ID: 1095954809

View in Genome Browser
Species Human (GRCh38)
Location 12:47799874-47799896
Sequence CTGGAGAAGGGGAAGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 871
Summary {0: 1, 1: 0, 2: 10, 3: 87, 4: 773}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095954797_1095954809 26 Left 1095954797 12:47799825-47799847 CCAGAGAGGCTGAGACACTGGGA 0: 1
1: 0
2: 3
3: 50
4: 620
Right 1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG 0: 1
1: 0
2: 10
3: 87
4: 773

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095954809 Original CRISPR CTGGAGAAGGGGAAGTGGGT GGG Intronic
900650868 1:3729585-3729607 CTGGAGGAGGAGATGTGGGGTGG - Intronic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
900887212 1:5423548-5423570 CTGGAGAAGGTGAAGTGAAAAGG + Intergenic
901193094 1:7424304-7424326 GTAGAGCAGAGGAAGTGGGTTGG - Intronic
901628613 1:10637589-10637611 CTGGAGTAGGGAAGGTGGGCAGG + Exonic
901651723 1:10746927-10746949 CTAGAGAAGGGGCAGGGAGTGGG - Intronic
901763834 1:11487741-11487763 CTGCAGAATGGGATGAGGGTGGG - Intronic
901789635 1:11647565-11647587 CTGGGGGAGGGGAGGTGGGGAGG - Intergenic
901811106 1:11767103-11767125 CTGGAGGTGGGGTAGGGGGTAGG + Intronic
901840251 1:11949800-11949822 GTGGAGAAGGGGACGTCGGCAGG + Exonic
902300982 1:15502581-15502603 CTGGGGAAGGTGAAGTGGCAGGG + Intronic
903337793 1:22636576-22636598 CTGAAGAAGGGGAAGTAGGAAGG + Exonic
903691045 1:25173870-25173892 CTGGGGATGGGGAATTGGTTGGG - Intergenic
903886322 1:26543041-26543063 CTGCAGAGGGGGAAGTGAGAAGG + Intronic
903990023 1:27260779-27260801 CTGGAATGGGTGAAGTGGGTGGG - Intronic
904425324 1:30419125-30419147 CTGGAAAAGGAGCAGTGAGTAGG + Intergenic
904911475 1:33937454-33937476 ATGGGGAAGTGGAAGTGGGCAGG + Intronic
905293101 1:36936585-36936607 CTGGAGAATGGGAATGGGGTGGG - Intronic
905302087 1:36992314-36992336 CTGGAGAGGGAGGTGTGGGTGGG + Intronic
905616946 1:39408283-39408305 CTTGAGAAGGGGGAGAGGGAAGG + Intronic
905862054 1:41358347-41358369 CTGGAGGAGGGGAAGTGACAGGG + Intergenic
906276133 1:44517335-44517357 CTGGAGAGAGGGAACTGGGCAGG - Intronic
906477933 1:46182333-46182355 ATGGAGAAGGAGCAGTGGGAGGG + Intronic
906515089 1:46434055-46434077 CAGTACTAGGGGAAGTGGGTAGG + Intergenic
906676640 1:47698134-47698156 CTGGAGAGGAGGAAGTGGGGAGG + Intergenic
906680178 1:47720959-47720981 CTTGGGAAGGAGAGGTGGGTTGG + Intergenic
908207945 1:61870229-61870251 AAGGAGATGGGGAGGTGGGTAGG + Intronic
908479028 1:64518765-64518787 CTTGAGAAGGGAAAGAGGATGGG + Intronic
908488614 1:64620093-64620115 TTAGAGAAGGAGAAGTGGGCTGG + Intronic
909514928 1:76496617-76496639 GTGGCAAAGTGGAAGTGGGTGGG - Intronic
910178453 1:84455981-84456003 CTTGGGAAGGGGAAATGGATGGG + Intergenic
910368430 1:86490287-86490309 CTGGGTAAGGGGATGTGCGTGGG + Intronic
910503026 1:87916465-87916487 ATGGAGAATAGGAATTGGGTAGG - Intergenic
910645514 1:89510094-89510116 GTGGGGTAGGGGAAGTGGGGCGG - Intergenic
910790357 1:91044011-91044033 CTGGAGAAGAGAAGGTGGGGTGG - Intergenic
910975185 1:92898868-92898890 CTCGGGAAGGTGAAGTGGGAGGG - Intronic
911180880 1:94859284-94859306 CTGGAGAAAGGGAAGAGATTAGG - Intronic
911650513 1:100382786-100382808 GGGTAAAAGGGGAAGTGGGTGGG + Intronic
912430037 1:109624149-109624171 CTGGACAAAGGGAAGAGGGAGGG - Intronic
912563270 1:110565568-110565590 CTGGGGAAGGGGATGTGGGGTGG + Intergenic
912935926 1:114003571-114003593 TTGGGGTAGGGGAAGTGGGAGGG - Intergenic
913368278 1:118067451-118067473 ATGGAGAAGGGAAAGAGGGAGGG - Intronic
913459567 1:119069924-119069946 CTGGAGAAGGGTATGTAGGCAGG + Intronic
914442852 1:147722310-147722332 GTGGAGAAGGTGATGGGGGTGGG + Intergenic
914912465 1:151798959-151798981 CTAAAGAAGGGGAAGTTGCTGGG + Intergenic
914995061 1:152536227-152536249 CTGGAGGAGAGGAAGTTGCTGGG + Intronic
915561833 1:156692330-156692352 CTCAGGAAGGGGAAGTGGGGGGG + Intergenic
915596681 1:156900313-156900335 CAGGAGAAGGGGATGGGGGTGGG - Intronic
915891216 1:159775639-159775661 CTGGAGATGGGGAGGGAGGTGGG - Intergenic
915945128 1:160144171-160144193 CTGGAGATGGAGGGGTGGGTGGG + Intergenic
915971574 1:160358751-160358773 CTGGAGAAAGGACAGTGGGAAGG - Exonic
916056010 1:161069408-161069430 CTGGGGAAGGGGCAGTGGCCTGG - Intronic
916682569 1:167117680-167117702 CTGGGGCAGGGTAAGTGGCTAGG - Intronic
917013994 1:170508771-170508793 GGGGAGAAGGGTAAGGGGGTGGG - Intergenic
917667078 1:177235537-177235559 CGGGAGATGGGGAAGTGAGGAGG + Intronic
917805235 1:178607179-178607201 CTGTAGAAGGTGATGTTGGTTGG - Intergenic
918131719 1:181635267-181635289 CTAGAGAAGGGGTTGTGGGAGGG + Intronic
919357665 1:196545716-196545738 CTGGAGCTGGGGGGGTGGGTGGG - Intronic
919375513 1:196788935-196788957 AAGGAAAAGGGTAAGTGGGTGGG + Intronic
919567723 1:199209602-199209624 GGGGAGCAGGGGAAGTGGGAGGG + Intergenic
920129481 1:203720738-203720760 CAGGTGAAGGGGGTGTGGGTGGG + Exonic
920188135 1:204175005-204175027 TTTCAGAAGGGGAAGAGGGTTGG + Intergenic
920202865 1:204270820-204270842 CTGGTGAAGGGGCAGAAGGTGGG - Intronic
920228526 1:204455310-204455332 AGAGAGAAGGGGAAGGGGGTTGG + Intronic
920294650 1:204948486-204948508 CTGGAGAAGGGTGAGTGAGAGGG - Intronic
920347038 1:205313061-205313083 CTGGGGGAGGGGAAATGGGGAGG + Intronic
920437034 1:205953675-205953697 CTGGTGAAGGGGGTGGGGGTGGG + Intergenic
