22959909-22959931 TGATCTCTAGGGTCCTGTGGAGG - Intronic
904789475 1:33007935-33007957 TCTCCTCGATAACCCTGTGGAGG - Intergenic
908551793 1:65215745-65215767 TGAGCTCTAGAGCCCTCTGGAGG - Intronic
915605602 1:156948215-156948237 GGTTCTCAAGAGACCTGTGGAGG + Exonic
918169663 1:181984626-181984648 TGTTCTCTAAAGGCCTGGGGAGG + Intergenic
918237959 1:182598556-182598578 TGTTGTGGAGAGCTCTGGGGAGG - Intergenic
922474558 1:225898338-225898360 TGTTAACGAGAGCACTGTAGGGG + Intronic
1069902910 10:71716115-71716137 TGCACTCGTGAGCCCTGCGGCGG + Exonic
1072033561 10:91543453-91543475 TGTTCTCATGAGCCCTCTTGAGG + Intergenic
1074537792 10:114341047-114341069 TTTTCACAAGAGCCCTGTGAGGG - Intronic
1074777235 10:116775385-116775407 TCTTCTAGAGAGCCCTGGGGAGG + Intergenic
1077368325 11:2170286-2170308 TGTTCACTGGGGCCCTGTGGGGG - Intronic
1081528969 11:43944925-43944947 TGTGCTCGGGCGCCCTCTGGTGG + Intergenic
1085305094 11:75481448-75481470 TGTTCCGGGGAGCCCTGGGGAGG + Intronic
1091180037 11:133596176-133596198 GGTTCTCGGGAGCGCTGGGGAGG - Intergenic
1091873911 12:3918015-3918037 TGTTCTCCAGCTCCCTGGGGAGG + Intergenic
1095951352 12:47783594-47783616 TGTTCTCGAGAGCCCTGTGGGGG + Exonic
1099876462 12:88412823-88412845 TGTTCTAATGAGCACTGTGGAGG - Intergenic
1102687109 12:114733934-114733956 TGAACTCCAGAGCCCAGTGGAGG + Intergenic
1102914848 12:116745059-116745081 TATTATCCAGAGCCCAGTGGAGG + Intronic
1103794574 12:123494540-123494562 TGTTCTTGAGACCCCGGTGTGGG + Intronic
1106116351 13:26821008-26821030 TGTGCTGGAGCTCCCTGTGGAGG + Intergenic
1108354836 13:49620731-49620753 TGTTCTAGGGAGTTCTGTGGAGG + Intergenic
1110273613 13:73618368-73618390 TTTGCTCAGGAGCCCTGTGGGGG + Intergenic
1114017633 14:18445790-18445812 TGTTCTGGAGTGCTCTGTGAGGG + Intergenic
1114019866 14:18468368-18468390 TGTTCTCGAATGCTCTGTGAGGG + Intergenic
1121866687 14:97368452-97368474 TGTTCTCCAGACCCCTGAGAAGG - Intergenic
1128761646 15:70220093-70220115 TGTTTTCAGGAGCCCAGTGGAGG + Intergenic
1129743977 15:78005241-78005263 TGTCCTCCAGAGCTCAGTGGAGG - Intronic
1132291398 15:100706142-100706164 AGTTCTGGGGAGCCCTGTGGAGG + Intergenic
1136545981 16:30954994-30955016 TGTTCCCAAGAGCCGGGTGGTGG + Intronic
1141885934 16:86892247-86892269 TATTCTCCATAGCCCTTTGGGGG + Intergenic
1143033669 17:3982312-3982334 GGCTCACGAGAGGCCTGTGGTGG + Intergenic
1143901589 17:10178511-10178533 GGTTTTCTGGAGCCCTGTGGTGG - Intronic
1145761638 17:27429030-27429052 TGCCCTTGAGAGCCCTGTGAGGG - Intergenic
1146824948 17:36013896-36013918 TCTCCTCCAGAGCACTGTGGAGG + Exonic
1147981922 17:44280114-44280136 TATGCTGGGGAGCCCTGTGGAGG + Intergenic
1148064322 17:44857678-44857700 TTTTCTCCAAGGCCCTGTGGAGG - Intronic
1148208224 17:45792790-45792812 TGTTTTTGAGCCCCCTGTGGGGG - Intronic
1149003334 17:51779187-51779209 GTGCCTCGAGAGCCCTGTGGAGG + Intronic
1151999461 17:77636445-77636467 TGTTCTGGAGCTCCCTGTTGGGG - Intergenic
1203157744 17_GL000205v2_random:20464-20486 TGTTCTGGAGTCCTCTGTGGAGG + Intergenic
1153103741 18:1504029-1504051 TGCTCTAGACAGCCCGGTGGAGG - Intergenic
1155073633 18:22337033-22337055 TGTGCTCAAGAACCCTGGGGTGG - Intergenic
1155227845 18:23745426-23745448 TATTCTAGAGAGCCCAGGGGTGG - Intronic
1156315708 18:35966986-35967008 TGCTCTCCAGAGCCCTGTCTGGG - Intergenic
1160920918 19:1520202-1520224 GGGTCTCTGGAGCCCTGTGGTGG + Intergenic
1162720153 19:12657333-12657355 CGTAGCCGAGAGCCCTGTGGCGG - Intronic
1162973498 19:14195318-14195340 TGTCCTCGGGTGCCCTGTGATGG + Intronic
1166718884 19:44986360-44986382 TTTTCTCGGGAACCCTGGGGAGG + Intronic
932580525 2:72990191-72990213 TGTTCCCGAGAGCCCAGGGTGGG - Intronic
934556312 2:95288823-95288845 TCTCCTCGGAAGCCCTGTGGGGG - Intronic
