ID: 1095951403

View in Genome Browser
Species Human (GRCh38)
Location 12:47783804-47783826
Sequence CTGCCCGCCCACCATGCCCT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 312
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 278}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095951403_1095951406 6 Left 1095951403 12:47783804-47783826 CCAAGGGCATGGTGGGCGGGCAG 0: 1
1: 0
2: 1
3: 32
4: 278
Right 1095951406 12:47783833-47783855 CCAGAGCCTTAGAGATTCATAGG 0: 1
1: 0
2: 3
3: 14
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095951403 Original CRISPR CTGCCCGCCCACCATGCCCT TGG (reversed) Exonic
900242489 1:1623707-1623729 CTGCCCGTCCCGCCTGCCCTTGG - Intronic
900617940 1:3573691-3573713 CTCCCCTCCCACCACTCCCTGGG + Intronic
900790175 1:4674747-4674769 CTGCCTGCTCACTCTGCCCTGGG - Intronic
901020805 1:6254432-6254454 CTGCCCTCCCAGCATGCCACAGG + Intronic
901091627 1:6645501-6645523 CTGCCCGCCCCCAATTCCGTGGG + Intronic
901241586 1:7697258-7697280 CTGGGCACCCACCAGGCCCTGGG + Intronic
901511931 1:9721868-9721890 CTGCCCGCCCCCCAGGGCCTTGG - Intronic
901675003 1:10878067-10878089 CTGGCCTCCCACCAGACCCTGGG + Intergenic
903012651 1:20342518-20342540 CTGCCAGCCCTTCCTGCCCTGGG + Exonic
903271139 1:22189115-22189137 CTGTGCGCCCACCTTGGCCTGGG + Intergenic
903735545 1:25528105-25528127 CTGCCTGCCCGCCAGGGCCTGGG - Intergenic
904406773 1:30296054-30296076 ATGCATACCCACCATGCCCTAGG - Intergenic
904479935 1:30787385-30787407 CTCCCAGCCCACGAAGCCCTGGG + Intergenic
905211554 1:36377882-36377904 CTGCCTGCCTGCCATGCACTAGG + Intronic
905844846 1:41220258-41220280 CTGCCTGCCCACAATGCAGTTGG - Intronic
906151052 1:43588048-43588070 CTGCCCGCAGACCATGTCCCTGG + Intronic
910556936 1:88544758-88544780 CTCCCTGCTCACCATGCACTGGG - Intergenic
912565664 1:110585550-110585572 TTGGCCTCACACCATGCCCTGGG - Intergenic
912863834 1:113238884-113238906 CTGCCTGCCCACAACCCCCTTGG - Intergenic
915007125 1:152648882-152648904 CTCCCTGACCACCATACCCTGGG - Intergenic
915549720 1:156625054-156625076 CTCTCCGCCCACCCTGCCCTCGG + Intronic
915631390 1:157155906-157155928 CACCCCGCCCACCCTGCCCCCGG + Intergenic
916214260 1:162382413-162382435 CTGAGTGCCCACCATGTCCTCGG + Intronic
920655727 1:207873169-207873191 CTCCCCGCCCACCAAGAGCTTGG - Intergenic
921128945 1:212202770-212202792 CTTCCCTCCCAGCATGCCCTGGG - Intergenic
924799414 1:247316735-247316757 CTGTCCACCCACCTGGCCCTTGG - Intronic
924832746 1:247614959-247614981 CAGGCCGTCCACCATGGCCTTGG - Intergenic
1063102566 10:2963253-2963275 CTGCCCACCCTCCATCTCCTGGG + Intergenic
1063489252 10:6447997-6448019 CTGCCCTCCCACCATCCACTTGG - Intronic
1063565852 10:7171903-7171925 GTGCCCGCCGACCAAGCCCGAGG - Exonic
1064278465 10:13929396-13929418 CTGCCCGCCTACTACGCCCTGGG + Intronic
1066746592 10:38607705-38607727 CTGCCTACGCACCATCCCCTCGG - Intergenic
