ID: 1095954421

View in Genome Browser
Species Human (GRCh38)
Location 12:47798220-47798242
Sequence CTGTAGGGGCAGAGTCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 505
Summary {0: 1, 1: 0, 2: 9, 3: 37, 4: 458}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095954411_1095954421 19 Left 1095954411 12:47798178-47798200 CCTCCGCTAGCTTCTGCTTGACC 0: 1
1: 0
2: 1
3: 10
4: 111
Right 1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG 0: 1
1: 0
2: 9
3: 37
4: 458
1095954414_1095954421 -2 Left 1095954414 12:47798199-47798221 CCACGCTGCTGGCTACAGCACCT 0: 1
1: 0
2: 1
3: 16
4: 167
Right 1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG 0: 1
1: 0
2: 9
3: 37
4: 458
1095954412_1095954421 16 Left 1095954412 12:47798181-47798203 CCGCTAGCTTCTGCTTGACCACG 0: 1
1: 0
2: 0
3: 4
4: 84
Right 1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG 0: 1
1: 0
2: 9
3: 37
4: 458

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095954421 Original CRISPR CTGTAGGGGCAGAGTCAGGA GGG Intronic
900142693 1:1145234-1145256 CTCTCGGGGCAGAGGCTGGATGG - Intergenic
900648840 1:3721235-3721257 CTGCAGGGGCTGGCTCAGGAAGG + Intronic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
902330312 1:15728056-15728078 CTGTGAGGGCCAAGTCAGGAGGG - Intronic
902381004 1:16052175-16052197 CTGCAAGGGCAGAGTCAGGCAGG - Intronic
902974480 1:20079000-20079022 CTCGAGAGGCAGAGGCAGGAGGG + Intronic
903622000 1:24704679-24704701 CTGTGGGGGCAGACTCAGAGAGG + Intergenic
903650184 1:24917251-24917273 CTCCAGGGGCAGGGTCAGCATGG - Intronic
903724164 1:25428876-25428898 GTGTTGGGGCAGAGGCAGGAAGG + Intronic
904377235 1:30089639-30089661 CTGGGGGCTCAGAGTCAGGAGGG + Intergenic
904461318 1:30682037-30682059 CTGTGGCGGCAGAGGCGGGATGG + Intergenic
904648599 1:31987363-31987385 CTGGTAGGGCAGAGTGAGGAGGG - Intergenic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
904836323 1:33339579-33339601 CTCTAGAGGCAGAGGCAGGGAGG + Intronic
904917178 1:33978521-33978543 CTGCAGGGTCAGGGTCAGGAAGG + Intronic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905025855 1:34848818-34848840 CTGTAGGCGAGGAGCCAGGAAGG + Intronic
905257219 1:36692597-36692619 CTGTAGGTGGAGAGTCATGAAGG + Intergenic
906647659 1:47487466-47487488 CTGCTGGGGTAGAGTCAGGCAGG - Intergenic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907586261 1:55620650-55620672 CTGCAGGGGCAGAGCCTTGATGG + Intergenic
909027068 1:70494369-70494391 GAGTAGGGGTAGAGGCAGGAAGG + Intergenic
909245354 1:73274146-73274168 CTGTAGGAGCAGAGGTGGGAAGG + Intergenic
909516062 1:76508572-76508594 CTGTAGGGGTAGACTCCGGGGGG - Intronic
910214806 1:84832532-84832554 GTGTAGGGGCAGGGTCATGAAGG + Intronic
910415021 1:86988394-86988416 CTGTATGGGAACAGTCAGGTTGG - Intronic
911100303 1:94090485-94090507 CAGTAGGGGTAGAGTGAGAATGG - Intronic
912153130 1:106883154-106883176 CTGTAGGGGCAGAGCCCTGATGG - Intergenic
914317829 1:146530797-146530819 CTGTAGGGGCAGAGCCTTCAGGG - Intergenic
914339357 1:146745842-146745864 CTGTAGGGGCAGAGTAAGGCTGG - Intergenic
914496527 1:148202561-148202583 CTGTAGGGGCAGAGCCTTCAGGG + Intergenic
915073827 1:153293223-153293245 CTGTAGGAGGAAAGCCAGGATGG - Intergenic
915291653 1:154888224-154888246 CTCTAGCGGAGGAGTCAGGATGG - Intergenic
915786976 1:158624136-158624158 CTGCAGGGGCAGAGTCCTCATGG + Intronic
916009098 1:160688538-160688560 CTGTATGGGAATAGTCAGGTTGG + Intronic
916296749 1:163228219-163228241 CTGCAGGGGCAGAGCCATCATGG - Intronic
916443097 1:164846713-164846735 CAGTTGGGGCAGGGGCAGGAGGG + Exonic
917781229 1:178399440-178399462 TTGTAGGGGCAGCCACAGGAAGG + Intronic
918042448 1:180921575-180921597 CTGTGGGGGCAGGGACAGGGTGG - Intronic
918259549 1:182783209-182783231 CTGAGGGGGCTGAGGCAGGAGGG - Intergenic
918548632 1:185713774-185713796 CTGGAGTGGCCGAGTCAAGATGG - Intergenic
918956706 1:191217548-191217570 CTGTAGGGTCAGAGTCCTCATGG - Intergenic
919108996 1:193193065-193193087 CTGTAGGGGCTTGGTCAGGGTGG - Intronic
920397639 1:205658707-205658729 TTGTAGGGGAAGAGTCCTGAGGG - Exonic
921605774 1:217152678-217152700 GTGTGGAGGCAGAGTCAGGCTGG + Intergenic
921716035 1:218417965-218417987 CTGTAGGGGCAGGGTCCTCATGG + Intronic
921890161 1:220345816-220345838 CAGGAGGGGCAGGATCAGGAAGG - Intergenic
922593322 1:226795416-226795438 CTGGAGAGGGAGAGGCAGGAAGG - Intergenic
922820120 1:228479020-228479042 CTGCAGGGCCAGAGACAGCATGG - Intergenic
923450249 1:234110391-234110413 CTGGAATGGCAGAGCCAGGAAGG + Intronic
923575786 1:235157870-235157892 CTTCAGTGGCACAGTCAGGACGG + Intronic
