ID: 1095953276

View in Genome Browser
Species Human (GRCh38)
Location 12:47793216-47793238
Sequence CAGCTGTTCCATGTGCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 206}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095953273_1095953276 0 Left 1095953273 12:47793193-47793215 CCTCATCGGCCAAATGCAATAAC 0: 1
1: 0
2: 0
3: 6
4: 87
Right 1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG 0: 1
1: 0
2: 2
3: 29
4: 206
1095953272_1095953276 7 Left 1095953272 12:47793186-47793208 CCTTGGTCCTCATCGGCCAAATG 0: 1
1: 0
2: 2
3: 9
4: 114
Right 1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG 0: 1
1: 0
2: 2
3: 29
4: 206
1095953274_1095953276 -9 Left 1095953274 12:47793202-47793224 CCAAATGCAATAACCAGCTGTTC 0: 1
1: 0
2: 1
3: 12
4: 110
Right 1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG 0: 1
1: 0
2: 2
3: 29
4: 206
1095953270_1095953276 23 Left 1095953270 12:47793170-47793192 CCTTAGATTTCGTGAGCCTTGGT 0: 1
1: 0
2: 0
3: 9
4: 59
Right 1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG 0: 1
1: 0
2: 2
3: 29
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095953276 Original CRISPR CAGCTGTTCCATGTGCTCCA TGG Intronic
900159131 1:1215275-1215297 CAGCTGTTTCCTGTGCTCCTGGG - Intergenic
900405746 1:2492245-2492267 CAGCTGTGCCGAGTGCTCCGAGG - Intronic
900939196 1:5786932-5786954 CACCTTTTCCCTGTCCTCCAGGG - Intergenic
901462504 1:9400086-9400108 CAGCTGTTCCCTTTGCACCGGGG + Intergenic
901962422 1:12838124-12838146 CTGGAGTTCCATGTGCTCCTAGG - Intergenic
902107165 1:14047397-14047419 GTGCTGTTCCATGGGCTCCTGGG - Intergenic
902282086 1:15382126-15382148 CTGGTGCTCCATGCGCTCCAGGG - Exonic
903761600 1:25702429-25702451 CAGCTCTTCCTTCTCCTCCAAGG + Intronic
903995839 1:27305068-27305090 AACCTGGTCCGTGTGCTCCAAGG + Exonic
903996463 1:27307990-27308012 CAGCTGGTCCTTGGGCCCCAGGG - Exonic
904089527 1:27935043-27935065 CAGGTGTTCCAAGTCCTCCAAGG - Exonic
904509558 1:30992489-30992511 CACATGTTCCATGGGGTCCAAGG + Exonic
906155848 1:43613494-43613516 CACCAGTTCCAAGTGCTCCATGG + Intronic
907108873 1:51908530-51908552 CTGCTGTTCAACCTGCTCCAGGG + Exonic
909146015 1:71932616-71932638 CAATTGTTGCATGTACTCCAGGG - Intronic
909731855 1:78901535-78901557 CAACTGTACCATGTGTACCAAGG - Intronic
909898925 1:81109091-81109113 CGGCTGATCCCTGTGCCCCAGGG - Intergenic
910112739 1:83700265-83700287 CAGCTGTTGTCTGTTCTCCATGG + Intergenic
910793613 1:91075878-91075900 CAGCTGCTTCCTGTCCTCCACGG + Intergenic
911104208 1:94117404-94117426 CAGCTGTCCCAGGTGCTCCAGGG + Intronic
915523488 1:156462481-156462503 CAGCCGCTCCATCTGCCCCAGGG + Intergenic
916610818 1:166389735-166389757 CAGCTGTTTCATTTGGTCAAGGG - Intergenic
916713292 1:167431012-167431034 GAACTGTACCATGTGCTACAGGG - Exonic
918550078 1:185732959-185732981 GAGCTATTCCAGGTGCTCAAGGG - Intergenic
919365189 1:196650646-196650668 CACCTGTTGCATGTCCTTCAAGG + Intergenic
922028193 1:221772929-221772951 CACCTGTTCTATCTGTTCCATGG + Intergenic
