ID: 1095951714

View in Genome Browser
Species Human (GRCh38)
Location 12:47785223-47785245
Sequence GGGTGCTCACCATTGCTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095951703_1095951714 23 Left 1095951703 12:47785177-47785199 CCTGCTGGCTCCATCGGGGGGGC 0: 1
1: 0
2: 0
3: 10
4: 116
Right 1095951714 12:47785223-47785245 GGGTGCTCACCATTGCTGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 162
1095951701_1095951714 24 Left 1095951701 12:47785176-47785198 CCCTGCTGGCTCCATCGGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 124
Right 1095951714 12:47785223-47785245 GGGTGCTCACCATTGCTGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 162
1095951705_1095951714 13 Left 1095951705 12:47785187-47785209 CCATCGGGGGGGCTCAGAGGATA 0: 1
1: 0
2: 1
3: 1
4: 76
Right 1095951714 12:47785223-47785245 GGGTGCTCACCATTGCTGCCTGG 0: 1
1: 0
2: 0
3: 10
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095951714 Original CRISPR GGGTGCTCACCATTGCTGCC TGG Intronic
900029280 1:359210-359232 TGGTGTCCACCACTGCTGCCTGG - Intergenic
900049882 1:587982-588004 TGGTGTCCACCACTGCTGCCTGG - Intergenic
900341309 1:2190616-2190638 GCGTGCTCAGCAGAGCTGCCGGG + Intronic
900394104 1:2446134-2446156 GGGTGCTGCCCCTGGCTGCCAGG + Intronic
903602892 1:24555470-24555492 TTGTGCTCACCTTTGCTTCCTGG + Intergenic
904005817 1:27362678-27362700 CTGTGCTCCTCATTGCTGCCGGG - Exonic
905617921 1:39413877-39413899 GGGTGGCCACCATAGCTGCAGGG - Exonic
906142841 1:43543980-43544002 GGGAGCTCACCAGTGGGGCCAGG + Intronic
907704493 1:56820633-56820655 GGCTGATCACCAGAGCTGCCTGG + Intergenic
908558740 1:65284112-65284134 AAGTGCTCTCCACTGCTGCCAGG + Intronic
909946352 1:81668374-81668396 GGGATCGCACCATTGCAGCCTGG + Intronic
911329833 1:96514157-96514179 GGGTTCTCACCATTGTTTCTGGG - Intergenic
920689219 1:208132955-208132977 GGCTGCTCCCCATGGCTGTCAGG + Intronic
921932363 1:220765137-220765159 GGGTGAACAGCATTGCTTCCGGG - Intronic
922975683 1:229781627-229781649 GGGGCCTCAGCCTTGCTGCCAGG + Intergenic
923383040 1:233440630-233440652 AGGTGCACACCACTACTGCCCGG - Intergenic
924420705 1:243906893-243906915 GAGTGCTCACCATTGTTCCAGGG + Intergenic
1063891415 10:10632798-10632820 TGGTGATCACCATTGCCTCCAGG - Intergenic
1064581027 10:16792890-16792912 AGTTGGTCAGCATTGCTGCCCGG - Intronic
1068991883 10:63158954-63158976 AGGTGCCCACCACTACTGCCTGG - Intergenic
1070144384 10:73763203-73763225 GGGTGTTCACCATTGATGGGGGG + Intronic
1071725604 10:88195448-88195470 GTGTGCCCAGCATTGTTGCCAGG - Intergenic
1072892516 10:99336822-99336844 AGGTGTGCACCATTACTGCCCGG - Intronic
1074471637 10:113732378-113732400 AGGTGCCCACCACTGGTGCCTGG - Intergenic