923871171 1:237995598-237995620 AAGTTGGGGCAGAGTCAGGGAGG - Intergenic
924208876 1:241744167-241744189 ATGTAGGGGCTGAGACAGGCAGG - Intronic
924335863 1:242986334-242986356 CTGTAGGGGAAATGACAGGAAGG + Intergenic
924394774 1:243607072-243607094 CTGCAGGGGCAGAGTCCTCATGG + Intronic
1062849061 10:729122-729144 CTGCAGGGGGAGGGTCAGGGAGG - Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064008462 10:11716030-11716052 CTGCAAGGTCAAAGTCAGGACGG + Intergenic
1065857984 10:29845892-29845914 CTGGGGAGGCAGAGGCAGGAGGG - Intergenic
1066317162 10:34259480-34259502 CAGAAGGGGCAGAGTCAGGAAGG - Intronic
1069617726 10:69816833-69816855 CAGTAGGGGAAGAGCCAGGTAGG + Intronic
1069751575 10:70748527-70748549 ATGTAGGGGCAGGGTGAGGGTGG - Intronic
1069867199 10:71511275-71511297 GTGTAGGTGAAGAGTCAGGTGGG + Intronic
1071251524 10:83824253-83824275 CTGTAAGGGCATAAACAGGAGGG + Intergenic
1073070182 10:100788371-100788393 CTGGAGGGGCAGTGGGAGGAGGG + Intronic
1073094490 10:100971449-100971471 CTGCAGGGGCAGAGCCCTGAGGG - Intronic
1073124673 10:101141911-101141933 CTGTAGGGGCTGGGGGAGGAGGG - Intergenic
1073293569 10:102425199-102425221 CTGAAGGGACACAGACAGGATGG + Intronic
1073932989 10:108598248-108598270 GTGTAGGGGTTCAGTCAGGATGG + Intergenic
1074306651 10:112285288-112285310 CTGTAGGGATGGAATCAGGAAGG + Intronic
1075303023 10:121342267-121342289 CTAGAGGGGAAGAGGCAGGAAGG + Intergenic
1075879450 10:125837848-125837870 CTGTCGGGGAAGAGGAAGGAGGG - Intronic
1075977201 10:126706290-126706312 CTGTGAGGGCAGAGCCAGCAGGG + Intergenic
1076008131 10:126964444-126964466 CTGTAGGAGCACAGACAGGGAGG + Intronic
1076521674 10:131085120-131085142 CTGTGGGGACACAGCCAGGAGGG + Intergenic
1077608584 11:3628818-3628840 ATGCAGGGGCAGAGGCAGGATGG + Intergenic
1077934793 11:6772055-6772077 CTGTTGGCGCAGAGACAGTAAGG - Intergenic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1078839461 11:15064939-15064961 CTGTATGGGAACAGTCAGGTTGG + Intronic
1080147587 11:29005810-29005832 GTGGAGGGGAAGAGACAGGAAGG - Intergenic
1081315562 11:41625459-41625481 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
1081584553 11:44375498-44375520 CTCTGGGGGCAGAGCTAGGATGG - Intergenic
1081670781 11:44941324-44941346 CTGTAGGGGAAAAGTGAGGTTGG - Intronic
1083678598 11:64341197-64341219 GTGCGGGGGCAGAGGCAGGAGGG - Intronic
1084030310 11:66477059-66477081 ATCCAGGGACAGAGTCAGGATGG + Exonic
1084307964 11:68299025-68299047 CTGTAGGGGCAAGATCGGGACGG - Intergenic
1084453619 11:69254628-69254650 CAGCAGGGGCAAAGGCAGGAGGG + Intergenic
1084694306 11:70744621-70744643 CTGCAGGGGCACAGCCAGGTGGG - Intronic
1084888841 11:72226708-72226730 CAGTAGGGGGAGACTAAGGAGGG + Intronic
1084963857 11:72733234-72733256 GTGTAGGGGCAGACTGTGGAAGG + Intronic
1085120423 11:73964160-73964182 CATCAGGGGCAGAGCCAGGATGG + Intronic
1085442485 11:76577370-76577392 CTGTCTGGGGAGTGTCAGGAAGG - Intergenic
1085560860 11:77472421-77472443 CTGTAAGAGGAGAGACAGGATGG + Intronic
1086220576 11:84438031-84438053 CTGCAGGGGCAGATTCATGGTGG - Intronic
1086742217 11:90381806-90381828 CTTTAAGGGTAGAATCAGGAAGG - Intergenic
1088097587 11:106118123-106118145 CAGTTGGGGCAGAGTAAGGGAGG - Intergenic
1089218555 11:116851478-116851500 ACTTAGGGGCAGAGGCAGGATGG + Intronic
1089756879 11:120693806-120693828 CTGTAGTGGCTGAGCCGGGAGGG + Intronic
1090208672 11:124899936-124899958 CTGTGGGGCCAGAGTGATGAAGG + Intergenic
1090266907 11:125359071-125359093 CTGTGGGAGCAAAGGCAGGAAGG + Intronic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG + Intergenic
1091041398 11:132284743-132284765 CTGTCGGGGAAGAGTCAGGTGGG - Intronic
1091403939 12:197372-197394 CTGAAGTGGCCGAGTCAGGTAGG - Exonic
1092945997 12:13454523-13454545 GTGTAGGGGCAGAGGCAGATGGG + Intergenic
1093171307 12:15863790-15863812 TTGTAGGGGTTCAGTCAGGATGG - Intronic
1093313193 12:17617309-17617331 CTGTAGGGGCAGAGCCTCCATGG - Intergenic
1093353124 12:18128303-18128325 CTGTAGGGGCAGGGTCCTCATGG + Intronic
1094797931 12:33998085-33998107 CTGAAGGGCCAGAGTCAGCAAGG + Intergenic
1095110697 12:38292124-38292146 CTGAAAGGCCAGAGTCAGCAAGG + Intergenic
1095954421 12:47798220-47798242 CTGTAGGGGCAGAGTCAGGAGGG + Intronic
1096634919 12:52952096-52952118 CTGCAGGGGCACAGAGAGGAGGG - Intronic
1097167395 12:57093162-57093184 CTGTCTGGGGAGAGTCTGGATGG + Exonic
1098236064 12:68419621-68419643 CTGGAGAGGCTGAGACAGGAGGG + Intergenic
1099555265 12:84102256-84102278 CTGTATGGGAACAGTCAGGTTGG + Intergenic
1099972585 12:89515375-89515397 CTCAAGGGGCTGAGGCAGGAGGG - Intronic
1100268356 12:93000046-93000068 CTGATGGGCCAGAGACAGGAGGG - Intergenic