1069255088 10:66322846-66322868 CTGCTCCCTCACAATGCCCTGGG - Intronic
1069677610 10:70259938-70259960 CTGCCTGCCCACCTTTCCCTGGG + Intronic
1071919754 10:90336262-90336284 CTGCCCTCTCCTCATGCCCTAGG + Intergenic
1073486786 10:103824180-103824202 ATGCCTGCCCACCCTCCCCTTGG - Intronic
1074219368 10:111421104-111421126 CTGCCACCACACCATGACCTTGG + Intergenic
1075209575 10:120479609-120479631 CTGCCTTCCCACCATTCCCCAGG + Intronic
1075417026 10:122271697-122271719 CTGCCCGCCCACAGGGACCTTGG + Intronic
1075678875 10:124318292-124318314 CTGCCCGCCTCCCATTCTCTGGG + Intergenic
1076440698 10:130479417-130479439 CTGCCTTCCCCCAATGCCCTGGG - Intergenic
1077289071 11:1780533-1780555 CTGCCCGTCGGCCATGCGCTGGG - Intergenic
1077504058 11:2922106-2922128 CTGCCCGATGACCAGGCCCTGGG - Exonic
1077529724 11:3089550-3089572 GTGCCAGCCCAGCATGGCCTGGG - Intronic
1077541336 11:3147902-3147924 CTGAACGCCCACCATGGCCCTGG + Intronic
1077998842 11:7476602-7476624 CTGCCTGCCCCACATGCACTTGG - Intergenic
1081869021 11:46374937-46374959 CTGTGCGGGCACCATGCCCTGGG + Exonic
1081973345 11:47214986-47215008 CTTCCCGCCAAACATGCCCAGGG - Exonic
1082027913 11:47586261-47586283 CAGCCAGCCCACCATGCAGTTGG + Intergenic
1083264877 11:61542097-61542119 CTCCCGGCCCTCCATCCCCTTGG - Intronic
1084208392 11:67609309-67609331 CTGCCCTCCCAACATGTCCCAGG - Intronic
1084597007 11:70123057-70123079 CTGCCTTCTCTCCATGCCCTGGG + Intronic
1084942274 11:72619172-72619194 ATGCCCTCCCACCAGACCCTCGG + Intronic
1084956849 11:72696148-72696170 CTGCCCCCCGACCCTGTCCTTGG - Intronic
1087441153 11:98185326-98185348 CTGGCAGCCCGCCATGCCCAAGG - Intergenic
1088257269 11:107912944-107912966 CTGCCCGGCCACCACCCCGTCGG + Intronic
1089125621 11:116174598-116174620 CCCCCTGCCCACCATCCCCTGGG + Intergenic
1090186036 11:124739854-124739876 CTCCCCGCCCACCCTGCCGGAGG + Exonic
1090227996 11:125083068-125083090 CTGCCCTCCCTCCCAGCCCTGGG + Intronic
1091086022 11:132722725-132722747 CTGCCAGCCCTCCATGAACTGGG + Intronic
1091385883 12:94382-94404 CTGGCCACCCACCCTGCCCAAGG - Intronic
1091816855 12:3445248-3445270 CTCCCCGGCCACCTTTCCCTGGG - Intronic
1093478004 12:19575882-19575904 CTGCTTTCCCACCAAGCCCTGGG - Intronic
1095951403 12:47783804-47783826 CTGCCCGCCCACCATGCCCTTGG - Exonic
1097280858 12:57845090-57845112 CTGGCCGCCCACCAGGCTCTAGG + Intronic
1099388040 12:82042347-82042369 CTTCCTCCCCACCAAGCCCTCGG + Intergenic
1101353651 12:103956729-103956751 CAGCCTGCCGACCATGCCCGCGG - Exonic
1101433475 12:104645646-104645668 CTTCCCCCCCACCCTCCCCTTGG + Intronic
1101605949 12:106247842-106247864 CGCCGCGCCCGCCATGCCCTCGG - Exonic
1102105043 12:110314035-110314057 GTACCCGGCCACCAAGCCCTTGG - Intronic
1102579794 12:113879104-113879126 CTGGCCACCCATCCTGCCCTGGG + Intronic
1103614198 12:122141928-122141950 CTGCCGGCCCACCGTGGCATCGG + Exonic