920624631 1:207585081-207585103 CTGGTGGAGTGGAAGAGGGTGGG + Intronic
920733531 1:208510975-208510997 TTTGAAAAGGGGAGGTGGGTTGG + Intergenic
921023849 1:211259766-211259788 CTGGGGGAGGGGAAGAGGGAGGG - Intronic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
922157821 1:223053663-223053685 CTGGAGCAGGGGCAGGGGTTTGG + Intergenic
922310040 1:224380141-224380163 GTGGAGAAGAGTGAGTGGGTGGG + Intergenic
922625826 1:227041293-227041315 CTAGAGAAGGGGAAGGAGGGAGG - Intronic
922696373 1:227733080-227733102 CTGGCGCAGGAGATGTGGGTTGG - Intronic
923036824 1:230290329-230290351 CTGGAGAAGCGGTAGTGGGTAGG + Intergenic
923334015 1:232951250-232951272 ATGGAGATGGGGATGGGGGTGGG - Intronic
923785087 1:237058787-237058809 CTGGAGAAGGGGCGGGGGGCCGG + Intronic
923806258 1:237261408-237261430 CTAGGCTAGGGGAAGTGGGTGGG - Intronic
924489151 1:244518089-244518111 AAGGAGAAGGGGAATTGAGTTGG - Intronic
1063107801 10:3008794-3008816 CTCGAGAAGGGGAAATGTGCTGG - Intergenic
1063197370 10:3756106-3756128 TTGGAAAGGGGGATGTGGGTGGG + Intergenic
1064234969 10:13565365-13565387 CAGGAGCAGGGGATGGGGGTGGG - Intergenic
1064330531 10:14389924-14389946 CTGAAGAAGTGGTAGTTGGTAGG - Intronic
1064423486 10:15210264-15210286 TTGCAGAAGGGCAACTGGGTCGG - Intergenic
1067272689 10:44805650-44805672 ATGGAGGAGGGGAGGTGGGGAGG + Intergenic
1067574260 10:47398379-47398401 TTGCAGAAATGGAAGTGGGTAGG - Intergenic
1069513234 10:69057457-69057479 CTGGAGAGGAGGAAGTGGGCTGG + Intergenic
1069583545 10:69581420-69581442 CTGGAGTGTGGGCAGTGGGTAGG - Intergenic
1069853154 10:71423578-71423600 CTGGAGAATGGGATGAGGGGAGG + Intronic
1070025231 10:72625942-72625964 AAGGCGAAGGGGAAGGGGGTTGG - Intronic
1072578351 10:96720137-96720159 CTGAAGAAGTGGGAGGGGGTCGG + Intronic
1072618719 10:97066321-97066343 CCAGAGAAGGGGAGGTGGCTGGG - Intronic
1072625461 10:97108211-97108233 GTGCAGCAGGGGAGGTGGGTAGG + Intronic
1072641850 10:97216986-97217008 CTGGAAAAAGGGAAGTACGTGGG + Intronic
1072848475 10:98859623-98859645 CTGGAAAGGGAGAAGAGGGTTGG - Intronic
1073043305 10:100621774-100621796 GCGGAGGAGGGGAAGGGGGTGGG + Intergenic
1073485852 10:103818799-103818821 CTGGAGAAGGGGTGGAGGGTGGG - Intronic
1073592141 10:104767654-104767676 GTGGAGAAGGGGAAGGGGAACGG - Intronic
1073898192 10:108187045-108187067 CTGGAGCAGGGGAAAAGGGGAGG - Intergenic
1074614745 10:115056395-115056417 GTGGAGGAGAGGAAGTGGGAGGG - Intergenic
1074700553 10:116088364-116088386 CTGGAGAAGGGGATGTTTGGTGG - Intronic
1074714997 10:116210240-116210262 CTGGAGAATGGGGAGAGGGGAGG - Intronic
1075553236 10:123409575-123409597 CTGGAGTTGGGGAGGGGGGTTGG - Intergenic
1075945360 10:126428282-126428304 CTGGGGTAGGGAAAGTGGGCTGG + Intronic
1076097108 10:127740497-127740519 CTGGAGATGGAGACGTTGGTGGG + Exonic
1076215957 10:128693584-128693606 CCGGGGCAGGGGAAGTGGCTGGG - Intergenic
1076312260 10:129517057-129517079 CTGGAGAAGCTGGAGTGGGAGGG - Intronic
1076437917 10:130459306-130459328 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076437924 10:130459336-130459358 CAGGAGAAGGTGAAGAGGGAGGG + Intergenic
1076578174 10:131485597-131485619 ATGTGGAAGGGGAAATGGGTAGG + Intergenic
1076804180 10:132846978-132847000 CTGGAGATGGTGGAGTGTGTCGG - Exonic
1077174236 11:1181426-1181448 GTGGAGAAGGAGAAGGTGGTTGG - Intronic
1077249841 11:1556069-1556091 AGGGAGCAGGGGAGGTGGGTGGG + Exonic
1077847925 11:6045686-6045708 CTGGAGAGAGAGAAATGGGTAGG + Intergenic
1078568216 11:12435305-12435327 CAGGAGAAGGGGAAAAGGATGGG - Intronic
1078764063 11:14276590-14276612 CTAAAGAAGGGGAAGAGGGAGGG + Intergenic
1079854576 11:25586096-25586118 TTGGAGAAGTGGTAGTTGGTTGG + Intergenic
1080601028 11:33820664-33820686 ATGGAGAAGGAGAAGAGGCTGGG - Intergenic
1080633784 11:34105740-34105762 GTGGAGAAGGGGAAGCACGTGGG - Exonic
1081603975 11:44515256-44515278 CTGGAGAGGGAGGAGTGCGTGGG + Intergenic
1081682896 11:45021192-45021214 CTGGAGAAGAGGAAGTGGAGGGG + Intergenic
1081718602 11:45269044-45269066 CTGGAGAAGGGGAGGGTGGTAGG + Intronic
1081720616 11:45285948-45285970 CTGCAGAGGGGGAACTGGGGTGG - Intronic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1082181791 11:49128904-49128926 CTGGGGTGGGGGAAGTGGGGAGG - Intergenic
1082739532 11:56895210-56895232 ATGGAGAAGAGGAGCTGGGTGGG + Intergenic
1083742720 11:64719591-64719613 ATGGAGCTGGGGAAGCGGGTGGG + Intronic
1083743689 11:64723681-64723703 CTAGAGAAGGGGGACTCGGTGGG + Intergenic
1084148060 11:67275471-67275493 AGGAAGAAGGGGAAGGGGGTGGG - Intronic
1084148981 11:67279305-67279327 CTGGAGAAAGGGGAGGAGGTTGG + Intronic
1084373935 11:68763525-68763547 CAGGAGGGCGGGAAGTGGGTGGG + Intronic
1084678116 11:70648746-70648768 ATGGAGAGGGGGAAGGGGTTTGG + Intronic
1084681116 11:70666982-70667004 CTGTGGAAGGTGAAGGGGGTGGG + Intronic
1084935662 11:72585277-72585299 GCAGAGAAAGGGAAGTGGGTGGG + Intronic
1085732495 11:79011578-79011600 CTGGAGAGGAGGAAGAGTGTAGG - Intronic
1085773148 11:79342435-79342457 CAGGAGGAGGCGAAGAGGGTGGG + Intronic
1086683706 11:89705962-89705984 CTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1086694077 11:89823394-89823416 CTGGAGAAGATGGGGTGGGTGGG - Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087002387 11:93434076-93434098 CTGGGGAAGGGGATCCGGGTAGG + Intronic