1100682777 12:96947332-96947354 CTGTGGGGGCAGATTTAGAAAGG + Intronic
1100933670 12:99639058-99639080 CTCTAGGGGCAGAGTCCTCATGG + Intronic
1101501972 12:105312434-105312456 CTGTATGGGAACAGTCAGGTTGG - Intronic
1101986738 12:109453019-109453041 GGTTAGGGGCAGAGCCAGGACGG + Intronic
1102418711 12:112787091-112787113 CTGGAGGGCCAGAGTCAGAGAGG - Intronic
1102468243 12:113142949-113142971 AGGTAGGGGCAGAGGCATGAAGG + Intergenic
1104483657 12:129130409-129130431 AGGGAGGGGCAGAGTCAGGATGG - Intronic
1104655779 12:130572882-130572904 GGGTAGGAGCAGGGTCAGGAGGG + Intronic
1104748697 12:131224878-131224900 CTGGAGGGGCAGAGCCAGGCAGG + Intergenic
1104784427 12:131440686-131440708 CTGGAGGGGCAGAGCCAGGCAGG - Intergenic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1105235960 13:18553919-18553941 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1108275711 13:48807544-48807566 CACTTGGGGCAGACTCAGGATGG - Intergenic
1108462128 13:50677213-50677235 TTGTAGGGGCTGGGACAGGAGGG - Intronic
1109216726 13:59597886-59597908 TTGTATGGCCAGAGTAAGGAAGG - Intergenic
1109616221 13:64837251-64837273 CTGCAGGGGCAGAGCCATCATGG + Intergenic
1110531374 13:76602568-76602590 CTGTGGGAGCAGTGACAGGAAGG - Intergenic
1110646635 13:77893262-77893284 CTGGAAGGGCGGAGTCAGCAGGG - Intergenic
1111334570 13:86803112-86803134 CTGCAGGGGCAGAGCCTGCATGG - Intergenic
1111412629 13:87896238-87896260 CAGTGGGAGCAGAGTCAGGATGG - Intergenic
1111763841 13:92500633-92500655 CTGTAGGGGTTCACTCAGGATGG - Intronic
1112170784 13:96969802-96969824 CTGAAAGGGCAGACTGAGGAGGG + Intergenic
1112881328 13:104109588-104109610 CTGTAGTGGCAGAGCCATCATGG + Intergenic
1113791545 13:113031462-113031484 CTGTAGGGACAGAGTCTGGGAGG + Intronic
1113813999 13:113159227-113159249 CTGTGCAGGCAGAGTCAGAATGG - Exonic
1114638709 14:24204455-24204477 ATGTAGGGACTGAGGCAGGAGGG + Intronic
1115392354 14:32867157-32867179 GTGGAGGGGCAGAGCCAAGATGG - Intergenic
1116744936 14:48805783-48805805 CTGTAGGGGTTCAGTCAGGATGG - Intergenic
1117497237 14:56317924-56317946 CTTAAAGGGCAGAGCCAGGATGG + Intergenic
1118069618 14:62231922-62231944 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
1118843190 14:69527760-69527782 CTGTGGCGGCAGGGCCAGGAAGG - Intronic
1119031157 14:71193610-71193632 CCGTAGGGGTTCAGTCAGGATGG + Intergenic
1119173607 14:72553292-72553314 CTGCTGGCGCAGAGTCAGAATGG + Intronic
1119391980 14:74296903-74296925 CTCAGGGGGCAGAGGCAGGATGG + Intronic
1121037935 14:90722234-90722256 CGGGAGGGACAGAGCCAGGAGGG - Intronic
1121248524 14:92482650-92482672 GTGAAGGGGCAGAGTGAGAAAGG - Intronic
1121302940 14:92886330-92886352 CTGAAAGGGCTGAGCCAGGAAGG + Intergenic
1121440012 14:93942616-93942638 CTGTTGGGCTAGATTCAGGAAGG - Intronic
1122160542 14:99781227-99781249 CTGAGGGGGCGGTGTCAGGAGGG - Intronic
1122956302 14:105073131-105073153 TTGTAGGGGCAGAGGCGGCAGGG - Intergenic
1122969530 14:105146895-105146917 CTGTTGGGCCAGGGTCAGGCTGG - Intronic
1124608812 15:31193510-31193532 CTGGAAGGGCAGAGGCAGGAGGG + Intergenic
1125859729 15:42987187-42987209 CGGCAGGGGCAGAGCCGGGATGG + Intronic
1126533240 15:49733181-49733203 CTGCAGGGGCAGAGCCATCATGG - Intergenic
1126887006 15:53161773-53161795 CTGTAGGGTTCCAGTCAGGAAGG + Intergenic
1127263239 15:57341143-57341165 CTGGAGGTGCAGGGACAGGAAGG + Intergenic
1127618574 15:60711069-60711091 CTGCAGGGGCAGAGCAAGGCTGG - Intronic
1131332168 15:91511333-91511355 CTGTTGGGGCAGAGTTGGGGGGG + Intergenic
1131427043 15:92354280-92354302 CTGCAGGGGCAGAGTCTTCATGG + Intergenic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132546481 16:535637-535659 CTGGAGGGGCAGGGTGCGGAGGG - Intronic
1133816252 16:9199533-9199555 CTCCTGGGGCAGAGGCAGGAAGG - Intergenic
1134080268 16:11319989-11320011 CTGTGGGGGCAGTGCAAGGAGGG + Intronic
1134638648 16:15811601-15811623 CAGTAGAGGCAGAGAGAGGAAGG - Intronic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1135380376 16:21991341-21991363 CTCCAGGGGCTGAGGCAGGAGGG - Intronic
1136669485 16:31843265-31843287 TTGTAGGGGTTCAGTCAGGATGG - Intergenic
1138321211 16:56113630-56113652 CTGAAGAGGCAGAATCATGAAGG - Intergenic
1138347100 16:56326746-56326768 CTCCATGGGCAGAGGCAGGAGGG + Intronic
1139939667 16:70596157-70596179 CTGTAGCCTCAGAGGCAGGAGGG + Intronic
1139994918 16:70971507-70971529 CTGTAGGGGCAGAGTAAGGCTGG + Intronic
1141507289 16:84486267-84486289 CGGTGGGGGCAGGGGCAGGAAGG + Intronic
1141842651 16:86584049-86584071 CTGAGGGGGCAGAGGCAGGATGG - Intergenic
1142001725 16:87668151-87668173 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