1104672489 12:130690231-130690253 CTCAGGGCCCACCATGCCCTGGG + Intronic
1104924429 12:132306462-132306484 CTGCCCGCCCACCTGGACCTCGG - Intronic
1105303689 13:19155236-19155258 CCTGCCCCCCACCATGCCCTGGG + Intergenic
1107058431 13:36131001-36131023 CTGAGCGCCCGCCCTGCCCTCGG + Intronic
1107721442 13:43252779-43252801 CTGACCTGCCACCATGCCCAGGG - Intronic
1107988541 13:45796976-45796998 CTGCCAGCCTCCCAAGCCCTGGG - Intronic
1113422442 13:110181187-110181209 CTGCTGGCCCAACATGTCCTGGG + Intronic
1117722215 14:58638585-58638607 CTGCCCGACCTCCAGCCCCTGGG - Intronic
1119544727 14:75463428-75463450 CTGCCTGCCCTCTGTGCCCTAGG - Intronic
1119711600 14:76826529-76826551 CTTCCCTCCCAGCAAGCCCTGGG - Exonic
1121089943 14:91174232-91174254 CTTCCCCCACACCTTGCCCTGGG + Intronic
1121425068 14:93844781-93844803 CTGCCTACCCACACTGCCCTGGG - Intergenic
1122018458 14:98817086-98817108 CTGTCCTCCCACAGTGCCCTTGG + Intergenic
1122316542 14:100828686-100828708 CTGCCCCCCTCCCATGCCATAGG + Intergenic
1122548684 14:102538735-102538757 CTCCCTTCCCACCATGCCCCGGG + Intergenic
1122835403 14:104428377-104428399 CTGCACCCCCACCCTGGCCTGGG + Intergenic
1122889466 14:104725695-104725717 CTGCCCCGCCACCTTGTCCTGGG + Intronic
1123105369 14:105838969-105838991 CTGCCCTGCCACCATGCTCCAGG - Intergenic
1123939364 15:25209384-25209406 TTGGGCGCCCACCATGCCCAAGG + Intergenic
1124150990 15:27178013-27178035 CTTCCCACCCACCATCCCCCAGG - Intronic
1124357674 15:29008813-29008835 CTGCCTTCCCACCATTCTCTGGG + Intronic
1125375504 15:39024557-39024579 CTGCTCGCCCACCAGGCCGAGGG - Intergenic
1126102901 15:45130158-45130180 CTCCCCCGCCACCCTGCCCTTGG - Intronic
1126137021 15:45402526-45402548 CCGGCCGCCCTCCACGCCCTGGG + Exonic
1126688416 15:51267817-51267839 CTGCCGGCTCCCCATGCCCCGGG + Intronic
1126865604 15:52933632-52933654 CTGAGCGCCCACAATGCACTAGG - Intergenic
1127772486 15:62242999-62243021 CTGCCAGCCCACCCTGCCCAAGG + Intergenic
1127931804 15:63601644-63601666 CTGCCCGCCCACCTTTCCTGGGG + Exonic
1128890978 15:71331580-71331602 CTCCCGGCCCACCATGCTCTGGG - Intronic
1130299343 15:82667968-82667990 CTGCCGGCCCCTGATGCCCTTGG - Intronic
1131148998 15:90035204-90035226 CAGCCCCCACACCATGCCCCAGG - Intronic
1131159969 15:90099299-90099321 CTGCTCTTCCATCATGCCCTTGG + Intronic
1131343122 15:91621464-91621486 CTGCCTGCCCACCAGGCTCAGGG - Intergenic
1131441666 15:92464286-92464308 CAGCCCGCATACCATGCCCTTGG + Exonic
1131755076 15:95550735-95550757 CTGCCCCCTCCCCATTCCCTTGG + Intergenic
1132184691 15:99792736-99792758 CTGCCTGCCCACCCTGCCTGAGG - Intergenic
1132396246 15:101476953-101476975 TTCCCCGCCCCACATGCCCTGGG - Intronic
1132432292 15:101771918-101771940 CTGCCTGCCCACCCTGCCTGAGG + Intergenic
1132682032 16:1146373-1146395 CTCCCTGCCCCCCATGCCCTCGG + Intergenic