1087504803 11:99005876-99005898 CTGTAGAAGGTGAGGTGGGTAGG - Intergenic
1087775327 11:102251611-102251633 CTGGAGAAGAGGAAGTGAAGGGG - Intergenic
1087964256 11:104392824-104392846 CTGGACATGTGGAAGTGAGTAGG + Intergenic
1088188089 11:107195949-107195971 GTGGGGTAGGGGAAGTGGGGAGG + Intergenic
1088981128 11:114864886-114864908 TTGGAGATGGGGTAGGGGGTGGG + Intergenic
1089078747 11:115759683-115759705 CTGGAGAAGGGGACGCAGGGAGG - Intergenic
1089389174 11:118088478-118088500 GTGGGGAGGTGGAAGTGGGTGGG - Intronic
1089458414 11:118639031-118639053 TTGGAGTAGGGTAAGTGGGAGGG + Intronic
1089628702 11:119770108-119770130 CAGGGGACGGGGGAGTGGGTAGG + Intergenic
1089679166 11:120109910-120109932 CCAGAGAAGGGGAACTGGATGGG - Intergenic
1089709809 11:120306712-120306734 CTGGAGAGGGAGAAAAGGGTGGG + Intronic
1089767610 11:120779325-120779347 CTGGAGAAAGGGCAGCTGGTGGG + Intronic
1089785055 11:120901696-120901718 AGGGAGATGGGGAAGTGGCTGGG + Intronic
1089905690 11:122035840-122035862 CTGGAGGAGGGGAGTAGGGTAGG + Intergenic
1090034273 11:123234856-123234878 CTGGAGAAGCAAACGTGGGTAGG + Intergenic
1090417854 11:126552965-126552987 CTGGGGAAGAGGATGTGGGAAGG - Intronic
1090439267 11:126712659-126712681 CAAGAGGAGGGAAAGTGGGTAGG + Intronic
1090461840 11:126897937-126897959 CTTGGGAAGGGGGAGTGGGTGGG + Intronic
1091196155 11:133732607-133732629 CTGGACAAGGGGCAGGGGGATGG - Intergenic
1091236340 11:134024797-134024819 ATGGTGAGGGGGAAGAGGGTGGG - Intergenic
1091614599 12:2039918-2039940 CTGGAGATGGGGATGGGGGTAGG + Intronic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1091823569 12:3493204-3493226 CTGGGGAAGAGGAAGTGGTGAGG - Intronic
1092483383 12:8880624-8880646 CTGGTGAACGGGGAGTGGGAGGG + Intronic
1092527707 12:9319284-9319306 CTGGAGAATGGGAAATGGAAAGG - Intergenic
1092539550 12:9412473-9412495 CTGGAGAATGGGAAATGGAAAGG + Intergenic
1092863218 12:12737600-12737622 CTGGAGAAGGGGAGGAGGAGAGG - Intronic
1092989163 12:13878248-13878270 TGGCAGAAAGGGAAGTGGGTCGG - Intronic
1094524749 12:31224031-31224053 CTGGAGAATGGGAAATGGAAAGG - Intergenic
1094772749 12:33684479-33684501 AGGGAGAAGGGGAAGGGGGAGGG - Intergenic
1095158640 12:38889493-38889515 GTGGAGAAGGGGAGGGTGGTGGG + Intronic
1095620551 12:44248652-44248674 CTGGAGATGAGGCAGTGGGCAGG - Intronic
1095954809 12:47799874-47799896 CTGGAGAAGGGGAAGTGGGTGGG + Intronic
1096001048 12:48130956-48130978 AAGGAGAAGGGGAAGTTGGTGGG - Intronic
1096225733 12:49865824-49865846 CTGGAGTAGGGAAAGTGGCTGGG - Intergenic
1096561274 12:52437675-52437697 GAGGAGGAGAGGAAGTGGGTGGG + Intergenic
1096691421 12:53324465-53324487 CCTGAGAAGGGGAAGTGGGCAGG + Intronic
1097053824 12:56238648-56238670 CTGGAGCTGGAGAAGGGGGTAGG + Exonic
1098739537 12:74154951-74154973 CTGGGGAAGCTGAAGTGGGAGGG - Intergenic
1098909449 12:76194169-76194191 GTGGGGAAGTGGAAGTGGTTAGG - Intergenic
1099238854 12:80115472-80115494 CTGGAGCAGAGGAAGTGTCTGGG + Intergenic
1100283081 12:93137205-93137227 CTGGGGTGGGGGAAGTGGGGAGG + Intergenic
1101408812 12:104452698-104452720 CTGGAGACGGGGAGGTGGCCAGG + Intergenic
1101456810 12:104841130-104841152 CTGGGGAAGTGGAAGTGGAGGGG - Intronic
1102029665 12:109732670-109732692 CAGAAGGAGGGGAGGTGGGTGGG + Intronic
1102223095 12:111208034-111208056 AAGGAGAAGGGGAAGTGGGAGGG + Intronic
1102404091 12:112657778-112657800 ATGAAATAGGGGAAGTGGGTAGG + Intronic
1102597344 12:114002947-114002969 TTGGAGATGGGGGAGGGGGTTGG - Intergenic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1102909192 12:116699694-116699716 CTGGAGAAGGGGAAATGTTTTGG - Intergenic
1103244781 12:119447308-119447330 CAGTACAAGGGGAAGTGGGAGGG - Intronic
1103292293 12:119856471-119856493 GTGGGGAGGGGGAAATGGGTGGG - Intronic
1103719060 12:122963856-122963878 AAGGGCAAGGGGAAGTGGGTAGG + Intronic
1103782405 12:123407725-123407747 TTGAAGAAGGGAAAGTGGGGCGG - Exonic
1104006267 12:124894865-124894887 CTGGAGGAGGGGGAGTGAGGAGG - Intergenic
1104177039 12:126342937-126342959 CTGGAGGAGGAGGTGTGGGTGGG + Intergenic
1104430984 12:128715853-128715875 CTGGAGAAGCTAAATTGGGTGGG + Intergenic
1104444592 12:128823323-128823345 CTGGGGCAGGGGAAGAGGCTGGG + Intronic
1104548272 12:129732152-129732174 CTGAGGAAGGGCAAGTGGCTGGG - Intronic
1104548342 12:129732603-129732625 TTGTGGAAGGGGAAGTGGGAGGG - Intronic
1104622973 12:130332167-130332189 CTGGGGGAGGGGAACGGGGTTGG - Intergenic
1104892498 12:132147335-132147357 CTGGAGAAGTCCAAGTGGGAAGG + Exonic
1104986969 12:132602812-132602834 CTGGGGAAGGGGAAGGGGCCTGG + Intergenic
1105217691 13:18298755-18298777 TTGAAGAAGGGAAAGTGGGGCGG - Intergenic
1105286457 13:19008476-19008498 CTGGAGAGGAGGAAGGGGCTTGG - Intergenic
1105712705 13:23028375-23028397 CAGGAGAAAAAGAAGTGGGTTGG + Intergenic
1105726246 13:23164997-23165019 CAGGAGAAGGTGCAGTGGGAGGG - Intergenic
1106053150 13:26210644-26210666 CTGGAGAAGTGGAAATGCCTTGG - Intronic
1106116010 13:26818203-26818225 CTGCAGAAAGGGAAGTGGATAGG - Intergenic
1106128807 13:26922491-26922513 CTGGAGAAGGGGAAGGGCCTCGG - Intergenic
1106197847 13:27509417-27509439 CTGGAGATAGAGAAGTGGGAAGG - Intergenic
1106594148 13:31122719-31122741 CTGGAGAAGGAGGTGTGGTTAGG - Intergenic
1106761971 13:32876332-32876354 CTGGAGATGTGGGAATGGGTGGG - Intergenic