1075468485 10:122670398-122670420 GGCTGCTCCCCCTTGCTACCAGG - Intergenic
1076919518 10:133444517-133444539 GGGGGCTCATCTTTGCAGCCAGG - Intergenic
1077035212 11:491171-491193 GGTGGCTCAGCATCGCTGCCTGG - Exonic
1079425019 11:20332106-20332128 GGAAGATCATCATTGCTGCCTGG + Intergenic
1081127539 11:39340283-39340305 GGCTGCCCACCATTTCTGCAGGG + Intergenic
1081530156 11:43952944-43952966 AGGTCCTCATCGTTGCTGCCAGG + Intergenic
1084871061 11:72098771-72098793 AGGTGCTCACCTGTACTGCCTGG + Exonic
1087176526 11:95101052-95101074 TGGTGCTCACCATTGAGTCCTGG + Intronic
1088322499 11:108568331-108568353 GGCTGCTCACCATGGCTGGCCGG + Intronic
1090366189 11:126208090-126208112 GGGTACTCACCACTGCTGGTGGG + Intronic
1091753191 12:3035298-3035320 GGGTCACCACCATTGATGCCTGG + Intronic
1092223192 12:6729437-6729459 CGGTTCTCACCATTCCTGCAGGG - Exonic
1095048453 12:37535175-37535197 CGCTGCTCACCACTGGTGCCTGG - Intergenic
1095396551 12:41768662-41768684 GGCTGCCCAGCATTGTTGCCAGG - Intergenic
1095951714 12:47785223-47785245 GGGTGCTCACCATTGCTGCCTGG + Intronic
1102156073 12:110729098-110729120 TTGTGCTCATCATTGCTGCCAGG - Intronic
1104662447 12:130620896-130620918 AGGTGCTCACCACTGCTGGGTGG - Intronic
1106479605 13:30127194-30127216 GGCTACTCAGCTTTGCTGCCTGG - Intergenic
1111490051 13:88960521-88960543 GGGTTTTCACCATTTCAGCCAGG - Intergenic
1113973837 13:114211543-114211565 GGGTGCTCGCCCTCCCTGCCTGG + Intergenic
1114264760 14:21067064-21067086 GGCTGCTCACTATTTCTCCCTGG - Intronic
1114457619 14:22866752-22866774 GGGTACTCCCCATGGCTGTCTGG + Intergenic
1115635814 14:35289473-35289495 AGGTGCACACCATTACTGCATGG + Intronic
1116643262 14:47493456-47493478 AGGTGCGCACCACTACTGCCTGG + Intronic
1116775372 14:49174190-49174212 GGGTGCACACCATTACTCCAGGG - Intergenic
1121654912 14:95588243-95588265 GGGTGTTCAGCACTGCAGCCAGG - Intergenic
1121655083 14:95589000-95589022 GGGTGCTCAGCACTACAGCCAGG - Intergenic
1122979340 14:105184646-105184668 GGGAGGTCACCGTGGCTGCCTGG + Intergenic
1124602774 15:31148888-31148910 TGGTGCCCACCCTGGCTGCCTGG - Intronic
1126153707 15:45545952-45545974 AGGTGCACACCACTACTGCCTGG - Intergenic
1128727354 15:69998123-69998145 GGCTGCTCCTCATTGCTGCCAGG + Intergenic
1131604354 15:93885392-93885414 CTGTGCTCACCACCGCTGCCAGG + Intergenic
1132403479 15:101528106-101528128 GGGTGCTCAGCCAAGCTGCCTGG - Intergenic
1134370161 16:13615932-13615954 GGAAGCTCACCATTCCGGCCGGG - Intergenic
1137386817 16:48049621-48049643 GAGTGCTCACCAGAGCAGCCCGG + Intergenic
1137440983 16:48498323-48498345 GGCTGGTCACCTTGGCTGCCCGG - Intergenic