1132872648 16:2122634-2122656 CTGCCCAAGCACCATGCCCGAGG + Intronic
1132895747 16:2228616-2228638 CTGCCCGCCCACGTGGCCCCCGG - Intronic
1133020052 16:2963346-2963368 CTGGCCTCCCCCCAAGCCCTGGG + Intergenic
1134551745 16:15141834-15141856 CTGCCCAAGCACCATGCCCGAGG + Intergenic
1136240289 16:28939076-28939098 CCCCCTGCCCACCAGGCCCTAGG - Intronic
1136736471 16:32471930-32471952 CTGCCTACGCACCATCCCCTCGG + Intergenic
1137055783 16:35746191-35746213 CTGCACCCCCACCATGGCCTGGG + Intergenic
1138414335 16:56862738-56862760 TTGACCACCCACCATGCCATAGG - Intergenic
1141148300 16:81547287-81547309 CTGCACACACCCCATGCCCTCGG - Intronic
1141431663 16:83973349-83973371 CTGCCCTCCCACCATGCCCAAGG - Intronic
1141605597 16:85151780-85151802 CTGCCAGCTCTGCATGCCCTCGG + Intergenic
1141611489 16:85183568-85183590 CTGGCCGTCCTCCATGCCCTGGG + Intronic
1141907794 16:87039085-87039107 CTAACCAACCACCATGCCCTGGG + Intergenic
1142286423 16:89173281-89173303 CCTCCCCACCACCATGCCCTGGG - Intronic
1142325796 16:89413800-89413822 CTGCACTCCCACAACGCCCTAGG + Intronic
1203016599 16_KI270728v1_random:357648-357670 CTGCCTACGCACCATCCCCTCGG - Intergenic
1203034934 16_KI270728v1_random:630806-630828 CTGCCTACGCACCATCCCCTCGG - Intergenic
1143845322 17:9769312-9769334 CTTCCTGCCCCCCATCCCCTTGG + Intergenic
1146654879 17:34629194-34629216 CTGCCTGCTCACCATGGCCAGGG - Exonic
1147951614 17:44110914-44110936 CTGCCCGACCACCTTCCCTTCGG - Intronic
1147979946 17:44268197-44268219 CTGCCCGCCCCACTGGCCCTGGG + Intergenic
1148469014 17:47882067-47882089 CTCCCCACCCACCGTGTCCTGGG + Intergenic
1148818309 17:50346281-50346303 CTGCCCGCCCGCCCGGCCGTCGG - Intronic
1149430880 17:56594783-56594805 CGGCTTGCACACCATGCCCTCGG - Exonic
1149563360 17:57625219-57625241 CTGGCCCCCAACCATGCCCTTGG - Intronic
1150652928 17:67021654-67021676 CTTCCTGCCCACCTTGCCCTGGG + Intronic
1152586878 17:81193168-81193190 CCTCCCGCCCTCCATGCCCGTGG - Intronic
1153046105 18:856988-857010 CTGGCAGCCCACCAGGCACTGGG + Intergenic
1153880721 18:9419561-9419583 TTGCCCGTCCAGCAGGCCCTTGG + Intergenic
1153999765 18:10473387-10473409 CTGCCGGCTCAGGATGCCCTTGG + Intronic
1155042370 18:22075307-22075329 GTGCCCCCGCACCATGCTCTAGG - Intergenic
1157616666 18:48991384-48991406 CTGCCCTCTCTCCATGCTCTGGG + Intergenic
1157618590 18:49002280-49002302 CTGCCCGGCCCCCAGCCCCTTGG - Intergenic
1157869299 18:51215098-51215120 CTTCCTTCCCACCATGGCCTTGG - Intronic
1158904402 18:61998170-61998192 CTGCAAGCCCACCAGCCCCTGGG + Intergenic
1160418289 18:78727002-78727024 CTGCCCGCCTCCCAGGCCCATGG + Intergenic
1160455162 18:78994475-78994497 CTGCCCGCCCTCCCCGCCCTCGG + Exonic
1160939604 19:1614201-1614223 TTGCCTGCCCACCCTGCCTTAGG + Intronic
1161189404 19:2944786-2944808 CTGCCGCCCCACCTCGCCCTGGG + Intronic
1163385827 19:16999870-16999892 CAGCCTGACCACCATGGCCTGGG - Intronic