1107332130 13:39312290-39312312 CTGCAGAACAGGAAGGGGGTGGG + Intergenic
1108004136 13:45930729-45930751 CTGGACAAGGGCAGGTAGGTGGG - Intergenic
1108436921 13:50410096-50410118 CTGGAAAAGGCGAAGTGGAAAGG - Intronic
1108448887 13:50539881-50539903 CTGGAGAAGGTAGAGTGGATTGG + Intronic
1108950872 13:56090132-56090154 CTAGAGGATGGGAAGTGTGTGGG - Intergenic
1110718408 13:78733630-78733652 CAGGAGAAGGAGAGGTGGCTTGG + Intergenic
1110735957 13:78936841-78936863 ATGGAAAAGATGAAGTGGGTAGG - Intergenic
1110759072 13:79210223-79210245 CTGGAGGAGAGGAAATGGATGGG - Intergenic
1111386973 13:87539953-87539975 CTGGAAAAGAGGAGGTGGGAAGG + Intergenic
1112853469 13:103735395-103735417 CTGGAGAGGAGCAAGTGGATGGG - Intergenic
1113472848 13:110559077-110559099 CTGAAGAGGGGGAAGAGAGTTGG - Intronic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1114069312 14:19095322-19095344 CTGGAGGAGGGGGAATGAGTTGG - Intergenic
1114092949 14:19304680-19304702 CTGGAGGAGGGGGAATGAGTTGG + Intergenic
1114201235 14:20522612-20522634 GAGGAGAAGGGGAAGTGGAAGGG + Intergenic
1115650272 14:35398062-35398084 CTGGGGGTGGGGGAGTGGGTGGG + Intergenic
1116781280 14:49240597-49240619 CTGGAGCAGGGTAGGTTGGTGGG + Intergenic
1117336931 14:54763970-54763992 CTGGAGACGGGGAGGTGTGTGGG - Intronic
1117788734 14:59315491-59315513 CTGGGGAAAGGAAAGAGGGTAGG + Intronic
1118028929 14:61800262-61800284 CTGCAGAAGGGGTTGTGAGTAGG + Intergenic
1118620427 14:67609785-67609807 GAGAAGAAGGGGAAGGGGGTGGG + Intergenic
1120082540 14:80232050-80232072 CTTAAGAAGGAGAAATGGGTTGG - Intronic
1120252154 14:82070900-82070922 CTGGAGAATGCGAAGTGCTTTGG + Intergenic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1121103464 14:91265100-91265122 CTGGAGAAGGGCAAGGAGGGAGG + Intergenic
1121405273 14:93715891-93715913 CTGGGTAAGTGGAGGTGGGTTGG + Intergenic
1121881088 14:97500822-97500844 TAGGAGAAGGGGGGGTGGGTGGG + Intergenic
1122048370 14:99039204-99039226 GTAGAGAAGGGGAGGTGAGTGGG + Intergenic
1122242049 14:100375651-100375673 GTGGGGAACGGGAAGAGGGTGGG - Intronic
1122267112 14:100551862-100551884 GTGGGGAAGGGGAAGTGGGTCGG + Intronic
1122622459 14:103067547-103067569 CGTGAGAAGGGGCAGGGGGTGGG - Intergenic
1122769585 14:104092046-104092068 CTGGGGAAGGGGACCTGGGCTGG + Intronic
1122789921 14:104179829-104179851 CTGGAGGACGGGACGTGGGACGG + Intronic
1122931757 14:104936356-104936378 CATGAGCAGGGGAAGTGGGAAGG - Exonic
1122955826 14:105070532-105070554 ATGGAGCAGGCGAACTGGGTGGG - Intergenic
1202870224 14_GL000225v1_random:156086-156108 CTGGGGAGGCTGAAGTGGGTTGG - Intergenic
1123883261 15:24695714-24695736 CATGAGAAGGGGCAGTGGATTGG + Intergenic
1124089707 15:26586886-26586908 CTGGAGGAGGGAAAATGGGGAGG + Intronic
1124100810 15:26690995-26691017 CAGGAGGAGGGGGAGTGAGTGGG - Intronic
1124657192 15:31517990-31518012 CTGGAGGAGGGGATATGGGGAGG - Intronic
1125616809 15:41021691-41021713 CTGGGGAAGGGGGAGTGCGGAGG + Intronic
1125929300 15:43589127-43589149 CTGGAGAAGGGGTAGAAGGGAGG + Intronic
1125942467 15:43688959-43688981 CTGGAGAAGGGGTAGAAGGGAGG + Intergenic
1125956431 15:43793790-43793812 CAGGCGAAGGGCAAGAGGGTTGG - Exonic
1126778254 15:52117989-52118011 CTGGGGAAGGCACAGTGGGTGGG - Exonic
1127085222 15:55418133-55418155 CCTGAAAAAGGGAAGTGGGTGGG + Intronic
1127689089 15:61377007-61377029 CTTGAGAAGGGGACTTGGGGTGG + Intergenic
1127883224 15:63176253-63176275 GGGGAGAAGGTGAAGGGGGTAGG - Intergenic
1128073703 15:64813014-64813036 CTGCGGAAGGGGAAGGGGCTGGG + Intergenic
1128114192 15:65095074-65095096 CTGGAGAAGGGGTGTGGGGTAGG + Intronic
1128153213 15:65376532-65376554 AGGGAGATGGGGAAATGGGTGGG + Intronic
1128377552 15:67088319-67088341 TTGGAGGAGGTGAGGTGGGTGGG + Intronic
1128662311 15:69511049-69511071 CCTGGGAAGGGGGAGTGGGTGGG - Intergenic
1128858608 15:71044676-71044698 CTGGAGAAGGTAAGGTGGGAGGG + Intronic
1128891503 15:71335914-71335936 TTGGAGAAGGGCATGGGGGTGGG + Intronic
1129158087 15:73731325-73731347 GTGGGGAAGGGGAAGGGGGAGGG - Intergenic
1129187847 15:73921376-73921398 CTGGAGAAGGGGAGGTGGTGTGG - Intergenic
1129210308 15:74064509-74064531 CTGTGGCAGGGGAGGTGGGTGGG - Intergenic
1129230410 15:74194084-74194106 CTCGAGAAGGGGAAGTGGGCAGG - Intronic
1129403714 15:75300893-75300915 CTGTGGCAGGGGAGGTGGGTGGG + Intergenic
1130538406 15:84803096-84803118 CTTGAGAAGGCGCTGTGGGTGGG + Exonic
1130668145 15:85886956-85886978 CAGTAGAAAGGGAAGTGGGTTGG + Intergenic
1131059923 15:89398308-89398330 CTGGAGAAGCGTAAGTAGGAGGG + Intergenic
1131069508 15:89456984-89457006 TCAGAGAAGGGGATGTGGGTTGG - Intergenic
1131815528 15:96217504-96217526 CTGGAGAAAGGCCAGTGGGAAGG - Intergenic
1132083110 15:98884227-98884249 ATGGAGAAGGGACTGTGGGTTGG - Intronic
1132578833 16:676012-676034 CTGGAGAAGGGAGAGTCGGGGGG + Intronic
1133172781 16:3992242-3992264 CAGGAGAAGGGAAGGTGGGCAGG - Exonic
1133425604 16:5686225-5686247 CTGGGGAAGGGGAACAGGTTGGG + Intergenic
1133738439 16:8633094-8633116 CTGGGGAAGAGGAACTGGGCAGG + Intronic
1134176735 16:12013011-12013033 GTGGAGGAGTGGAGGTGGGTGGG + Intronic
1134562012 16:15219039-15219061 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1134922550 16:18130665-18130687 CTGAGGAGGGGGAAGTGGGTGGG - Intergenic
1135422930 16:22316810-22316832 CTGGAGAAGGCCAGGAGGGTGGG + Intronic