934730585 2:96654067-96654089 TGTTCTCCTTAGCCCTGTGCTGG - Intergenic
938306833 2:130262399-130262421 GCTTCTCAAGAGCCCTGTGGGGG - Intergenic
941018145 2:160380293-160380315 TGTTCTGGAAAGCCCACTGGTGG - Intronic
1173502385 20:43563657-43563679 TGTTCTGAAGTGCTCTGTGGTGG + Intronic
1174598682 20:51706446-51706468 TCTTCTAGATAGCCCTGTGAAGG - Intronic
1177310365 21:19384353-19384375 TGTTGTTGAGAGACCTGTTGTGG - Intergenic
1180062639 21:45393588-45393610 TGTTCTAGAAAGGCGTGTGGCGG - Intergenic
1180442138 22:15376659-15376681 TGTTCTGGAGTGCTCTGTGAGGG + Intergenic
1180444373 22:15399193-15399215 TGTTCTCGAATGCTCTGTGAGGG + Intergenic
1181403121 22:22663868-22663890 TGTTGTGGGGAGCCCTGTGGAGG - Intergenic
1181461470 22:23088566-23088588 TGTCCTGGAGTCCCCTGTGGAGG - Intronic
1184962517 22:47941767-47941789 TGTCCTGAAGAGCCATGTGGTGG - Intergenic
951456814 3:22901968-22901990 TTTTCTCATGAGCCCTTTGGAGG + Intergenic
954395669 3:50292125-50292147 TGTTCTCGAGGGCCCTGGGTGGG - Intronic
954522007 3:51236812-51236834 TGGTCTCTAGAGACCTGTGCAGG + Intronic
954744576 3:52779842-52779864 ACTTCTCGTGATCCCTGTGGCGG - Intronic
956374943 3:68603943-68603965 TTTTCTGGTGACCCCTGTGGGGG - Intergenic
961325806 3:126108602-126108624 TGGTCACGAGAGCTCTGTTGAGG + Intronic
969219844 4:5752449-5752471 TTTCCTCCACAGCCCTGTGGGGG + Intronic
969442490 4:7225750-7225772 TGCTCTCGGGGCCCCTGTGGTGG + Intronic
974039778 4:56847413-56847435 TGTTGTCAGAAGCCCTGTGGAGG - Intergenic
985070167 4:186159765-186159787 TGTTCACGCGAGGCCTGTAGTGG + Intronic
989757453 5:44973040-44973062 TCTTCTCTAGGGCACTGTGGTGG - Intergenic
997258997 5:132451309-132451331 AGTTCTCCAGAGCTCTGTGCAGG - Intronic
1006388801 6:33746876-33746898 TGTTCACCAGAGCCCTGGTGCGG + Exonic
1013193445 6:107824134-107824156 TGTTCACCAGAGCCCTGAGCAGG + Exonic
1013649601 6:112181203-112181225 TCTTCTCTAGACCACTGTGGCGG + Intronic
1017676490 6:156819886-156819908 GTTTTTCTAGAGCCCTGTGGAGG + Intronic
1018006308 6:159625487-159625509 TGTTCTTGAGAGCTCTTTGGAGG - Intergenic
1019121082 6:169804271-169804293 TGGTCTGAAGAGCTCTGTGGTGG - Intergenic
1020141873 7:5616141-5616163 TGTTCTCAGGACCCCTGCGGGGG - Intergenic
1022517542 7:30985551-30985573 TTTTCAGGAGAGCCATGTGGTGG - Intronic
1027644398 7:80779048-80779070 TGTTATAGAGAGCACTGTGCTGG - Intronic
1033038215 7:137894741-137894763 TGTTTTAGAGGGCCCTGTGCTGG - Intronic
1034759009 7:153653661-153653683 TGATCTGGAGAGGCATGTGGTGG - Intergenic
1048995171 8:139789673-139789695 TGCTCCCGAGTGCCCTGTGCTGG + Intronic
1049428283 8:142547321-142547343 TCTTGTCGTGAGCCCTGTGCTGG + Intergenic
1049529408 8:143146932-143146954 TGTCTTCCAGAGCCCTCTGGAGG - Intergenic
1053050777 9:34958802-34958824 TTTTCTAGGGAGCCCTCTGGGGG - Intronic
1060252411 9:121996977-121996999 TGTTCTCAAGTTCACTGTGGAGG + Intronic
1061429529 9:130522526-130522548 TGTCCTTGCAAGCCCTGTGGGGG - Intergenic
1062363062 9:136196681-136196703 TGTTCTCGAGTATCCTGTGGAGG - Exonic
1185460450 X:330812-330834 TGTTGTGGGGAGGCCTGTGGGGG + Intergenic
1186946638 X:14575832-14575854 TGTAGCCGAGAACCCTGTGGGGG - Intronic
1187813857 X:23209733-23209755 GATTCTGGAGAGTCCTGTGGAGG - Intergenic
1188932753 X:36133763-36133785 TATTCACCAGAGCCCTTTGGGGG - Intronic
1194746641 X:97635672-97635694 TCCTTTCCAGAGCCCTGTGGAGG + Intergenic
1195716574 X:107824848-107824870 TGTGCTAGAGAGCACTGAGGTGG - Intergenic
1195746210 X:108121313-108121335 TGTTTTCAAAAGCCCTGTGCAGG + Intronic
1200289175 X:154855621-154855643 TTTTCTCTCCAGCCCTGTGGTGG + Intronic
1201766706 Y:17579583-17579605 TGTTCACGCGTGCCCAGTGGTGG - Intergenic
1201834846 Y:18326401-18326423 TGTTCACGCGTGCCCAGTGGTGG + Intergenic