1163593158 19:18205365-18205387 CAGCCCGCCCCCAGTGCCCTGGG + Intergenic
1163790085 19:19301432-19301454 CTGCCCACCCTCCACGACCTTGG + Intronic
1163811927 19:19438485-19438507 CTGCCCTCAAACAATGCCCTGGG - Intronic
1165066806 19:33234341-33234363 CTGCACCCCCACCCTGTCCTGGG + Intergenic
1165357682 19:35313743-35313765 CTGCCCCCACACCTGGCCCTGGG + Exonic
1167373913 19:49101301-49101323 CAGCCTGCACACCAGGCCCTGGG - Intronic
1167474429 19:49691740-49691762 CTGCCCCCGCACCATGTTCTTGG + Intronic
1167540795 19:50086162-50086184 CTGCCCGGCCACCACCCCGTCGG + Intergenic
1168269026 19:55239721-55239743 CTGCCTGCCCACCCTGGTCTGGG - Intronic
925868261 2:8247548-8247570 CCCCCAGCCCACCCTGCCCTGGG + Intergenic
926320153 2:11743816-11743838 CTTCCCGCCTACCTTGCCCCAGG + Intronic
929588474 2:43130613-43130635 GTGTCCGGCCACCATGACCTGGG - Intergenic
932396527 2:71452711-71452733 CGGCCAGCCCATCCTGCCCTGGG + Intergenic
932578265 2:72974658-72974680 CTACCAGCCATCCATGCCCTTGG + Intronic
934187632 2:89761051-89761073 CTGCCTACGCACCATCCCCTCGG + Intergenic
934308997 2:91846895-91846917 CTGCCTACCCACCATCCCCTCGG - Intergenic
934562609 2:95320917-95320939 CTGCCCCCCCAGCCTTCCCTAGG + Intronic
934717989 2:96554322-96554344 CTGCCCACCCTCCAGGCCCTGGG + Intergenic
934729999 2:96650371-96650393 CTGCCCTTCTACCATGACCTTGG - Intergenic
938292401 2:130157149-130157171 CACCCTGCCCTCCATGCCCTGGG + Intronic
938464153 2:131515827-131515849 CACCCTGCCCTCCATGCCCTGGG - Intergenic
940092042 2:149931574-149931596 CTGGCCTCCCACTGTGCCCTGGG + Intergenic
946054569 2:216889511-216889533 GTGCCCTCCCACGATCCCCTTGG + Intergenic
946398141 2:219453723-219453745 ATGCCTGCCCCCCAGGCCCTGGG - Intronic
946467638 2:219926254-219926276 CTGCCTGCCTAGCATGGCCTAGG - Intergenic
948461982 2:238134235-238134257 CTGCCCACTCGCTATGCCCTTGG + Intergenic
948738263 2:240025215-240025237 CCGCCCGCTCACCACGCGCTGGG + Exonic
949069255 2:242013539-242013561 CTCCCCTCCTTCCATGCCCTGGG + Intergenic
1169066446 20:2696780-2696802 GTGCCCTCCCACCCTGCCCACGG + Intronic
1169394410 20:5216884-5216906 GTGCCCTGCCCCCATGCCCTTGG - Intergenic
1170582661 20:17710872-17710894 CTGCCCACACACCCAGCCCTGGG - Intronic
1171291556 20:23985604-23985626 CCTCCAGCCCACGATGCCCTGGG + Intronic
1172181111 20:33004190-33004212 CTGCCCCTCCACCCTGTCCTTGG - Intronic
1172874939 20:38158447-38158469 CAGCCCGGCCACCATGGTCTGGG - Intronic
1173539821 20:43842946-43842968 CTGCCCTGCCACCTGGCCCTTGG + Intergenic
1174393870 20:50234126-50234148 CTGCCCACCCCCACTGCCCTGGG - Intergenic
1174545386 20:51321414-51321436 CTGTCTGCCCACCATGGCCTGGG - Intergenic
1175161571 20:57011766-57011788 CTGCCTGCCCACCAAGCCTCAGG + Intergenic
1175777817 20:61664037-61664059 CAGCCCCCACACAATGCCCTTGG - Intronic
1175954733 20:62603518-62603540 CCACCTGCCCACCATGGCCTGGG + Intergenic