1139515670 16:67451132-67451154 GGGGGGTCATCCTTGCTGCCAGG - Intronic
1139692701 16:68651176-68651198 GGGTGCTAACCAGAGCAGCCAGG - Intronic
1141236144 16:82219053-82219075 GGGTACTCTCCATTGCTGCATGG - Intergenic
1141338651 16:83181707-83181729 GGGTGTTCACCCTTGGTCCCTGG + Intronic
1141640154 16:85336107-85336129 GGGTCCTCACCAAGGCTTCCAGG - Intergenic
1203052805 16_KI270728v1_random:892223-892245 AGGTGCACACCACTACTGCCCGG + Intergenic
1143405498 17:6674827-6674849 CGGTGCTCACCTCTGCTTCCAGG - Intergenic
1143537551 17:7550183-7550205 GGATGCTCACCACTTCTGCGAGG - Exonic
1143568097 17:7737426-7737448 GGTTGCTCAGCATTGGAGCCTGG + Intronic
1146941775 17:36848347-36848369 GGGCACTCACCATTGCCCCCTGG + Intergenic
1152605515 17:81287687-81287709 GGGTGCTCTTCTGTGCTGCCTGG - Intronic
1152830140 17:82492083-82492105 GGGTGCTCACGACTGCTGGCTGG + Intergenic
1152950478 17:83227346-83227368 TGGTGTCCACCACTGCTGCCTGG + Intergenic
1153907595 18:9676727-9676749 AGGTGCGCACCACTACTGCCTGG + Intergenic
1156886045 18:42137707-42137729 GGCTGCTAACAATTGCTGCGTGG + Intergenic
1158543739 18:58378685-58378707 GGGTGCTCACAAATCCTGCAGGG - Intronic
1158607941 18:58912503-58912525 GGGTGCCCAGCAGTGCTGACAGG + Intronic
1163547305 19:17948016-17948038 GGGTGCTCGCCATTTGCGCCGGG + Intergenic
1164402005 19:27909376-27909398 GGGCGCTCACAACTGGTGCCAGG + Intergenic
1165224222 19:34342767-34342789 GGCTGCTGACCTTGGCTGCCGGG - Intronic
1166115620 19:40652201-40652223 AGGTGCACACCACTACTGCCTGG + Intergenic
1167793099 19:51692682-51692704 GGGGGCTCACCATCGCGGCTGGG + Intergenic
930504642 2:52267576-52267598 AGGTGCGCACCACTACTGCCCGG - Intergenic
936156511 2:110050606-110050628 AGGTGTTCATCATTGCTTCCTGG - Intergenic
936188179 2:110320838-110320860 AGGTGTTCATCATTGCTTCCTGG + Intergenic
937070014 2:119056254-119056276 GCCTCCTCACCATTACTGCCAGG - Intergenic
937110908 2:119366749-119366771 GGGTGCTTAGTTTTGCTGCCGGG - Intronic
937264021 2:120604891-120604913 GAGTGAGCACCATCGCTGCCAGG + Intergenic
940192974 2:151062033-151062055 GGGAGCTCACCACTCTTGCCTGG - Intergenic
941190678 2:162377986-162378008 GGGTGCCAATCATTGCTGCTAGG - Intronic
946401090 2:219468780-219468802 GGGTGCACCCCATCGCCGCCTGG - Intronic
948157260 2:235793286-235793308 AGGTGCTCGCCAAGGCTGCCCGG - Intronic
948657629 2:239486527-239486549 CGGTTCTCGCCATGGCTGCCAGG + Intergenic
1170030381 20:11938060-11938082 GGGTGCACACAATGGCTGCATGG + Intergenic
1170597315 20:17815886-17815908 GGGCGGTCACCTTTGCTGTCAGG + Intergenic
1171846022 20:30275300-30275322 CGCTGCTCACCACTGGTGCCTGG - Intergenic
1172181403 20:33006035-33006057 CGGTGCTTGCCATTGCTGTCAGG + Intergenic