1142177741 16:88652668-88652690 CTGTAGGGCCGGACACAGGAGGG + Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142345172 16:89549414-89549436 CTTTGGGGGCTGAGGCAGGAGGG + Intronic
1143504372 17:7355731-7355753 GTGGAGGGGTAGAGACAGGAGGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1143964664 17:10748623-10748645 CTATACAGGCAGAGGCAGGAAGG - Intergenic
1144508965 17:15858796-15858818 CTGTAAGGGGAAGGTCAGGAAGG - Intergenic
1144605175 17:16658423-16658445 CTGCAGGGGCAGAGTCCTCACGG - Intergenic
1144847766 17:18228930-18228952 CTGGATGGGCAGAGGCAGGCAGG + Intronic
1145173081 17:20676438-20676460 CTGTAAGGGGAAGGTCAGGAAGG - Intergenic
1145801398 17:27688221-27688243 CTGTATGGGAACAGTCAGGTTGG + Intergenic
1145870150 17:28267110-28267132 ATGTAGGGGCGGAGTCGGGGTGG - Intergenic
1145870249 17:28267726-28267748 AGGTAGGGGCAGAGTCGGGGTGG - Intergenic
1147970621 17:44217836-44217858 GTGTAGAGGAAGGGTCAGGAAGG - Intronic
1148810285 17:50285967-50285989 CTGTAGAGGCAGAGTCTGGAGGG - Intergenic
1149600242 17:57888823-57888845 CTGGAGGGGCAGAGAGATGATGG - Intronic
1150293062 17:63992969-63992991 TGGCAGGGGCAGAGTCAGGAGGG + Intergenic
1150445966 17:65227226-65227248 ATGTAGGGGCAGGGGCAGGAGGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1151799187 17:76367566-76367588 CTGGAGGGGTTCAGTCAGGATGG + Intronic
1152236819 17:79143261-79143283 CTGTAAGGACAGAGGCAGGGTGG - Intronic
1152409069 17:80112853-80112875 CTGGGAGGGCAGAGTCAGGCTGG - Intergenic
1153810881 18:8750533-8750555 CTGGAGGTGCAGAGGAAGGAAGG + Intronic
1153979594 18:10297669-10297691 CTGGAGGGGGAGAAGCAGGAAGG - Intergenic
1154513584 18:15136079-15136101 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
1156160295 18:34350944-34350966 CAGGAGGGGCAGAGGCAGCAGGG - Intergenic
1156243610 18:35276713-35276735 CTGCAGGGGCAGAGTCCTCATGG + Intronic
1156327548 18:36087759-36087781 CTGTTGGGGGAAGGTCAGGAAGG + Intergenic
1157425914 18:47584127-47584149 ATGTACAGGTAGAGTCAGGAAGG + Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159761287 18:72429969-72429991 CTGTAGGGGCAGGGTCCTCATGG - Intergenic
1160258246 18:77265609-77265631 CTGCAGGGGCAGAGTCCTTATGG - Intronic
1160565932 18:79786580-79786602 CTGCTGGGGCAGGGCCAGGACGG + Intergenic
1161000646 19:1909176-1909198 CTGTGGGGGCAGATGCAGGTGGG + Intronic
1161447660 19:4327490-4327512 CTGTGGGGGCGGAGCCAGTATGG - Intronic
1161727404 19:5937793-5937815 CTGTGGGGAGAGAGACAGGAGGG + Intronic
1161921366 19:7268540-7268562 ATGTAGGGGCAGAATCTTGAGGG - Intronic
1162873569 19:13603832-13603854 TTGTAGGGGCTGACTCAGGTGGG - Intronic
1163232860 19:16015865-16015887 CAGTTGGGGCTCAGTCAGGAGGG + Intergenic
1164377886 19:27705438-27705460 CTGTATGGGAATAGTCAGGTTGG + Intergenic
1165382671 19:35492175-35492197 GTGTGGGGGCAGCGTGAGGATGG - Intronic
1165431616 19:35776227-35776249 CTGTTGGGGTGGAGTAAGGAAGG - Intronic
1165829713 19:38724355-38724377 CCGTAGGGGCTGGGGCAGGACGG + Intronic
1167600482 19:50451678-50451700 CTGTAGGGTCTGAGGGAGGAGGG + Intronic
1168168875 19:54573538-54573560 CTGGAAGGGCAGACGCAGGAGGG + Intronic
1168277424 19:55285348-55285370 CCATAGGGGCAGAGGCTGGAGGG + Intronic
1168349334 19:55667146-55667168 CTGTGGGGGCAGCGTCATCATGG + Intronic
1168589061 19:57617754-57617776 CTGTAAGGGCAGACACAGCAGGG + Intronic
925669389 2:6294562-6294584 CTGTAGAGGCTGAGCCAGGCTGG - Intergenic
926095951 2:10080534-10080556 CTGTAGGGGGAGACCCGGGAGGG - Intronic
926990767 2:18677301-18677323 CTGGAGGGGCAAAGCCAGGTGGG + Intergenic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
927635913 2:24816659-24816681 CTGCAAGGGCCCAGTCAGGAGGG - Exonic
927841665 2:26448933-26448955 CCTGAGGAGCAGAGTCAGGATGG + Intronic
928189068 2:29144908-29144930 CTACAGGGGCTGAGGCAGGAGGG - Intronic
929028520 2:37628945-37628967 CTGTAGTGGCAGAGACTGTATGG + Intergenic
929554436 2:42916566-42916588 CTGGAGGGGCTGAGTAGGGAGGG + Intergenic
930060252 2:47282594-47282616 CTGTAGGAGTTCAGTCAGGATGG + Intergenic
930484852 2:51998977-51998999 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
931758204 2:65393220-65393242 ATGTAGGTGGAGAGTCAGGCTGG - Intronic
931940261 2:67244340-67244362 CTTTAGAGGCAGAGTCAACAGGG - Intergenic
932072787 2:68637403-68637425 TTCTCGGGACAGAGTCAGGAAGG - Intergenic
932448383 2:71794466-71794488 CTGCAGGGCCAGAGTGGGGAGGG + Intergenic
932915710 2:75855936-75855958 CTGTAGGGGCAGAGCCCACATGG + Intergenic
935141158 2:100354177-100354199 CAGTAGGGGCAAAATCATGATGG + Intergenic
935142263 2:100363862-100363884 CTGTATGGGAACAGTCAGGTTGG + Intergenic