1176136062 20:63522486-63522508 CTCCCCGCCCCGCAGGCCCTCGG - Intergenic
1176151911 20:63595822-63595844 TGGCCCGCCCACCCTGACCTGGG + Intronic
1178925713 21:36773340-36773362 CTGCCAGCCCTCCGTGGCCTTGG - Intronic
1179255689 21:39713352-39713374 CAGCCAGCCCACCATGACCTGGG - Intergenic
1179410976 21:41162993-41163015 CTGAGCTCCCACCATGTCCTGGG - Intergenic
1179667010 21:42919903-42919925 CTGCCCGGGTACCTTGCCCTGGG + Intergenic
1179921891 21:44512025-44512047 CTGTCCGTCCTCCATGCCTTTGG - Intronic
1179922534 21:44514905-44514927 ATGCCCACCGACCATTCCCTTGG + Intronic
1180067994 21:45422342-45422364 ATGCCTGCCCACCAAGCCCAGGG - Intronic
1180078145 21:45473553-45473575 CTGCCCGCCCTCCCAGGCCTTGG + Intronic
1180257003 21:46636215-46636237 CTGCCCTCCTAAGATGCCCTCGG - Exonic
1180536077 22:16393990-16394012 CTGCCTACGCACCATCCCCTCGG - Intergenic
1181639958 22:24191123-24191145 CTGCCCGTCCTGCAAGCCCTGGG - Intergenic
1181983346 22:26782033-26782055 CTGCCCTCCTTCCCTGCCCTGGG + Intergenic
1182123882 22:27802546-27802568 CGGGCCGCACACCTTGCCCTGGG + Intergenic
1183393191 22:37557398-37557420 CTGCCTGCCCTCCCTGCCCGCGG + Intergenic
1183453772 22:37910630-37910652 CTCCCCGTCCACCCAGCCCTGGG + Intronic
1183484254 22:38080949-38080971 CAGCGCGCCCACCATGCCGTAGG + Exonic
1184478982 22:44736349-44736371 TGGCCCTCCCACCATCCCCTTGG + Intronic
1184692037 22:46121838-46121860 CTCCCTGCCCACCCTGCCCTAGG + Intergenic
1184787691 22:46679876-46679898 CTGCCAGCCCGCCACTCCCTGGG + Intergenic
1184829460 22:46974998-46975020 CTGCCCCTACACCATGCCATAGG - Intronic
1184941073 22:47765654-47765676 CTGCCCGCACTCCATCCCCCTGG - Intergenic
1184969465 22:48004898-48004920 CTTCACTCCCACCAGGCCCTTGG - Intergenic
1185310740 22:50152881-50152903 CTGCCCCCAGACCAAGCCCTTGG - Intronic
950106705 3:10393180-10393202 CTTCCGGCCCGCCATGTCCTTGG - Intronic
950643012 3:14360510-14360532 GTGCCCACCCCCCAGGCCCTGGG + Intergenic
950782029 3:15400274-15400296 CTGCACCCCCACCAAGCCCCAGG + Intronic
952768552 3:36976589-36976611 CGGCCCGCCCGCCATGCTCTTGG - Intergenic
954411532 3:50373371-50373393 CTGCCTGCCCACCACGCCCGAGG - Intronic
954583511 3:51716274-51716296 CAGCCCTCCCACCTTCCCCTTGG - Intronic
954624572 3:52015588-52015610 CTGGGCCCCCAGCATGCCCTGGG + Intergenic
954925636 3:54231867-54231889 CTCCCCTCCCACCCTGCCCCAGG - Intronic
957683282 3:83467728-83467750 CTGCTTGCCTTCCATGCCCTTGG + Intergenic
961394622 3:126578396-126578418 CTCCCCTCCCACCCTGCCCAGGG - Intronic
961622380 3:128234657-128234679 CTACCCTCCCACCCTGCCTTAGG + Intronic
961662866 3:128479665-128479687 CTGCCCGCCCATATTGCACTTGG + Exonic
966362942 3:179148953-179148975 CTGCACGCCCACCCAGCCCGCGG + Intronic
968579126 4:1381563-1381585 CTGCCCGCCCTGCCTCCCCTCGG + Intronic
969314212 4:6371881-6371903 CTGCCCGCCCACCAGCCCCCCGG + Intronic