1172734378 20:37115193-37115215 GGGTCCTCATCATGGCAGCCAGG + Exonic
1174704267 20:52639753-52639775 TGGATCTCACCATTGCTTCCGGG - Intergenic
1174956455 20:55103933-55103955 GGGAGCTCCTCATTGCTGCTAGG + Intergenic
1175846123 20:62059678-62059700 GGGTGTTCACCTGTGGTGCCCGG - Intronic
1176058760 20:63162591-63162613 GGGCGCTCACCCTTCCTGGCAGG - Intergenic
1176371347 21:6063546-6063568 GGGTTCTCACCATGTCGGCCAGG - Intergenic
1179752172 21:43474993-43475015 GGGTTCTCACCATGTCGGCCAGG + Intergenic
1180680925 22:17626578-17626600 GAGATCACACCATTGCTGCCTGG - Intronic
1181805856 22:25374121-25374143 GGCTGCAGCCCATTGCTGCCAGG + Intronic
949122471 3:403245-403267 GGGTGCTCTCTCTTGCTCCCTGG - Intronic
952808625 3:37381422-37381444 GGGGGCACACCATTACTGCCAGG + Intergenic
953271268 3:41447659-41447681 TCGTGCTCACCAATGCTGCCGGG + Intronic
953570034 3:44063984-44064006 GGGTCCTTACCACTGCTGCTGGG - Intergenic
953741323 3:45541668-45541690 GGGTGCTCACCACTTTGGCCTGG - Intronic
954134208 3:48574693-48574715 CCTTGGTCACCATTGCTGCCCGG + Exonic
966255103 3:177908525-177908547 GGATGCTCAAACTTGCTGCCAGG - Intergenic
968713694 4:2139055-2139077 GGGTGCTCATCCTTGCTCCTCGG - Intronic
975286862 4:72631449-72631471 GGGTTATCACCATTGCTTCTGGG - Intergenic
976274055 4:83258206-83258228 GTGTCCTCACCATAGCAGCCAGG - Intergenic
978623064 4:110653897-110653919 GGTTCCTCACCATTTCTCCCTGG + Intergenic
980875320 4:138656395-138656417 GGGTGATCACCTTTGGTACCAGG + Intergenic
985733666 5:1565278-1565300 AGGCGCTCTCCATTCCTGCCAGG + Intergenic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
997373151 5:133375158-133375180 GGGTGCTCAAGAGTGCTGCAGGG - Intronic
1001450047 5:171817613-171817635 TGCTGCACACCATTGATGCCTGG + Intergenic
1002744710 5:181461161-181461183 TGGTGTCCACCACTGCTGCCTGG + Intergenic
1003911062 6:10744271-10744293 GAGTGCTCACCATGTGTGCCAGG + Intergenic
1007108851 6:39301441-39301463 GGGAGCTGACCTGTGCTGCCTGG + Intronic
1007177458 6:39906623-39906645 GGCTGGTCACCTTGGCTGCCTGG + Exonic
1010723287 6:79308092-79308114 GGATGCTCACCATCTCTGCAGGG + Intergenic
1010803042 6:80199927-80199949 AGGTGCACACCACTACTGCCAGG - Intronic
1019249621 6:170734702-170734724 TGGTGTCCACCACTGCTGCCTGG + Intergenic
1019527853 7:1488788-1488810 GTGTGGGCACCAATGCTGCCAGG + Intronic
1019625567 7:2014118-2014140 GGGTGCTCAGAGTTGTTGCCAGG - Intronic
1019686236 7:2383770-2383792 GGGCGCTCACCATTAGTGGCTGG - Intergenic
1020002444 7:4763560-4763582 GCCTGCTCACCACTGCTGCTGGG - Exonic
1020936254 7:14467965-14467987 GGGTCCTCACAATTGTTCCCTGG + Intronic
1024537645 7:50450970-50450992 GGGTGCTCAGCAATGTTCCCTGG + Intronic