922439075 1:225637142-225637164 CATCTCTTCTGTGTGCTCCAGGG + Intronic
924508274 1:244706409-244706431 CAGGTGTTCCATGGGCACCTGGG - Exonic
1065551308 10:26870928-26870950 TAGCTTTTCCATGTGCCCCATGG - Intergenic
1066281109 10:33919207-33919229 CAGTGCTTCCATGTGCTCTATGG + Intergenic
1067421964 10:46159664-46159686 CAGGTGTCCTGTGTGCTCCATGG + Intergenic
1067507271 10:46865753-46865775 CAGGTGTCCTGTGTGCTCCATGG + Intergenic
1069255331 10:66324670-66324692 AACCTGTTCCATGTCCTGCATGG + Intronic
1069748727 10:70732392-70732414 CAGCTGTGCCGTGAGCTCCAGGG + Intronic
1069884497 10:71615322-71615344 CGGCTGCTCCATGGACTCCAGGG + Intronic
1073510380 10:104039102-104039124 CAGGTGATCCAGGTGTTCCAGGG - Exonic
1074297492 10:112204031-112204053 CTGCTGTGCCATCTCCTCCACGG - Intronic
1075015593 10:118908123-118908145 TTGCTGTTCCATGAGCTCCTGGG - Intergenic
1077799381 11:5522963-5522985 TAGCTGTTCCAGCTGCTCCAGGG + Intronic
1078264933 11:9747998-9748020 AAGCTGCTCCAGCTGCTCCATGG - Exonic
1079973708 11:27066630-27066652 GAGCTATTCCATGTATTCCATGG - Intronic
1083988720 11:66233558-66233580 CAGCTGTTCCGTCTGCTTCATGG + Intronic
1085667317 11:78426272-78426294 CAACTTTTCCATGGGTTCCACGG - Intergenic
1087738248 11:101858658-101858680 CAGCAGATCCATTTGCTTCATGG - Intronic
1089957718 11:122587452-122587474 CATCATTTCCATGTGCCCCATGG + Intergenic
1090583758 11:128187875-128187897 CAGATGTTCCAAAGGCTCCATGG - Intergenic
1091256591 11:134192796-134192818 CAGCTGGTCCAGGAACTCCAGGG + Exonic
1091818686 12:3458377-3458399 CAGCAGGTCCATGGGCCCCAGGG + Intronic
1091906516 12:4193944-4193966 CAGCTTCTCCAGGTCCTCCACGG + Intergenic
1092464491 12:8718124-8718146 CAGCTATTCCATTTCCTCTATGG + Intronic
1093086396 12:14870036-14870058 CTGCTTTTCTATGTTCTCCATGG + Intronic
1094502594 12:31034457-31034479 CAGCAGGCCCATGGGCTCCAGGG - Intergenic
1095425842 12:42073861-42073883 CAGGTGTTCCATGTTCTTAAAGG + Intergenic
1095953276 12:47793216-47793238 CAGCTGTTCCATGTGCTCCATGG + Intronic
1097013406 12:55968781-55968803 TATCTGTTCCAGCTGCTCCAGGG + Exonic
1101407018 12:104437624-104437646 CAGCAGCACCATGTCCTCCAAGG - Intergenic
1101603898 12:106233351-106233373 CCCCTGCTCCATGTGCTCCATGG + Intergenic
1102351399 12:112194916-112194938 CAGCAGTTGCAGGTGCTCCAGGG + Exonic
1102955911 12:117058957-117058979 CACCTTTTCCTTCTGCTCCATGG + Intronic
1103477720 12:121230804-121230826 CTGCTGCCCCATGTTCTCCAGGG - Intronic
1104609924 12:130219634-130219656 CAGCTCATGCATGTGCCCCATGG + Intergenic
1106035169 13:26037620-26037642 CAGCTGGTCCTGGTGCCCCACGG - Intergenic
1110220469 13:73067524-73067546 CAGCTTTTCCATATTCTCTAAGG - Intronic
1113359258 13:109613783-109613805 CAGCTGATGCAGGTGTTCCAGGG - Intergenic
1113582716 13:111440232-111440254 CAGCATATCCATGTTCTCCAAGG - Intergenic
1114734854 14:25033727-25033749 CAACTGTTGTAAGTGCTCCAGGG - Intronic
1115379325 14:32717054-32717076 CACCTGATCCACCTGCTCCAGGG - Intronic
1118570586 14:67190886-67190908 AAGCTGTTCTCTGTGCTCCTTGG - Intronic