1135775372 16:25253382-25253404 CTGGGGAAGGGAAAGGGGGTAGG - Intronic
1135916672 16:26611108-26611130 ATGGAGATGAGGAAGTGGATAGG - Intergenic
1135935108 16:26773242-26773264 GTGGAGAAGCTGAAGTGGATAGG + Intergenic
1136427457 16:30178594-30178616 ATGGAGAAGGCGGAGGGGGTAGG + Intergenic
1137476844 16:48816815-48816837 CTGAGGAAGGGGTTGTGGGTGGG + Intergenic
1137597645 16:49735468-49735490 CTGCAGAAGGGCAGGTGGGGTGG - Intronic
1137634776 16:49976285-49976307 CTGGAGACAGGGACGGGGGTTGG + Intergenic
1137754151 16:50888117-50888139 CTGGAGCAGAGGAGCTGGGTGGG + Intergenic
1138331545 16:56219569-56219591 TGGGAGAAGGGGCAGAGGGTAGG - Intronic
1138528783 16:57623641-57623663 CTGGGGGATGGGCAGTGGGTGGG + Intronic
1139029614 16:62863372-62863394 CTGCATAAGAGGAAGTGTGTGGG - Intergenic
1139389595 16:66598361-66598383 CTGAAAGAGGAGAAGTGGGTGGG - Intergenic
1139936104 16:70572320-70572342 CTGGAGATGAGGATGTAGGTGGG + Exonic
1140170414 16:72598736-72598758 CTGGAGAATGGGAGGAGGGAGGG + Intergenic
1140279763 16:73543827-73543849 CTGGAGAAGGGGGTGGGGGAGGG + Intergenic
1140516947 16:75550133-75550155 GAGAAGAAGGGGAAGCGGGTGGG + Intronic
1141173336 16:81704452-81704474 AGGGAGGAGGGTAAGTGGGTAGG - Intronic
1141248307 16:82331555-82331577 ATGAAGAAGAGGAAGTGGGTTGG + Intergenic
1141585376 16:85030006-85030028 CTGTGGAATGGGAAGTGGGGCGG + Intronic
1141904451 16:87014801-87014823 CAAGAGAGGGGGAAGTGGCTGGG + Intergenic
1142014871 16:87740099-87740121 CTGGAGAAGGTGCAGGGGGTTGG - Intronic
1142968353 17:3594914-3594936 CTGAAGAACGGGAAGTCAGTGGG + Intronic
1142983093 17:3682542-3682564 CTGGAGAAGGGGATGGGGACTGG + Intronic
1143031887 17:3972564-3972586 GTGGTGAAGGGGAAGTGGCGGGG + Intergenic
1143224210 17:5286856-5286878 CAGGAGAAAGGGAAGGGGGTGGG + Intronic
1143270972 17:5674041-5674063 TTGCAGAAGTGGAAGTGGATTGG + Intergenic
1143686770 17:8523653-8523675 AGGGAGAAGTGGAAGTGGGGAGG + Intronic
1143871312 17:9959018-9959040 CAGGAGAAGGGGAGGTGGGAGGG + Intronic
1144425135 17:15134330-15134352 CAGGAGAAAAGGAAGTTGGTTGG + Intergenic
1144821402 17:18077198-18077220 CTGGAGTTGGGGTAGTGTGTAGG - Intergenic
1145018543 17:19413710-19413732 CTGGAGAAGGGTGTGTGGGGTGG - Intronic
1145769392 17:27481812-27481834 CAGGAGAAGGGACAGTGGGAGGG - Intronic
1145965390 17:28913084-28913106 CAGGACAAGGGGTAGTGGGAAGG + Exonic
1146659291 17:34653687-34653709 CTGGAGGAGGGGATGGGGTTGGG - Intergenic
1146888977 17:36492694-36492716 CTGGGGTAAGGGATGTGGGTGGG - Intronic
1146956172 17:36937493-36937515 CGGGAGAAGGGAAAGAGGGGAGG - Exonic
1147487156 17:40827501-40827523 GTGTAGCAGGGTAAGTGGGTGGG + Intronic
1147532305 17:41290855-41290877 CTGGGGAGGGGGATGTGGATGGG + Intergenic
1147912317 17:43862970-43862992 CTGGAGAAGGGGTCGGGGGTGGG + Exonic
1147980696 17:44272294-44272316 CTGGAGGAGGGGACGTGGTCTGG + Intergenic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148522881 17:48298809-48298831 GTGGGGGAAGGGAAGTGGGTAGG + Intronic
1148591274 17:48818185-48818207 CAGGTGAAGGGGATCTGGGTTGG - Intergenic
1148770709 17:50064395-50064417 CTGGAGAAGGGGAGTTGGGAGGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1149475878 17:56960646-56960668 ATGGGGAAGGGGACGAGGGTTGG - Intronic
1149804341 17:59600932-59600954 CTGGAGATGGAGAAGTGGTAAGG - Intronic
1150352599 17:64457595-64457617 CTGGAGAAGAGGAAGAGTATAGG + Exonic
1150868371 17:68878225-68878247 CTGGGGAAGTGGCAGTAGGTAGG + Intronic
1151267744 17:72969575-72969597 GGGGAGAAGGGGAAGGGAGTAGG - Intronic
1151329664 17:73399290-73399312 CTGGAAAAGGAGAACAGGGTGGG + Intronic
1151522683 17:74641569-74641591 CTGGGGAAGGGGAGGTGGGTGGG - Intergenic
1151716372 17:75833092-75833114 CAGGGGAAGGGGATGGGGGTGGG - Intronic
1152237951 17:79148241-79148263 CTGGAGAAGGGACTGTGGGTGGG - Intronic
1152262415 17:79274221-79274243 CTGGAGACTGGGATGGGGGTTGG + Intronic
1152552056 17:81034939-81034961 CCGGAGAAGGGGGAGGGGGGCGG - Intergenic
1152720185 17:81919770-81919792 CAGGGGAAGGGGAAGAGGGGTGG + Exonic
1152755391 17:82084998-82085020 GTGGGGAAGGGGAAGTGGTGAGG + Intronic
1152893460 17:82896090-82896112 CTGAAGAAGGGGGTGTGGGAGGG - Intronic
1153299642 18:3581461-3581483 CTTGAGAAGGCGCTGTGGGTGGG + Intronic
1153520912 18:5953174-5953196 CAGGAGAAGGGGAAGGGAGCTGG + Intergenic
1154215858 18:12415694-12415716 CAGGGGAAGGAGCAGTGGGTGGG - Intronic
1154296142 18:13150661-13150683 GTGGAGGTGGGGAAGTGGGGGGG - Intergenic
1155269629 18:24127462-24127484 GTGGAGAAGGGCAGGTGGGTGGG - Intronic
1155417156 18:25611422-25611444 CTGGGGAAGGGGAAATGAGGAGG + Intergenic
1156241298 18:35257275-35257297 TTGGTAAAGGGGAACTGGGTGGG - Intronic
1156841909 18:41618964-41618986 TTGGAGAAGGGGATGGGGGCTGG - Intergenic
1157404455 18:47411329-47411351 CTGGAGGAGGTGAAGTGGGAAGG + Intergenic
1157422691 18:47559604-47559626 CAGGAGAAGGGGAAGGGGAAGGG - Intergenic
1157714452 18:49873800-49873822 CTTGAGAAAGGGAGGTGGCTGGG + Intronic
1157969673 18:52251845-52251867 CAGGAGAAGAGAAAGTGGGGAGG + Intergenic
1158946649 18:62452771-62452793 CTGGAGAAAGGGAAATAGATGGG + Intergenic
1159145124 18:64444454-64444476 CTGGAAAAGGGGAAGTGACCAGG + Intergenic
1159361143 18:67404702-67404724 CGGGAGGAGAGGAAGTGGGAAGG - Intergenic
1159502870 18:69296521-69296543 CTAGAGGAGGGGATGTGGATGGG - Intergenic