935203843 2:100881176-100881198 CTGTTGGGGCCGAGGTAGGATGG - Intronic
938008125 2:127805574-127805596 TTGTGGTGACAGAGTCAGGAAGG + Intronic
938064267 2:128272593-128272615 CTGCAGGGGCAGTGTCTTGAGGG + Intronic
938415282 2:131099070-131099092 CTGAAGGGAGAGAGCCAGGAAGG - Intergenic
938513824 2:131980690-131980712 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
939752413 2:146063991-146064013 CTGTAGGGGCAGGGTCCTCATGG - Intergenic
943006539 2:182393106-182393128 CTGCAGGGGCAGAGTCCTTATGG - Intronic
944391683 2:199225498-199225520 TTGTAGGGGAACAGTCAGGGAGG - Intergenic
946721691 2:222615568-222615590 ATGTAGGAGCAGAGTAAGCATGG - Intronic
946874509 2:224114394-224114416 CTGTAGGGGCAGAGTCCTCATGG + Intergenic
947120327 2:226807633-226807655 CAGTGGGAGCAGAGTGAGGAAGG + Intergenic
947233857 2:227919910-227919932 CTGTAGGTGCAGAAGCAGAAAGG - Intronic
948148962 2:235729491-235729513 CTGTAGGGGCAGTCTCACGGCGG + Intronic
948216143 2:236234312-236234334 CTGAAGGGGCTGAAGCAGGAAGG - Intronic
948456425 2:238106589-238106611 CTGGAGGGGCAAAGGGAGGATGG - Intronic
948477141 2:238227486-238227508 AGGTGGGGACAGAGTCAGGAGGG - Intronic
948747164 2:240105390-240105412 ATGTTGGGGCTGGGTCAGGAGGG + Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169952768 20:11064352-11064374 CTGTAGGACCTGAGTCAGGGAGG - Intergenic
1170941657 20:20853299-20853321 CTGTAGGGGCAGAGCCCTCATGG - Intergenic
1171204630 20:23269284-23269306 CTGTAGGGGATCAGTCAGGGTGG - Intergenic
1171288799 20:23967714-23967736 TTGTAGGGGCAGAGACAGGCGGG + Intergenic
1173648056 20:44645999-44646021 CTGTGGGCGCAGAGTGAGGTTGG - Intronic
1174000020 20:47367760-47367782 CTCTAGAGGCTGAGGCAGGAAGG + Intergenic
1175381800 20:58568795-58568817 TTGTGGGGGCTGAGACAGGATGG + Intergenic
1175752484 20:61508907-61508929 CTGTGGAGGCAGAGTGGGGAGGG - Intronic
1176785940 21:13255851-13255873 GTGTAGGGGTTCAGTCAGGATGG - Intergenic
1176901611 21:14449053-14449075 CAGTAGGGGCAGAGTGAGGAGGG - Intergenic
1177977611 21:27871231-27871253 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1178827397 21:36028337-36028359 CTCTGTGGGCAGAGCCAGGATGG + Intergenic
1179271944 21:39858350-39858372 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
1179629053 21:42665579-42665601 CTGTAGGAGCAGAGCAAGGTCGG - Intronic
1179727460 21:43348409-43348431 CTGATGTGGCAGAGGCAGGAAGG - Intergenic
1179936425 21:44608038-44608060 TTCCTGGGGCAGAGTCAGGAGGG + Intronic
1180012193 21:45058566-45058588 CAGTGGGGGCAGAGTGGGGAGGG + Intergenic
1180128609 21:45809629-45809651 CTGTAGTGGCAGCGGCAGGGGGG - Intronic
1180147000 21:45927309-45927331 ATGTAGGGGGAGAGGGAGGAAGG - Intronic
1180245818 21:46546614-46546636 CTGCTGGGGCAGCGTCAGCATGG - Intronic
1180245833 21:46546681-46546703 CTGGTGGGGCAGCATCAGGAAGG - Intronic
1180836339 22:18931459-18931481 CTGAAGGGGCAGAGTCCAGGTGG - Intronic
1180926120 22:19556165-19556187 CTGCAGGGCCAGAGGCAAGATGG - Intergenic
1182299513 22:29329839-29329861 CAGGAGGGGCAGTGTCTGGAGGG + Intronic
1182325673 22:29510995-29511017 CTGCAGGGGAAGTTTCAGGAAGG + Intronic
1182890753 22:33816952-33816974 CTGTAGGGGCAGATTGTGGTGGG - Intronic
1183249893 22:36723000-36723022 CTGCAGGGGCAGAGGCATGGAGG - Intergenic
1183317788 22:37146381-37146403 CTGTGAGGGCAGGGTCTGGAAGG - Intronic
1183751138 22:39721268-39721290 CTGTTGGTGCAGAGCCAAGAGGG + Intergenic
1183928308 22:41221486-41221508 CAGTAGGAGCAGAGTCTGGGTGG - Intronic
1184383359 22:44160350-44160372 CAGCAAGGGCAGAGCCAGGAGGG + Intronic
1184515315 22:44958261-44958283 GTGTAGGGAGAGAGTCAGGGAGG - Intronic
1184896218 22:47408444-47408466 CTGGAGGGACAGTGACAGGAGGG + Intergenic
1185096733 22:48811017-48811039 CTCTAGAGGCTGAGGCAGGAGGG + Intronic
1203286431 22_KI270734v1_random:156758-156780 CTGAAGGGGCAGAGTCCAGGTGG - Intergenic
949147885 3:725565-725587 CTGCAAGGGCAGAGTGAAGAGGG - Intergenic
949518351 3:4827179-4827201 CTGTCGGGGCAGGAGCAGGAGGG - Intronic
950108176 3:10401502-10401524 CTTTTAGGGCAGAGTGAGGAGGG + Intronic
950412222 3:12846433-12846455 CTGTAGGGGCAGAGCCCTCATGG + Intronic
950478262 3:13227706-13227728 CTGGAGGGGCAGATTCCGAAGGG + Intergenic
950604373 3:14065045-14065067 CTTTGGGTGCAGAGCCAGGAGGG + Exonic
951580100 3:24153610-24153632 CTGAAGGAGCAAAGACAGGAGGG - Intronic
952105526 3:30065495-30065517 CTGTAGGGGCAGGGTCCTCATGG - Intergenic
953094971 3:39766306-39766328 CTTTAGGGGCAGAGTCCTCATGG - Intergenic
954647137 3:52138402-52138424 CTGATGGGGCTGGGTCAGGATGG + Intronic
955317597 3:57951799-57951821 CTGGAGGGGCAGAGGCAGCCTGG - Intergenic
955594261 3:60571614-60571636 CTCTAAGTGTAGAGTCAGGAGGG + Intronic