1122039543 14:98974318-98974340 CACCTTTTCCTTGTCCTCCAAGG - Intergenic
1122302808 14:100740726-100740748 CACCTGCTCCAGGTGCTGCACGG - Intergenic
1123118205 14:105904255-105904277 CATCTGTTTCATGATCTCCAGGG + Intergenic
1123120494 14:105914117-105914139 CATCTGTTTCATGGTCTCCAGGG + Intergenic
1123194556 14:106604116-106604138 CAGCTGTTGTATGTGCTTTAGGG + Intergenic
1126066499 15:44830034-44830056 CAACTGTTCCAAATGCTCTAAGG + Intergenic
1126093382 15:45070835-45070857 CAACTGTTCCAAATGCTCTAAGG - Intronic
1129921885 15:79326438-79326460 CACCTGTTCCATGTTCTCTCTGG + Intronic
1131051158 15:89348991-89349013 CTGCAGATCCATGTGCTCTAAGG + Intergenic
1131940179 15:97554379-97554401 CAGCTGTACTGTTTGCTCCAAGG + Intergenic
1133145736 16:3785196-3785218 AAGGTGCTCCAAGTGCTCCATGG + Intronic
1133256801 16:4522159-4522181 CAGCTGGGCCACCTGCTCCACGG + Intronic
1136103482 16:28012137-28012159 CAGCTGCTCCAAATGCCCCACGG + Intronic
1138922796 16:61553506-61553528 CAGATGTTCCAGTTGCTCCTGGG + Intergenic
1139102454 16:63785155-63785177 AAGCTGTTCCATGTGGAGCAGGG + Intergenic
1139472754 16:67187048-67187070 CAGCTGCTCAATGTTCTCCAAGG + Exonic
1139551564 16:67675905-67675927 CAGCTGTTTCATGCGCACGAAGG + Exonic
1139706985 16:68747559-68747581 AATCTGTTCCCTGTGCCCCAGGG - Intronic
1142277858 16:89132423-89132445 CATCTGTTCCTGGTGCTGCAGGG + Intronic
1143291153 17:5830170-5830192 AAGCTGCTCCAGGTGGTCCAGGG - Intronic
1144686335 17:17228564-17228586 CACCTGCTCCATGTGGGCCAAGG + Intronic
1146640519 17:34537245-34537267 TAGCAGTTCCTTGTGCTCCAGGG + Intergenic
1147981951 17:44280212-44280234 CAGCTGTTCCATGTGGCCTCAGG + Intergenic
1149389229 17:56172887-56172909 CAGATGATACAAGTGCTCCAGGG - Intronic
1151936673 17:77266244-77266266 CATCTGTGCCTTTTGCTCCAGGG - Intergenic
1152315261 17:79576772-79576794 CATCATTTCCATGTTCTCCATGG - Intergenic
1153465821 18:5387058-5387080 CAGCCCCACCATGTGCTCCATGG - Intergenic
1153897483 18:9579905-9579927 CAGCTGTTCCTTGGTATCCATGG - Intronic
1154176925 18:12092026-12092048 CAGCTGCTCCAGGTTCTGCAGGG + Intergenic
1156419309 18:36933668-36933690 CAGCTGTTCTAGGGGATCCAGGG + Intronic
1156434116 18:37107894-37107916 CATGTGTTCCATTTTCTCCACGG - Intronic
1157104233 18:44758305-44758327 CAGCTGTTTTATTTGCTCCAAGG - Intronic
1157679205 18:49590636-49590658 CAGTTGTTCCCAGTGCTCCAGGG - Exonic
1158887399 18:61841057-61841079 CTGCTGCTCCATGTGCCCCATGG - Intronic
1159366466 18:67472067-67472089 CAGCTCTTCCATGTTAACCACGG + Intergenic
1161233908 19:3188725-3188747 CAGCTGGTCCGTGGGCTCCCGGG + Intronic
1161581239 19:5082210-5082232 CAGCGGCTCCAGGGGCTCCAGGG - Intronic
1161825769 19:6563921-6563943 CAGCTGCTGCTTCTGCTCCAAGG + Intergenic
1162456156 19:10786280-10786302 AAGCTGTTGCTTGTCCTCCAAGG + Intronic
1162760422 19:12885559-12885581 CAGCTCTTCCGCGGGCTCCAGGG - Exonic
1168344782 19:55644832-55644854 CAGCTGCCCCGTGTGCTCAAGGG + Exonic
925083717 2:1091298-1091320 GAGCTGTCCCAAGTGGTCCAGGG - Intronic