1160379341 18:78439642-78439664 CAGGACAAAGGGAAGAGGGTGGG + Intergenic
1160590821 18:79943923-79943945 CTGGGAGAGGGGGAGTGGGTGGG - Intronic
1161317705 19:3625901-3625923 CTGGAGATGGGGCACTTGGTCGG - Intronic
1161354162 19:3810040-3810062 CTGGACACTGGGCAGTGGGTGGG + Intronic
1161847984 19:6723212-6723234 CAGGAGAAGGGTCTGTGGGTGGG + Intronic
1161985399 19:7650644-7650666 CTGGGGAGGGGGCAGAGGGTGGG + Intergenic
1162127389 19:8506737-8506759 CTGGAGATGGGGGAGAGGCTTGG + Intergenic
1162401210 19:10447752-10447774 CTGGAGGAAGGGCAGAGGGTGGG - Intronic
1162722088 19:12668618-12668640 CTAGGGAAAGGTAAGTGGGTGGG + Exonic
1163410881 19:17153756-17153778 CTGGAGGATTGGAGGTGGGTGGG - Intronic
1163742250 19:19022624-19022646 CTGTGGGAGGGTAAGTGGGTGGG + Intronic
1164707298 19:30329395-30329417 CTGGGGAATGGGAGGTGGGGAGG + Intronic
1166117989 19:40667435-40667457 CTGGAGATGATGGAGTGGGTGGG + Exonic
1166129196 19:40735921-40735943 CTGGAAAACGGGAATTGTGTTGG - Intronic
1166317011 19:41994674-41994696 CTGCAGGAGGGGAAGTTGGAAGG + Intronic
1166507531 19:43380392-43380414 CTGGCCAAGGGGATGTGGGTAGG + Intergenic
1166785459 19:45364332-45364354 CTGGAGAAGGGGGAGAGAGCCGG + Intronic
1166844904 19:45721411-45721433 GTGGGGATGGGGAAGTGGGGTGG - Intronic
1167100050 19:47399153-47399175 GGGGAGAAGGGAAATTGGGTGGG - Intergenic
1167112010 19:47468170-47468192 CTGGGCAAGGGGGAGAGGGTGGG - Intronic
1167201362 19:48067717-48067739 CTGGAGTAGGGGAAGGGGGTGGG - Intronic
1167262643 19:48467677-48467699 CTGGGGAAGGGGAAGGGGAAGGG + Intronic
1167521639 19:49959152-49959174 CTGAGGTGGGGGAAGTGGGTGGG + Intronic
1167523742 19:49971570-49971592 CTGAGGTGGGGGAAGTGGGTGGG - Intergenic
1167748036 19:51364225-51364247 TGGGAGAAGGGAAAGAGGGTGGG + Intronic
1167756322 19:51415690-51415712 CTGAGGTGGGGGAAGTGGGTGGG + Intronic
1167757400 19:51421409-51421431 CTGGAGAAGGGGACGTGGTGAGG - Intergenic
1168434418 19:56305970-56305992 CAGGAGAAGGGGGAGGGAGTGGG + Intronic
1168522145 19:57060902-57060924 CTGGAGCAGGGGAGGGTGGTGGG - Intergenic
925072690 2:983592-983614 CAGGAGAAGGGCAGGTGGGCTGG - Intronic
925084557 2:1097845-1097867 GTGGTGAAAGGGAAGTGGGGCGG - Intronic
925803461 2:7625510-7625532 CTGGAGCAGGAGAACTGGCTGGG - Intergenic
926048112 2:9724977-9724999 CTGGAGAAGGCAAAGTGGAAAGG - Intergenic
926128786 2:10287309-10287331 CTCTAGAAGGGGAAGAGGGCAGG + Intergenic
926226840 2:10972922-10972944 CTGGTGCAGGGGAAGCGGGGTGG + Intergenic
927228549 2:20796336-20796358 CTCCAGGTGGGGAAGTGGGTGGG + Intronic
927271904 2:21220108-21220130 CTGGAGGGAGGGAAGTGGGAGGG - Intergenic
927400890 2:22708390-22708412 CAGGAGAAGGAGAAGTGAGTGGG + Intergenic
927455164 2:23242619-23242641 CTGGAAAAGGGACAGTGGGTCGG + Intergenic
927636883 2:24823029-24823051 CTGGGGAAGGGGAGGTGAGGTGG - Intronic
927960741 2:27239358-27239380 TTGGAGAAGGGCATGTGGCTGGG - Exonic
928118726 2:28566532-28566554 TTGGGGAAGGGGAGGTAGGTTGG - Intronic
928217382 2:29373051-29373073 CTGGTGATGGGGAAGGGGCTTGG - Intronic
928245643 2:29624588-29624610 CTGGAGCAGGGGATGGGGGGAGG + Intronic
928694557 2:33836214-33836236 CAGGAGTAGGGGAAGAGGGCAGG + Intergenic
928752353 2:34485714-34485736 CTGGAGTAGGAAAAGTGGGATGG - Intergenic
929783983 2:44976003-44976025 CTGGAGAAGGGGTAGAGAGGCGG - Intergenic
930029890 2:47051949-47051971 CTGGAGAAGGGAGTGTGGGGAGG + Intronic
931356105 2:61538520-61538542 GTGGGGGAGGGGAAGTGGGGAGG + Intronic
931868107 2:66433326-66433348 CTGGCGAGTGGGACGTGGGTGGG + Intergenic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932343646 2:70982130-70982152 CTGGGGGAGGGGAAGGGGGTGGG - Intronic
932434931 2:71697551-71697573 CTGGGGATGGGGATGCGGGTGGG + Intergenic
932635728 2:73386184-73386206 CTGGAGAAGGTGAGGCGGGCCGG + Exonic
932810032 2:74817500-74817522 CTTGCTAAGGGGAAGTGGGGCGG - Intergenic
933445718 2:82377635-82377657 CTGCAGAAGCTGAAGTGGCTGGG - Intergenic
933805602 2:85996500-85996522 CTGAAGAAGAGGAAGGAGGTGGG + Intergenic
933917761 2:87013582-87013604 CTGAAGAAATAGAAGTGGGTTGG - Exonic
934005235 2:87756332-87756354 CTGAAGAAATAGAAGTGGGTTGG + Exonic
934296617 2:91747896-91747918 TTGAAGAAGGGAAAGTGGGGCGG + Intergenic
934979409 2:98827635-98827657 CTGGAGAAAGGTAAATGGCTGGG + Intronic
935768192 2:106390426-106390448 CTGAAGAAATAGAAGTGGGTTGG + Intergenic
936521085 2:113212555-113212577 GAGGAGGAGGGGAAGTGGGGGGG + Intergenic
937045842 2:118851123-118851145 CTGGAGAAGGGAAGGACGGTTGG - Intergenic
937080766 2:119137964-119137986 CTGGAGGAGGGGAAGTTTGAAGG + Intergenic
937354813 2:121191635-121191657 AAGGAGAAGTGGCAGTGGGTGGG + Intergenic
937495203 2:122411866-122411888 AAGCAGAAGGAGAAGTGGGTGGG - Intergenic
938055735 2:128213400-128213422 CCGTAGGAGGGGAAGTGGGGAGG - Intergenic
939059335 2:137400849-137400871 CTGGAGCAGGGGAAGAAGGTAGG + Intronic
939065740 2:137481722-137481744 CTGGGGAGTGGGATGTGGGTTGG - Intronic
939069241 2:137518949-137518971 CTGGAAAAGGGGAAAGGGGCTGG + Intronic
939691686 2:145269830-145269852 CTGGAGAAAAGGAAAGGGGTTGG - Intergenic
939977636 2:148737460-148737482 CTGGAGATGGAGGAGTGGGATGG + Intronic
940134460 2:150420792-150420814 CAGAAGAATGGGCAGTGGGTAGG + Intergenic
940193170 2:151064123-151064145 CTGGAAAAAGGGATGTGGGTGGG + Intergenic