956256130 3:67284981-67285003 CTCTAGGGACAGAGTCAGGCTGG + Intergenic
956938582 3:74131813-74131835 CTGTAGGGGCAGTGTCCTAATGG - Intergenic
957353992 3:79058578-79058600 CTGTATGGGAACAGTCAGGTTGG - Intronic
958754535 3:98234810-98234832 CTGTAGGGGCAGAGCCCTCATGG + Intergenic
961052016 3:123755061-123755083 CTGTATGAGCAGAGTCCTGAGGG - Intronic
961319712 3:126064220-126064242 CCACAGGAGCAGAGTCAGGAGGG - Intronic
961481402 3:127183203-127183225 CTCTAGGGGAGGAGTCAGCATGG + Intergenic
961786440 3:129349946-129349968 CTGGAGGGGCAGATTCCGAAGGG - Intergenic
961811235 3:129523100-129523122 CTGCAGGGGGAGAATCAGGGAGG - Intergenic
961922768 3:130445470-130445492 CTGTATGGGAACAGTCAGGTTGG + Intronic
962374807 3:134850882-134850904 CTGTTGGTGCAGAGCCAGGGGGG + Intronic
964974877 3:162606313-162606335 CTGCAGGGGCAGAGCCATCATGG + Intergenic
967214480 3:187198931-187198953 CTGTGGGGGCTGAGTGGGGAGGG + Intronic
967627596 3:191703763-191703785 CTGGAGGGGCAGTGACAGGTTGG - Intergenic
968817963 4:2831548-2831570 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
968971571 4:3798329-3798351 CTGGTGGGGCAGAGTCAGGGTGG + Intergenic
969008823 4:4044105-4044127 CTGTATGGGAACAGTCAGGTTGG + Intergenic
969181699 4:5446837-5446859 CTGGACGGGCAGAGTCGGCAGGG + Intronic
969523851 4:7694129-7694151 CTGCAGGGGCAGAGGAAGGATGG + Intronic
970742320 4:19252322-19252344 CTGTTGGCACAGAGTCAGGAGGG - Intergenic
971557831 4:28036703-28036725 CTGTAGGGGCAGAGCCCTCATGG - Intergenic
972209827 4:36823602-36823624 GTGTAGGGGCAAAGCCAGGCGGG - Intergenic
972278955 4:37585137-37585159 GTGGAGGGGGAGGGTCAGGAGGG + Intronic
972460125 4:39293989-39294011 CAGTAGTGTCAGAGTCAGAAAGG - Intronic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
972988199 4:44791753-44791775 ATGTAGGGGTTCAGTCAGGATGG + Intergenic
975363899 4:73505449-73505471 CTGAAGGTGCAGAGTGAGAAAGG + Intergenic
975954974 4:79826372-79826394 CTGTATGGGAATAGTCAGGTTGG + Intergenic
976445418 4:85125629-85125651 ATGTAGGGGTTCAGTCAGGATGG - Intergenic
976445855 4:85129211-85129233 GTGTAGGGGTTCAGTCAGGATGG - Intergenic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
978721745 4:111918015-111918037 ATGCAGTGGCAGAGCCAGGAAGG - Intergenic
979241263 4:118448950-118448972 CTGTAGGGGAAATGACAGGAAGG - Intergenic
979568409 4:122183818-122183840 CTGTAGGGGGACAGTGAGGTTGG - Intronic
980065763 4:128187063-128187085 CTGTAGGGGCAGAGCCCTCATGG + Intronic
980457908 4:133069315-133069337 CTGGAGGGGCAGAGCTAGGTTGG + Intergenic
980586023 4:134817093-134817115 CTGCAGGGGCAGAGTCTTCATGG - Intergenic
980628441 4:135405859-135405881 CTGTAGGGGTTCAGTCAGGATGG + Intergenic
982258271 4:153470903-153470925 CTGCAGGGCAGGAGTCAGGAAGG - Intronic
982478349 4:155879053-155879075 CTGCAGGGGCAGAGTCCTCATGG - Intronic
983340512 4:166454862-166454884 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
983785926 4:171729354-171729376 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
984078884 4:175217076-175217098 TTGTAGGGGTTCAGTCAGGATGG - Intergenic
984616425 4:181903768-181903790 CAGTAGGGGTAGAACCAGGAGGG - Intergenic
985996623 5:3600575-3600597 CGGAAGAGGCAGAGTTAGGACGG - Intronic
986088934 5:4482593-4482615 ATGGAGGGGAACAGTCAGGAAGG + Intergenic
986167574 5:5288843-5288865 CTGGAGTGGCAGGATCAGGAAGG - Intronic
986727275 5:10608389-10608411 CTGAAGGGGAAGAGCAAGGAAGG + Intronic
987379097 5:17267379-17267401 CTGTAAGGAATGAGTCAGGATGG - Intronic
987435266 5:17885812-17885834 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
989027699 5:37086385-37086407 CTGCAGGGGTTCAGTCAGGATGG + Intergenic
989096060 5:37782259-37782281 CAGTATGAGGAGAGTCAGGAGGG + Intergenic
991085944 5:62648433-62648455 CTGAAGGGGCTGTGGCAGGAAGG - Intergenic
991340304 5:65601664-65601686 CTGTAAGGGCAGGGTTTGGAGGG - Intronic
991359357 5:65803378-65803400 CAGTAGGGGCTGAGGCAGCAAGG + Intronic
991441842 5:66658912-66658934 CTTGAGAGGCAGAGGCAGGAGGG + Intronic
992143301 5:73820609-73820631 CTGTAGGGTAAGAGCCAGGGTGG - Intronic
993442957 5:87978814-87978836 CTGAAGGGGCAGAGTCCTTATGG + Intergenic
994051763 5:95369989-95370011 CTGAAGGGGAGGAGTCAGGAAGG - Intergenic
994552798 5:101258815-101258837 CTGTAGGGGCAGAGCCCTTAAGG + Intergenic
995008358 5:107229214-107229236 ATGCAGGGACAGAGACAGGAGGG - Intergenic
995206100 5:109483155-109483177 CTGTAGGGGATCAGTCAGGGTGG - Intergenic
995617043 5:113976459-113976481 CTGTTAGAGCAGAGCCAGGATGG + Intergenic
995850907 5:116545004-116545026 GTGTTGGGGAAGAGTCAGGATGG - Intronic