1024953992 7:54896646-54896668 GGTTGCTCAGCATTCCTCCCAGG + Intergenic
1026801930 7:73405481-73405503 AGGTGCCCACCATTGGTGTCAGG - Intergenic
1027618788 7:80457088-80457110 AGGTGCACACCACTACTGCCCGG - Intronic
1028387552 7:90274635-90274657 GGGTGCTCACCATTACACCATGG - Intronic
1028655316 7:93198711-93198733 GGCTGTTCACCATTGCTGAATGG - Intronic
1030062197 7:105631436-105631458 GAGTTATCACCATTTCTGCCAGG + Intronic
1034188915 7:149198726-149198748 GGGGCCTCCCCCTTGCTGCCCGG - Exonic
1034196277 7:149250522-149250544 GGGGCCTCCCCCTTGCTGCCCGG - Exonic
1034198614 7:149266704-149266726 GGGGCCTCCCCCTTGCTGCCCGG - Exonic
1034201901 7:149287890-149287912 GGGGCCTCCCCCTTGCTGCCCGG - Intronic
1034227324 7:149494208-149494230 GGGGACTCCCCCTTGCTGCCCGG + Exonic
1034242502 7:149621264-149621286 GGGGACTCCCCCTTGCTGCCCGG + Intergenic
1034461178 7:151198880-151198902 GGGCCTTCACCATTGCTGCCCGG + Exonic
1035019867 7:155794507-155794529 TGGTGTTCACCAAGGCTGCCTGG + Intergenic
1035498475 8:72954-72976 TGGTGTCCACCACTGCTGCCTGG - Intronic
1037364308 8:18105944-18105966 GGGTTTTCACCATTTTTGCCAGG + Intergenic
1037368699 8:18149906-18149928 TGGTGCTGACCACAGCTGCCAGG + Intergenic
1039955415 8:42203449-42203471 TGGTGCTGATCATGGCTGCCAGG - Intronic
1043926997 8:86048642-86048664 GGGTGATCACCATGGCTGCAGGG - Exonic
1050898015 9:10908929-10908951 AGGTGCGCACCACTACTGCCTGG - Intergenic
1053043863 9:34897220-34897242 GAGTGCTCACTATTCCTGTCTGG - Intergenic
1053203896 9:36170714-36170736 GGATGCTCATCTTTCCTGCCAGG - Exonic
1053434382 9:38065883-38065905 GGGTGGTCACCATGGTTGGCTGG - Intronic
1053526145 9:38832831-38832853 GGATGGTCACTATTGCTGACCGG - Intergenic
1054162056 9:61680542-61680564 CGCTGCTCACCACTGGTGCCTGG + Intergenic
1054198372 9:62057256-62057278 GGATGGTCACTATTGCTGACCGG - Intergenic
1054639982 9:67531107-67531129 GGATGGTCACTATTGCTGACCGG + Intergenic
1056911177 9:90702274-90702296 TGGTTCTCACCTTTGCTTCCAGG - Intergenic
1057211725 9:93204271-93204293 GGGTGCTCAACATTTCTGCTGGG + Intronic
1062092026 9:134683341-134683363 GGCTGATCACCATTCCTCCCTGG + Intronic
1062093195 9:134689320-134689342 GGCTGATCACCATTCCTCCCTGG + Intronic
1062569718 9:137179492-137179514 GGGATCTCAGCAGTGCTGCCAGG + Intronic
1203610521 Un_KI270748v1:91640-91662 TGGTGTCCACCACTGCTGCCTGG + Intergenic
1187016706 X:15335744-15335766 GGGTGCTCACCCTGGTTTCCTGG + Intergenic
1188199833 X:27284236-27284258 GAGTGCTCACCATTGCATCATGG - Intergenic
1189293478 X:39902346-39902368 TGGTGCTGACCATTCCAGCCTGG + Intergenic
1198637857 X:138719162-138719184 GGTTGCTCAACAGTGGTGCCTGG + Intronic
1202026432 Y:20528639-20528661 GGGCGCCCACCATTGCTGGTTGG + Intergenic