940301890 2:152184337-152184359 CTGGGGATGGGGAGGTAGGTAGG - Intergenic
940444821 2:153765089-153765111 GTGCAGAAGGGAAAGTGGGATGG + Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
941023098 2:160430946-160430968 CTGGAGGAGGGAAAGGGGGATGG - Intronic
941038226 2:160590594-160590616 GAGGAGAAGGGGAAGGGGGAGGG - Intergenic
943433666 2:187835361-187835383 CTGGAGAAGGGGAATGGGAGTGG - Intergenic
943454830 2:188092688-188092710 CTGGAGAAAGGGGATTTGGTTGG - Intergenic
943629506 2:190234897-190234919 CTGGAGAAGAGGTAGTGAGTAGG + Intronic
943737882 2:191377425-191377447 CTCCAGAAGAGGAAGTGGGCAGG - Intronic
944000746 2:194834731-194834753 GTGGAGTAGGGGGAGTGGGGAGG - Intergenic
944218459 2:197278736-197278758 GTGGGGAAGAGAAAGTGGGTAGG - Intronic
944219152 2:197285124-197285146 CTGCAGAATGTGATGTGGGTGGG - Intronic
944661192 2:201923358-201923380 ATGCATAAGGGGAAGAGGGTGGG - Intergenic
945180720 2:207088403-207088425 GGAGAGATGGGGAAGTGGGTTGG - Intronic
945780977 2:214172237-214172259 GTGGGGTAGGGGAAGTGGGGAGG - Intronic
945995638 2:216433586-216433608 CTGTAGAGGGGGGAGTGAGTGGG + Intronic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946401400 2:219470351-219470373 CTGGAGATGGGCAGGCGGGTGGG - Intronic
946435055 2:219645936-219645958 CTGGAGATGAGGAAGGGGCTGGG + Intergenic
946762720 2:223010962-223010984 CAGGAAAAGTGGAAGTGGGAGGG + Intergenic
946835424 2:223767827-223767849 GTGGGGAAGGGGAAGTATGTTGG - Intronic
947179312 2:227398054-227398076 CTGGACAAGGGGAAGGAGGATGG - Intergenic
947437823 2:230088023-230088045 CTGGAGAAGAGCAGGTGGGATGG + Intergenic
947544794 2:231003061-231003083 CTGGACAAGAGGAAATGGGAGGG + Intronic
947578370 2:231294608-231294630 CAGGAGAAGGGGAGCTGGGCAGG + Intronic
948021348 2:234736312-234736334 CTGGAGTAGGGGAAGGGGGCAGG - Intergenic
948344339 2:237282679-237282701 AAGGAGAAGGGGAAGGGGGAGGG + Intergenic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948562644 2:238864653-238864675 CGGGAGAAGAGGAGGTGGGAGGG + Intronic
1169026985 20:2379938-2379960 GTGAGGAAGGGGAAGTGGGAGGG - Intergenic
1169029535 20:2396803-2396825 CTGGGGAAGGGGAGGTGCTTTGG + Intronic
1169996602 20:11564528-11564550 CAGGTGAAGGGGATCTGGGTGGG - Intergenic
1171217607 20:23363158-23363180 CTGGAGAAGGGGAGAGGGGTGGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172485208 20:35293806-35293828 CTGGAGGAGGGGAAGAAGGCTGG - Intergenic
1172588959 20:36104384-36104406 CTGCAGAAGGGGCATAGGGTCGG + Intronic
1172764103 20:37341888-37341910 CTGGAGTCGGGGAAGTGAGGTGG - Intergenic
1173241464 20:41301266-41301288 ATGGAGAATGGGTAGTGGGGAGG - Intronic
1173373534 20:42461427-42461449 CTGGAGAGGGTGAGGTGGGAGGG + Intronic
1173424233 20:42928743-42928765 CTGGAGAAGAGAAGGTGGGTAGG - Intronic
1173992978 20:47317325-47317347 CTGGAAAAGGGGAGGTGAGTTGG - Intronic
1174180233 20:48669838-48669860 ATGGAGAAGGCAAAGTGGGGTGG + Intronic
1174520787 20:51129001-51129023 CTGGAGGAGGGGATGTGGCGTGG - Intergenic
1174649318 20:52111075-52111097 CAGGAGAAGGGGAAGCGGCAGGG + Intronic
1174932874 20:54834451-54834473 CTGGAGAAGGGGAAAGGAGGAGG + Intergenic
1175035661 20:55998606-55998628 CTGGAGAAAGGTAATTTGGTTGG - Exonic
1175126340 20:56754809-56754831 AGGGAGAAGGGGAAGGGTGTTGG - Intergenic
1175336311 20:58198545-58198567 GTGGAGAAGGGAAGGTGGCTGGG + Intergenic
1175373452 20:58508568-58508590 CTGGCGGAGGGGAGGTGGCTGGG + Intronic
1175876546 20:62232899-62232921 CTGGAGCTGGGGATGGGGGTTGG - Intronic
1175964127 20:62652003-62652025 CGGGGGCAGGGGGAGTGGGTCGG - Intronic
1176045836 20:63092167-63092189 CTGGAGAAGGGGACCAGGGGCGG + Intergenic
1176241703 20:64078554-64078576 CTGGAGGAGGGGACGTGTTTAGG + Intronic
1176298422 21:5086630-5086652 ATGGGGCAGGGGAAGTGGGGTGG + Intergenic
1176299927 21:5094791-5094813 CCGGAGGAGGGGCTGTGGGTGGG - Intergenic
1176389183 21:6154907-6154929 CTGGGGAGGGGGAAGGGGGCAGG - Intergenic
1176613796 21:9011034-9011056 CTGTGGAAGGGGAGGTGGGAAGG + Intergenic
1176902854 21:14464512-14464534 CTGAAGAAGAGGCAGTGGGGAGG + Intergenic
1178029882 21:28512147-28512169 CTGTACAAGGACAAGTGGGTAGG - Intergenic
1178517165 21:33257809-33257831 CTGGAAAAGGGGACATGGGCAGG + Intronic
1178799491 21:35779164-35779186 GAGGAGAAGGGGAAGCGGGAGGG + Intronic
1179496716 21:41776487-41776509 CTGCACTAAGGGAAGTGGGTGGG + Intergenic
1179734289 21:43383341-43383363 CTGGGGAGGGGGAAGGGGGCAGG + Intergenic
1179857095 21:44167120-44167142 CCGGAGGAGGGGCTGTGGGTGGG + Intergenic
1179858604 21:44175319-44175341 ATGGGGCAGGGGAAGTGGGGTGG - Intergenic
1180144736 21:45912849-45912871 GTGGGGAAGGGGATGTGGGGCGG - Intronic
1180177528 21:46097934-46097956 CTGGAGGAGGTGGAGAGGGTGGG - Intergenic
1180487783 22:15817885-15817907 CTGGAGGAGGGGGAATGAGTTGG - Intergenic
1181043501 22:20203960-20203982 CTGTGGAATGGGAAGTGGGGAGG + Intergenic
1181335263 22:22124295-22124317 GTGGAACAGGGGAAGGGGGTGGG + Intergenic
1181483684 22:23217616-23217638 CTGAAGTTAGGGAAGTGGGTGGG + Intronic
1181571067 22:23768029-23768051 CGGGAGAAGGGGGATAGGGTTGG - Exonic
1182318775 22:29464860-29464882 CGGGAGAAGGGGAAGGGGCCTGG - Intergenic
1182551997 22:31105622-31105644 CTGGGGGAGGGGAAATGGGATGG - Intronic
1182572587 22:31249825-31249847 CTGGACAGGGGGAAGGGGGAAGG + Intronic