996126149 5:119727676-119727698 CTGCAGGGGCAGAGTCCTAATGG + Intergenic
996774732 5:127121115-127121137 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
997091554 5:130864497-130864519 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
997102064 5:130980463-130980485 CTGCAGGGGCAGAGTCCTCATGG - Intergenic
997108227 5:131045843-131045865 CTGCAGGGGCAGGGTCATCATGG - Intergenic
997745758 5:136298778-136298800 TTGAAGGGGCAGAAGCAGGATGG - Intronic
997979743 5:138461552-138461574 CTGTAGTGATTGAGTCAGGATGG - Intergenic
998400533 5:141846509-141846531 CTGTAATGGCAGATTCTGGAGGG + Intergenic
998464769 5:142334725-142334747 CTGAAGGGGCAGTGTGGGGATGG - Intergenic
999193080 5:149763148-149763170 CTGCAGGGCCAGAGTGGGGAGGG - Intronic
999194820 5:149774736-149774758 GTATAGGGCCAGAGGCAGGAGGG - Intronic
999334700 5:150705514-150705536 ATGAAGGGCCAGAGACAGGAAGG + Intergenic
999380358 5:151117164-151117186 CTGCAGGGGCATCGTGAGGAGGG - Exonic
999459670 5:151747129-151747151 CTCTAGGGGCAGGATCAGTAGGG - Intronic
999520787 5:152348786-152348808 ATAGAGGGGCAGGGTCAGGATGG + Intergenic
999829337 5:155303953-155303975 CTGTGGGGGCAGTGTTGGGAGGG + Intergenic
999831751 5:155326763-155326785 CTGTTGGGGGAGGGTGAGGAGGG + Intergenic
1000155049 5:158542048-158542070 CTGTTTTGGCAGATTCAGGAAGG + Intergenic
1002318977 5:178363989-178364011 CTGATGGGGAACAGTCAGGAGGG - Intronic
1004069782 6:12288053-12288075 CTGCAGGGGCAGCCTCAGCAAGG + Intergenic
1004588860 6:17029590-17029612 GTGAAGGTGCAGAGTCAGTAAGG - Intergenic
1004772064 6:18795449-18795471 GTGTGGGGGCAGGGTGAGGAAGG - Intergenic
1007381697 6:41494288-41494310 CAGTAGGGGCAGACTCAGGAAGG + Intergenic
1007523777 6:42473259-42473281 AAGTAGGGGCAGAGGTAGGAGGG - Intergenic
1008705775 6:54157353-54157375 CTGCAGGAGCAGAGTGAAGAGGG - Intronic
1008793349 6:55267849-55267871 TTGCAGGGGCAGAATCAGGAAGG + Intronic
1009945910 6:70341574-70341596 CTGTAGAGGCAGAGTCCTCAAGG - Intergenic
1010280777 6:74020336-74020358 CTGTAGGGGTTCAGTTAGGATGG - Intergenic
1010492081 6:76488818-76488840 CTGTATGGGAACAGTCAGGTTGG + Intergenic
1011110637 6:83833753-83833775 CTGTAGGGGCAGGGTCCTCAGGG + Intergenic
1011152510 6:84289991-84290013 CTGTAGGGGCAGGGTCCTCAGGG - Intergenic
1011461942 6:87614068-87614090 CTGTAGGGGCAGGGTCCTCATGG - Intronic
1013440349 6:110158548-110158570 CTTTAGGGGAAGAGCCAAGATGG - Intronic
1015765284 6:136709822-136709844 CTCAAGAGGCAGAGGCAGGAGGG + Intronic
1017375132 6:153760141-153760163 CTGTGGGGGTAGTGTCAGGTGGG - Intergenic
1018377841 6:163230766-163230788 CTGTAGGTGCAGAGTTAGGGAGG + Intronic
1018581639 6:165313008-165313030 GGGCAGGGGCAGAGTCCGGAGGG + Intergenic
1018755032 6:166841645-166841667 CTGCAGAGGCTGAGTCAGAAAGG + Intronic
1018854607 6:167666592-167666614 CGAAAGGGGCAGCGTCAGGAGGG - Intergenic
1019987449 7:4668134-4668156 CTTGAGGGGCAGACTCTGGAAGG - Intergenic
1022192483 7:28030131-28030153 CTGTAGGGGCTGGCGCAGGATGG + Intronic
1022595800 7:31712561-31712583 CAGTAGAGGCAGAGACAGCAGGG + Intergenic
1023397197 7:39762281-39762303 ATGTAGGGGATCAGTCAGGATGG - Intergenic
1023909023 7:44540936-44540958 CAGTAGGGCCAGTGACAGGAGGG + Intronic
1024337061 7:48219757-48219779 CTGTGGAGACAAAGTCAGGATGG - Intronic
1024553349 7:50582033-50582055 CTGTATGGGAACAGTCAGGTTGG - Intergenic
1024804206 7:53117612-53117634 CTGATGGGGTGGAGTCAGGAAGG + Intergenic
1024934891 7:54702074-54702096 CTGTAGAGGCAGAGACAGGCGGG + Intergenic
1027348712 7:77288506-77288528 GTGTAGGGGTAGACTGAGGAAGG - Intronic
1029572500 7:101379481-101379503 CTGGAGGGTGAGAGGCAGGAAGG - Intronic
1029599935 7:101557681-101557703 CTCCAGGGGCAGGGTCTGGAGGG + Exonic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030246098 7:107386033-107386055 CTGTTAGGGTTGAGTCAGGATGG + Intronic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1033544322 7:142386165-142386187 TGGTAGGGTCAGAGTGAGGAGGG - Intergenic
1033664915 7:143431296-143431318 CTGTAAAGGCAGACCCAGGATGG - Intergenic
1034422223 7:150996031-150996053 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034422249 7:150996097-150996119 GGGTAGGGGCAGAGGGAGGAGGG - Intronic
1034427692 7:151023300-151023322 CAGCAGGGGCAGGGTCAGGGAGG - Intronic
1034542081 7:151764733-151764755 AGGTGGGGGCAGTGTCAGGATGG + Intronic
1035200410 7:157260482-157260504 GTGTGGTGGCAGAGTCTGGAGGG + Intronic
1035567970 8:654387-654409 CTGGAGGGGCAGAGCTGGGACGG + Intronic
1036250092 8:7154766-7154788 CTGTATGGGAACAGTCAGGTTGG + Intergenic
1036367396 8:8132674-8132696 CTGTATGGGAACAGTCAGGTTGG - Intergenic
1036739509 8:11347874-11347896 CCGTGGTCGCAGAGTCAGGAGGG + Intergenic