926906295 2:17808636-17808658 GAGCTGTTCCATGTTCCACAAGG - Intergenic
928619272 2:33072253-33072275 CAGATCTTCCATGTCCTCCCGGG + Intronic
928758186 2:34551362-34551384 CATCTGTTCCATGTGTTGCAAGG + Intergenic
929462507 2:42113641-42113663 CAGCTGTCCTGTGTTCTCCAGGG + Intergenic
929613971 2:43293625-43293647 AAGCTGTCTCATGAGCTCCAGGG - Intronic
930107604 2:47652378-47652400 AAGCTGTGCCATGTAGTCCAGGG - Intergenic
933161205 2:79026750-79026772 CAGCTGTCCCAAAGGCTCCAAGG + Exonic
935134120 2:100284421-100284443 CAGCTGAGCCTTGCGCTCCAGGG + Exonic
935178261 2:100668342-100668364 CAGGTGTTCCCTCTGCTGCAGGG - Intergenic
938416313 2:131105882-131105904 CTGCTGCTCCCTCTGCTCCAGGG + Intronic
939181556 2:138808947-138808969 CAGCTGTACCATGTCCTCAAAGG + Intergenic
939419003 2:141941646-141941668 CCACTGTTCCACGTGCTCCCAGG - Intronic
944127224 2:196307943-196307965 CAGCTGCTCCATTTGCTGTATGG + Exonic
944665137 2:201953502-201953524 CAGCAGTGCCTTGTGCTCCAGGG + Intergenic
946455655 2:219823782-219823804 CAGCTGTTGCTTTTGCACCAGGG + Intergenic
947102007 2:226630950-226630972 CACCTGTACCATGTGGTCTAAGG - Intergenic
947324011 2:228955163-228955185 TATCTGTTCCATGTGGTCCACGG - Intronic
948747852 2:240108995-240109017 CGGCTGGTCCCTGTGCTCCATGG + Intergenic
1171157351 20:22888459-22888481 CAGCTTTTCCTTATGTTCCATGG - Intergenic
1172589786 20:36109544-36109566 CAGTTATTCCATGTGCCTCAAGG + Intronic
1173737987 20:45375201-45375223 CAGCTGCTTCATGTGCCCCATGG + Exonic
1174106797 20:48168052-48168074 CAGCTGGGACATGAGCTCCAGGG - Intergenic
1176169602 20:63690901-63690923 CCGCTGTTCGCTGTGCTCCAGGG - Exonic
1177825042 21:26073452-26073474 CATCTGTTCCTTGAGCTCCAGGG - Intronic
1178695909 21:34792665-34792687 CAGCTCTTCCCTCTGCCCCAGGG + Intronic
1178830708 21:36054182-36054204 CAGCTGTTCCCTGTGAGCCAAGG + Intronic
1182112109 22:27731244-27731266 CAGCTGTATAATGGGCTCCATGG - Intergenic
1183303206 22:37068764-37068786 CTGCTGTTCCTTGGGCTGCAAGG - Intronic
1183758170 22:39790246-39790268 CTGCTTCTCCCTGTGCTCCATGG - Intronic
1184433970 22:44458830-44458852 CAGCTTCTGCATGAGCTCCAGGG + Intergenic
1185197289 22:49479843-49479865 CGGCTGTGGCAGGTGCTCCATGG + Intronic
949347174 3:3087336-3087358 CTGCTGTCCCCTGTGCTCCTTGG + Intronic
950635107 3:14308678-14308700 CAGCTGCTCCAGGGGCTCCTGGG - Intergenic
952692673 3:36228084-36228106 CAGCTGCTCCTTCTGCCCCATGG - Intergenic
956237957 3:67096033-67096055 CAGGTTTCCCTTGTGCTCCATGG - Intergenic
956777512 3:72577750-72577772 CAGCTGCTCCCTGTGCTCTCCGG + Intergenic
956875344 3:73457531-73457553 GTGCTGTTCCATGTGCCCCCTGG + Intronic
961569452 3:127787401-127787423 CAGCCGTTCCACGTGCTCTAGGG - Intronic
961828839 3:129612919-129612941 TGGCTGTTCCCTGTTCTCCAGGG + Intergenic
963143041 3:141963676-141963698 GAGGTGTTTCATGTGCCCCAAGG + Intronic
963808626 3:149752406-149752428 CAGGTGTTCCTTATGCTCCTCGG + Exonic
965711260 3:171558597-171558619 CTGCTGTTCCAGGTGCTCTGTGG + Intergenic
967701566 3:192598682-192598704 TTGCTGTGCCATGTGCTCTAGGG - Intronic