969398460 4:6938302-6938324 ATGCTCGGCCACCCTGCCCTTGG + Intronic
969843569 4:9901670-9901692 ATGCCCCCCCACCAGCCCCTTGG + Intronic
977913782 4:102567117-102567139 TTACCCGACCACCATGTCCTTGG - Exonic
981057034 4:140373783-140373805 CGCCCCGCCCTCCAGGCCCTCGG - Intronic
984999739 4:185471434-185471456 CCGCCCGCCCAGCGCGCCCTCGG - Intronic
985644145 5:1077206-1077228 CTTCCTGGACACCATGCCCTAGG + Intronic
990173616 5:53082838-53082860 CTGCCCGCCCCACTAGCCCTTGG + Intronic
995014477 5:107294496-107294518 CTCCCCACCCACCAGGCACTGGG + Intergenic
998133968 5:139665127-139665149 CTGCCCGCCCAGCAGGCAGTTGG - Intronic
1001668394 5:173453045-173453067 CTGCTTTCTCACCATGCCCTGGG + Intergenic
1001929756 5:175664543-175664565 CTGCCTGCCCCCACTGCCCTGGG - Intronic
1003052556 6:2793075-2793097 CTGCCCGGCCACCTTGCCAGTGG + Intergenic
1003850107 6:10213487-10213509 CTGCCCTCCCACCCTTCCCCCGG + Intergenic
1004275459 6:14231737-14231759 CTGCCTGCCAAGGATGCCCTTGG - Intergenic
1005075609 6:21903535-21903557 CTTCTCTCCCTCCATGCCCTGGG - Intergenic
1005995063 6:30925875-30925897 CTGCGGGTCCACCAGGCCCTGGG - Exonic
1008137643 6:47795290-47795312 CTTCTGGACCACCATGCCCTTGG + Exonic
1012399479 6:98832503-98832525 CTGCCCGCCACCCAGCCCCTTGG + Intergenic
1018618127 6:165707254-165707276 CTGCCCGCCACCCATCCCCTGGG - Intronic
1019453091 7:1109754-1109776 CTTCCCGCCCGCCGGGCCCTGGG + Intronic
1021274731 7:18636285-18636307 CTGCCAGCCCCCCCTGCCCTGGG + Intronic
1023938597 7:44756316-44756338 CTGCCCACCCCTCAGGCCCTGGG + Intronic
1024354041 7:48396192-48396214 ATCCCCTCCCACCATGGCCTTGG + Intronic
1024981856 7:55163897-55163919 CTGCCCACACAGGATGCCCTGGG - Intronic
1027051848 7:75025631-75025653 CTGCCTGCCCACCCGCCCCTTGG + Intergenic
1027263161 7:76479280-76479302 CTGACCGGCCACCAGGCCCAGGG - Intronic
1027314545 7:76977385-76977407 CTGACCGGCCACCAGGCCCAGGG - Intergenic
1027375717 7:77547215-77547237 CTGAGTGCCCACTATGCCCTAGG + Intronic
1027559127 7:79705114-79705136 CTGTCTGCCTACCATGCCCCAGG + Intergenic
1029402412 7:100354194-100354216 CTGCAATCCCACCATGTCCTAGG + Intronic
1029518991 7:101048134-101048156 CTTCCCCCACCCCATGCCCTGGG + Intronic
1029732362 7:102446832-102446854 CTGGCCCCCCACCTGGCCCTGGG + Exonic
1030063310 7:105640273-105640295 CTCCCCGCCCCCACTGCCCTGGG + Intronic
1030260994 7:107563969-107563991 CCGCCCGCCCACCCAGCCCATGG + Exonic
1032269030 7:130387168-130387190 CTGCTTGCCCACCAAGGCCTAGG - Intronic
1032400318 7:131619954-131619976 GTACCCTCCCACCAGGCCCTGGG - Intergenic
1034198042 7:149262685-149262707 CTGCCCGCCCAGCCTGCTGTAGG - Intronic
1034406280 7:150904547-150904569 CTGCCTGTCCCTCATGCCCTTGG - Intergenic
1034466112 7:151230161-151230183 CCCCCTGCCCACCCTGCCCTGGG + Intergenic
1034817375 7:154184091-154184113 CTGCCCGTCTGCCATGCCCAGGG - Intronic
1035129625 7:156640323-156640345 CCGCCCGCCCACCTGGGCCTGGG - Exonic