1036883486 8:12532988-12533010 CTGTATGGGAACAGTCAGGTTGG + Intergenic
1037455894 8:19063736-19063758 CTGAAGGTGCATAGTCAGAAAGG + Intronic
1037652626 8:20852815-20852837 CTGAAAGGGGAGAGTCAGGCAGG - Intergenic
1039811779 8:41055320-41055342 CTGAAAGAGCAGGGTCAGGAGGG + Intergenic
1039826705 8:41180476-41180498 GTGTTTGGGCAGAGTGAGGATGG - Intergenic
1043573625 8:81631863-81631885 ATGTGGGGCCAGAGACAGGAAGG - Intergenic
1044142440 8:88672354-88672376 CTGTATGGGAACAGTCAGGTTGG + Intergenic
1044184602 8:89236505-89236527 CAGTCTGGGGAGAGTCAGGAGGG + Intergenic
1044860539 8:96519037-96519059 CTGTAGTGGGAGTGTCTGGATGG - Intronic
1045553095 8:103190142-103190164 CAGAAATGGCAGAGTCAGGAAGG + Intronic
1046805840 8:118478058-118478080 CTAGAGGTGCAGAGTCAGGCAGG - Intronic
1046814783 8:118571799-118571821 CTGTAGGGGCAGGGTCCTCATGG + Intronic
1047149170 8:122241375-122241397 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
1047660011 8:127023215-127023237 CTGTATGGGCTGCCTCAGGAAGG + Intergenic
1048287118 8:133150517-133150539 CTGTTGGGGAAGAGTCATGGTGG - Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049290668 8:141799989-141800011 CTCTAGGGCCAGAGCCAGGGAGG + Intergenic
1049397800 8:142409671-142409693 CTGCAGAGGCAGGGCCAGGAGGG - Intergenic
1049511194 8:143027353-143027375 CTGAAGGGGCAGCGCCAGGGGGG + Intergenic
1051175169 9:14353177-14353199 CTGTAGGGGCAGACAGAGGGTGG + Intronic
1057155394 9:92833731-92833753 CTGTAGGGGTTTAGTCAGGATGG + Intergenic
1057340638 9:94198318-94198340 GTGTAGGGGCAAAGCCAGGTAGG + Intergenic
1058632958 9:107008150-107008172 CAGTTGGGGAGGAGTCAGGAAGG + Intronic
1059457787 9:114410674-114410696 CTTCAGGGGCATAGTCAGGCAGG + Intronic
1060060352 9:120454220-120454242 CTGGCGGGGTAGAGTCAGGGAGG - Intronic
1060217301 9:121746078-121746100 CTGTGGGGGGAGAGTCAGGAAGG + Intronic
1060551146 9:124486004-124486026 CAGTAGGGGCAGGGGCGGGAGGG + Intronic
1061144818 9:128791452-128791474 GTGTAAGGGCAGTGACAGGAGGG + Intronic
1061387488 9:130299115-130299137 CTTCGTGGGCAGAGTCAGGAGGG - Intronic
1061524703 9:131149777-131149799 GGGCAGGGGTAGAGTCAGGAAGG - Intronic
1062112436 9:134789411-134789433 AGGAAGGGGCAGAGGCAGGAAGG + Intronic
1062396853 9:136356056-136356078 CTGCAGGGGCAGTCTCAGGGAGG + Intronic
1062686170 9:137814598-137814620 CTGTCGTGGCAGCGTCGGGAAGG + Intronic
1185663538 X:1745988-1746010 CTGTAGGAGCAGAGACATGTCGG + Intergenic
1188823411 X:34801454-34801476 CTGTATGGGAACAGTCAGGTTGG - Intergenic
1188900600 X:35728428-35728450 GTGTAGGGGTTCAGTCAGGATGG + Intergenic
1189509384 X:41646691-41646713 CTGTATGGGAATAGTCAGGTTGG - Intronic
1189652777 X:43208228-43208250 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1190451125 X:50581855-50581877 GTGTAGGGGTTCAGTCAGGATGG - Intergenic
1190514319 X:51207118-51207140 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
1192040737 X:67618681-67618703 ATCTAGGGATAGAGTCAGGAAGG + Intronic
1192592429 X:72371432-72371454 TTGGATGGGCAGAGCCAGGAAGG + Intronic
1193277034 X:79601811-79601833 CTGTAGGGGTTCAGTCAGGATGG - Intergenic
1193332958 X:80256166-80256188 CTGTAGGGGCAGAGCCCTCAGGG + Intergenic
1193449199 X:81645414-81645436 CTGTAGGGGCAGGGTCCTCATGG + Intergenic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1194084583 X:89510068-89510090 CTGCAGGGGCAGAGTCCTAATGG - Intergenic
1194486209 X:94490327-94490349 TTGTAGGGGTTCAGTCAGGATGG + Intergenic
1197415378 X:126166435-126166457 CTGCAGGGGCAGAGTCGCGGAGG + Intergenic
1197473401 X:126890858-126890880 CTGCAGGGGCAGAGTCCTCAAGG - Intergenic
1198119969 X:133582778-133582800 CTGTGTGGGCAGAATCAGAAGGG + Intronic
1198267441 X:135022409-135022431 CCGGAGGGGCCGAGCCAGGAGGG + Exonic
1198775291 X:140172879-140172901 CTGCAGGGGCAGAGTCCTCATGG + Intergenic
1198859275 X:141052144-141052166 ATGTAAGGGTAGATTCAGGAAGG - Intergenic
1198903419 X:141535248-141535270 ATGTAAGGGTAGATTCAGGAAGG + Intergenic
1198916322 X:141676610-141676632 ATGTAAGGGTAGATTCAGGAAGG + Intronic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199424022 X:147680435-147680457 CTGCAGGAGCAGAGTAGGGAGGG + Intergenic
1200976423 Y:9216495-9216517 TTGTAGGGGTTCAGTCAGGATGG - Intergenic
1201853955 Y:18520327-18520349 CTGTGGGGGTTCAGTCAGGATGG - Intergenic
1201879366 Y:18800057-18800079 CTGTGGGGGTTCAGTCAGGATGG + Intronic
1202134745 Y:21650036-21650058 TTGTAGGGGTTCAGTCAGGATGG + Intergenic
1202388979 Y:24350775-24350797 CTGTAGGGGAAATGACAGGAAGG - Intergenic
1202481808 Y:25319349-25319371 CTGTAGGGGAAATGACAGGAAGG + Intergenic