968487933 4:872879-872901 CAGCTGTTACATCTGTGCCATGG + Intronic
968532861 4:1104415-1104437 CAGCTCTGCCCTGTTCTCCAGGG + Intronic
968704835 4:2072992-2073014 CACCTGTTCCAAGGACTCCATGG + Exonic
970855462 4:20645964-20645986 CAGCTGTTCCATTTGTCCCTGGG - Intergenic
976476472 4:85489524-85489546 CAGCTGAGCCATGAGCTGCAGGG - Intronic
976492986 4:85693519-85693541 CAGCAGGTCCCTGTGCCCCAGGG - Intronic
978710490 4:111774645-111774667 CAGCTTTCCCATCTGCTCAAGGG + Intergenic
978761403 4:112358599-112358621 CCACTGTTCGCTGTGCTCCAGGG - Intronic
978993797 4:115123582-115123604 CTGCTGATCCATGAGCTGCAAGG + Intergenic
980073809 4:128271754-128271776 CAGCTGTTCCAAGGGACCCAGGG + Intronic
980506667 4:133732658-133732680 CAGTTGTGCCATGTTCTACATGG + Intergenic
982399449 4:154950527-154950549 CATCTATTTCGTGTGCTCCAGGG + Intergenic
985592632 5:773557-773579 CAGCTGTGCCCTGTACTCCCAGG + Intergenic
985729706 5:1540326-1540348 CTGTGGTTCCATGGGCTCCAGGG + Intergenic
986427274 5:7646688-7646710 GAGCTGTACGATGTGCTTCAGGG - Intronic
986682994 5:10250527-10250549 CGGCTCTGCCATGTGCTCCCCGG + Intronic
989127745 5:38073590-38073612 CCCCTGTTCCATCTGCCCCATGG - Intergenic
990137840 5:52668755-52668777 CAGCTGATCCACGTCCTGCATGG - Intergenic
991454447 5:66787616-66787638 CAGATGTTACCTGTGCTGCAGGG + Intronic
991622213 5:68556657-68556679 CATCTGTTCTATGTGGTCTAGGG + Intergenic
991641412 5:68758006-68758028 CTGCTGTTCCTTGTGCTTCCTGG - Intergenic
992085586 5:73275346-73275368 CAGCTGTTCCATTTTCTCCAAGG - Intergenic
994321678 5:98401783-98401805 CAGCTGTGCTTTGTGCTCCCAGG - Intergenic
1001221184 5:169902428-169902450 CAGCAGGGCCTTGTGCTCCAGGG + Intronic
1001710086 5:173771579-173771601 CAGCATTTCCCGGTGCTCCACGG + Intergenic
1001891095 5:175339487-175339509 CAGCTCTTCCATGTGGGGCATGG + Intergenic
1002800112 6:514646-514668 CAGCTGCTCCAGGGGCTCCAGGG + Intronic
1005569811 6:27133841-27133863 CAGCTGTTCCACGCGGGCCAGGG + Exonic
1005950042 6:30625211-30625233 CAGCAGTGCCATGTAGTCCAGGG - Intronic
1006090256 6:31624503-31624525 CACCATCTCCATGTGCTCCATGG - Exonic
1011332834 6:86228665-86228687 CTGCTTTGGCATGTGCTCCATGG + Intergenic
1011836320 6:91435800-91435822 CAGAAGTTCCATGTGACCCAAGG - Intergenic
1016830063 6:148425091-148425113 CATCTCTTCCATGAGCTTCAGGG - Intronic
1019588041 7:1815347-1815369 CAGATGCTCCATCTGCCCCATGG + Intergenic
1020033744 7:4951318-4951340 CCACTGTTCCATGGGCTCTATGG - Intronic
1021440637 7:20670420-20670442 CATCGGTGACATGTGCTCCATGG - Intronic
1021804749 7:24343685-24343707 CAGCTGTGTGATGTGCTACAGGG - Intergenic
1021805317 7:24349310-24349332 CAGCTGTATGATGTGCTACAGGG + Intergenic
1022898240 7:34774529-34774551 CAGCTGTTCCATCTTGACCAAGG + Intronic
1023825721 7:44007535-44007557 CTTCTGTTCCATGAGCTGCAGGG + Exonic
1026724991 7:72864114-72864136 CTTCTGTTCCATGAGCTGCAGGG - Intergenic
1026841241 7:73671009-73671031 CAGCTGCTCCATCTGCTCCTGGG - Exonic
1029397728 7:100319757-100319779 CTTCTGTTCCATGCGCTGCAGGG + Exonic