1035400848 7:158564612-158564634 CTGCCCACCCTTCATGCCCCAGG + Intronic
1038006240 8:23432936-23432958 CTTCCCGCCCAGAATGCCCCGGG - Exonic
1039493420 8:37964526-37964548 CCACCCGCCCCCCAAGCCCTCGG - Intronic
1041464637 8:58146218-58146240 AAGACCGCCCACCATGCCCACGG + Exonic
1047892783 8:129331107-129331129 CTCCCCGCCCCCCATGTTCTTGG - Intergenic
1049090703 8:140511636-140511658 CTGCCCCCTCACCGTGGCCTTGG - Exonic
1049185699 8:141251489-141251511 CTGTCCACCCTCCGTGCCCTAGG + Intronic
1049218885 8:141419969-141419991 CTGCCTGCCCTCCACACCCTGGG - Intronic
1049668236 8:143858365-143858387 CTCGCCGCCCACCACGCCCGCGG + Exonic
1049668652 8:143859964-143859986 CTCGCCGCCCACCACGCCCGCGG + Exonic
1049669067 8:143861566-143861588 CTCGCCGCCCACCACGCCCGCGG + Exonic
1049669482 8:143863168-143863190 CTCGCCGCCCACCACGCCCGCGG + Exonic
1049669892 8:143864761-143864783 CTCGCCGCCCACCACGCCCGCGG + Exonic
1049670309 8:143866369-143866391 CTCGCCGCCCACCACGCCCGCGG + Exonic
1053297703 9:36926743-36926765 ATGCACGCCCACCATTCACTAGG - Intronic
1056623743 9:88236977-88236999 CTGCCAGCCCACTAGGCCCTCGG + Intergenic
1057228712 9:93305965-93305987 CTTCCGGCCCAGCCTGCCCTGGG + Intronic
1060996623 9:127877742-127877764 CTTCCCGCCCTCCCTGCCTTCGG - Exonic
1061428639 9:130517267-130517289 CTGACCGGCCTCCATGTCCTCGG + Intergenic
1061709877 9:132480251-132480273 CTGCCCACCCACCCTGCTCTGGG + Intronic
1061836598 9:133333706-133333728 CTGCCCGCCTACCTGGCCCCGGG + Exonic
1061874572 9:133537327-133537349 CTGCCCCCACCCCATGCCCGAGG - Intronic
1061962372 9:133994537-133994559 CCGCCCGCCAACAATGCCATGGG + Intergenic
1062107601 9:134764261-134764283 TTGACCCCCCACAATGCCCTCGG - Intronic
1062501455 9:136853706-136853728 CTGCCCACCCGCCCTCCCCTTGG - Intronic
1187049407 X:15680762-15680784 CTGCCCGCCCACCAGCCACATGG - Intergenic
1189373071 X:40445408-40445430 CAGCCTCCCCACCATGCCCTAGG + Intergenic
1189848703 X:45158376-45158398 TTGCACCCCCACCCTGCCCTTGG + Intronic
1191846736 X:65552346-65552368 CTGCCCCTCCACCAAGCCCACGG + Intergenic
1192533897 X:71911695-71911717 CTACCCGCCCACCTAGCCCCAGG + Intergenic
1196055251 X:111348558-111348580 CTGCCCTTCCACAAGGCCCTGGG + Intronic
1199296760 X:146167918-146167940 GTTGCCTCCCACCATGCCCTTGG - Intergenic
1199313552 X:146349743-146349765 CTGAGTGCCCACCATGCCCTAGG + Intergenic
1199894044 X:152115454-152115476 CTGCACACCCACCAGGCCCAGGG + Intergenic
1199950290 X:152700897-152700919 CTGCGCACCCACCAGGCCCAGGG - Exonic
1199952571 X:152717171-152717193 CTGCGCACCCACCAGGCCCAGGG - Exonic
1199955169 X:152736226-152736248 CTGCGCACCCACCAAGCCCAGGG - Exonic
1199957112 X:152751277-152751299 CTGCGCACCCACCAGGCCCAGGG + Exonic
1199959388 X:152767564-152767586 CTGCGCACCCACCAGGCCCAGGG + Exonic
1200112242 X:153746850-153746872 CTGCCTACACACCATCCCCTCGG - Intergenic