1029586105 7:101472645-101472667 CAGCTGCTCCATGCTCTCCTGGG - Intronic
1029718611 7:102348313-102348335 CTTCTGTTCCATGAGCTGCAGGG - Intergenic
1029754005 7:102560942-102560964 CTTCTGTTCCATGAGCTGCAGGG + Exonic
1029771955 7:102660032-102660054 CTTCTGTTCCATGAGCTGCAGGG + Exonic
1033377075 7:140772057-140772079 CATCTGTGCCATTTGATCCATGG + Intronic
1034941313 7:155232146-155232168 CAGTTGTTCCCTGTGGTCGAGGG + Intergenic
1035133073 7:156674078-156674100 CAGCAGTTACATCTGCTTCATGG - Intronic
1035471166 7:159109678-159109700 CAGCTGTTCCCTGACCCCCAGGG + Intronic
1035688007 8:1539814-1539836 CAGCTGTGCCATGAGCACCACGG + Intronic
1037744053 8:21629328-21629350 CAGTTTTTCCATGTGCTAAACGG - Intergenic
1044277984 8:90324186-90324208 GAGCTGTTACAAGTCCTCCATGG - Intergenic
1049496031 8:142933926-142933948 CTGCTGTTACAATTGCTCCAGGG - Intergenic
1050869257 9:10545864-10545886 CTGCTGTGCCTTGTGTTCCATGG - Intronic
1051195897 9:14562667-14562689 GAGCTGTTCTGTGTTCTCCAAGG - Intergenic
1051975385 9:22942036-22942058 CAGCTTTTCCAGGTGCACGATGG + Intergenic
1052235493 9:26209211-26209233 CACTTGCTCCTTGTGCTCCAAGG - Intergenic
1053385807 9:37687029-37687051 CATCTGCTCCATGTATTCCATGG + Intronic
1053512723 9:38702554-38702576 GAGCTGATCCTTCTGCTCCAAGG + Intergenic
1055009791 9:71552818-71552840 CAGCTAACCCCTGTGCTCCAAGG + Intergenic
1055628389 9:78197567-78197589 CAGCTGTCACAGGTGCACCAAGG + Intergenic
1057228302 9:93304024-93304046 CAGCTGTCCCGTGGGCTCCTGGG + Intronic
1057748283 9:97769942-97769964 CATCTGTTCCTTCTGCCCCAGGG + Intergenic
1058566928 9:106296064-106296086 CAGCTCTTTGATGTACTCCAAGG - Intergenic
1058856729 9:109069607-109069629 CAGCTGTTCCATTCGTGCCATGG + Intronic
1058975399 9:110121438-110121460 CAGCTTTTCAAGCTGCTCCAAGG - Intronic
1059992971 9:119882642-119882664 CTGCTTTTTTATGTGCTCCAGGG + Intergenic
1060002109 9:119968298-119968320 CACCTGTTCCATGTTCTCTCTGG - Intergenic
1060795090 9:126507797-126507819 CAGCTGTTCTATCTGCACCACGG - Intergenic
1060902282 9:127270357-127270379 CAGCTGTTCATTGTACTTCAAGG + Intronic
1060934894 9:127509117-127509139 CAGCTTCTCCATGTACTGCAGGG + Exonic
1061038049 9:128124394-128124416 CAGCAGCTCCACGTGCTCCCAGG + Intronic
1185986112 X:4835983-4836005 CAGAAACTCCATGTGCTCCAAGG - Intergenic
1186253625 X:7696542-7696564 CAGCTGTTACATGCCTTCCAGGG - Intergenic
1186829515 X:13376781-13376803 CAGATGTTTCATTTCCTCCAGGG - Intergenic
1187785713 X:22883570-22883592 CCTCTCTTCCATGTGCTTCATGG - Intergenic
1190083709 X:47377056-47377078 CAGCTGATCCATTAGGTCCAGGG - Intronic
1190914064 X:54797063-54797085 AAGCTATTCTATGCGCTCCACGG - Exonic
1194675226 X:96785978-96786000 CTGCTCTTCCATTTGCTCCAGGG - Intronic
1195640837 X:107173025-107173047 GAGCTGCTCCACCTGCTCCAGGG + Intronic
1195898552 X:109773298-109773320 CAACTGTGACAAGTGCTCCAAGG + Intergenic
1197130685 X:123002370-123002392 CTCCAGTTCCATGTGCTGCAGGG - Intergenic
1197996419 X:132380421-132380443 CAGTTATCCCATGTGCTCAAAGG + Intronic