1183493355 22:38128236-38128258 CTGGAGAAGAGGGAGTCGGGAGG + Intronic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184149228 22:42628845-42628867 ATGGAGAAGGGGAAGGTGGCTGG + Intronic
1184321063 22:43742622-43742644 CAGGAGACGGGCAAGAGGGTTGG - Intronic
1184422669 22:44391023-44391045 CCTCAGAAGGGGATGTGGGTTGG - Intergenic
1184726521 22:46350545-46350567 CTGGAGAAGGGGAAGTGGTGCGG - Intronic
1185149156 22:49154256-49154278 CTGGGGAGGGTGAAGAGGGTGGG + Intergenic
949535306 3:4991013-4991035 CATGAGCAGGGGAAGTGGATGGG - Intergenic
949673729 3:6428645-6428667 GTGGGGTAGGGGAAGTGGGGAGG - Intergenic
950529443 3:13544663-13544685 CTGGAGCAGGGGATGGGGATGGG + Intergenic
950652932 3:14418929-14418951 CGGGGGAAGGGGAAGGGGCTGGG - Intronic
950717646 3:14861151-14861173 CTGAAGACGGGGGAGTGGCTCGG + Intronic
950938337 3:16866471-16866493 CTGGAGGTGGGGAGGTGGGGGGG - Intronic
950967715 3:17157533-17157555 CTGGAGGAGGGGCACTGGGGAGG - Intronic
951064056 3:18243656-18243678 CTGGAGAAGGGGATCTATGTTGG - Intronic
951174108 3:19579000-19579022 CTGGGGAAGAGGAAGTCAGTAGG + Intergenic
952105802 3:30068002-30068024 CTAGAGAAGGGGCAGTGAGTTGG + Intergenic
952221539 3:31328426-31328448 CAGGAGAAAGGGAAGGGGGCAGG + Intergenic
952331238 3:32366230-32366252 ATGGGGAAGGGGAAGAGGGTTGG - Intronic
952983348 3:38756163-38756185 CTGGTGAAAGGGATCTGGGTGGG - Intronic
952992591 3:38844630-38844652 GATGGGAAGGGGAAGTGGGTGGG - Intergenic
953239725 3:41138031-41138053 GTGGAGATTGGGAAGTGTGTGGG - Intergenic
953390777 3:42532484-42532506 CTGGAGCAGGGGATGGTGGTGGG - Intronic
953450562 3:43001842-43001864 CAGGAGAAGGGGAAGGGGTGAGG - Intronic
953831541 3:46301686-46301708 CTGGAGCAGAGGAAGTGAGGGGG - Intergenic
953856034 3:46499705-46499727 CTTGAGCAAGGGAACTGGGTTGG + Intronic
953913069 3:46902475-46902497 TTGTTGAAGGGGAAGTGGCTTGG + Intronic
953990125 3:47477068-47477090 CTGAAGAATGTGTAGTGGGTCGG - Intronic
954415837 3:50392854-50392876 CTGGGGAAGGGGGACTGGTTTGG + Intronic
954484702 3:50836966-50836988 ATGGAGAAGGGGAACTTGTTGGG - Intronic
954616048 3:51969078-51969100 TTGCAGAAGGAGGAGTGGGTGGG + Exonic
954672072 3:52296575-52296597 CTGGAGAAAGGAAGGTGGGAAGG - Intergenic
954740821 3:52749080-52749102 TTGCAGAAGGGGAAGAGGGGAGG + Intronic
956724457 3:72145750-72145772 CTGGAGAGTGGGAAGGGGGTAGG - Intergenic
957050987 3:75411783-75411805 CTGGGGAAGGGGGCGTGGGGAGG + Intergenic
957821816 3:85386369-85386391 CTGGAGAATGGGAATTGGGTGGG + Intronic
957843238 3:85698579-85698601 CAGGAGAAGGAGAGGTGGGGTGG + Intronic
957857215 3:85894345-85894367 GTGGGGTAGGGGAAGTGGGGAGG + Intronic
958818009 3:98938621-98938643 CTCGAGAGGGGAAGGTGGGTTGG + Intergenic
958978807 3:100697054-100697076 CTGGAAAAGGGGAATGGAGTGGG - Intergenic
959494524 3:107034667-107034689 CTAGAGATAGGAAAGTGGGTAGG + Intergenic
960574793 3:119218875-119218897 CAGGAGAAGCAGGAGTGGGTGGG - Intronic
960829778 3:121834577-121834599 CTGGAGAAGGGGATGTGTAGTGG - Intronic
961786280 3:129348985-129349007 CTGAGAAAGGGGAAGTGAGTAGG + Intergenic
962086631 3:132198351-132198373 CTTCAGTAGGGGAAGTGGGAAGG - Intronic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
962326876 3:134441758-134441780 CTGGGGAAGGGGAGGTGGGGAGG - Intergenic
962852696 3:139319666-139319688 CTGGAGCAGGGGCAGAGGGCTGG - Intronic
963254510 3:143131465-143131487 GGGGAGAATGGGCAGTGGGTGGG - Intergenic
963356803 3:144218144-144218166 CTGGAGCAGGGGAAGTTTGGTGG + Intergenic
963492451 3:146018349-146018371 CTGGAGAAGGGAAAGCAGCTTGG - Intergenic
963493688 3:146033489-146033511 ATGGAGAAGGGGAGGTGTGTAGG + Intergenic
963535780 3:146526379-146526401 GTGGAGAAGGGGAAATCTGTTGG + Intronic
964310526 3:155386953-155386975 CTGGGAAAAGGGAAGTGGGGAGG + Intronic
965299840 3:166995822-166995844 CTGGGGAAGGCCAATTGGGTGGG + Intergenic
965668871 3:171125790-171125812 CATGAGAAGGGGAAGTGCTTTGG + Intronic
966888539 3:184389879-184389901 GTGGAGAAGGGGCAGAGAGTAGG + Intronic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
966920080 3:184605335-184605357 CTGAAGAAGGCCTAGTGGGTGGG + Intronic
968241214 3:197087958-197087980 GTGGAGAAGGGGAAGGTGGTTGG + Intronic
968534178 4:1113203-1113225 GTGGAGAAGGGGGAGGGGGCAGG - Intronic
968683489 4:1938625-1938647 CTGGTGAAGGGGAACAGGGCAGG + Intronic
968807800 4:2786838-2786860 ATGGAGAAGTGGAAGGGGGAGGG + Intergenic
968880154 4:3294381-3294403 CTAGAGAAGGCGACGTGGGGAGG + Intronic
969315608 4:6379957-6379979 GTGGAGAAGGGGAGGTAGGAGGG - Intronic
969349316 4:6589135-6589157 TTGGAGAAAGGGATGTGGGACGG - Exonic
969457455 4:7308293-7308315 CAGCAGAAGGGGCAGGGGGTTGG - Intronic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
970008965 4:11437805-11437827 GTGGAGTAGGGGGAGTGGGGAGG - Intergenic
970647793 4:18142658-18142680 CTGGGGAAGTTGAAGTGGGTGGG - Intergenic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
972422838 4:38905792-38905814 CTGATGAAGGGGAAGTGGGTGGG - Exonic
972637783 4:40899603-40899625 ATGAAGAAGGGCAAGTGGCTGGG + Intronic
972896267 4:43624806-43624828 TGGGGGAAGGGGAAGGGGGTTGG - Intergenic
973059000 4:45695798-45695820 CTGAAGAAGTGGTAGTTGGTAGG - Intergenic
973288023 4:48441140-48441162 CAGGAGAAGGAGAAGTGCGTGGG - Intergenic
973931153 4:55793926-55793948 CTGGGGATGGGGAAGAGGGACGG + Intergenic
974517270 4:62934105-62934127 CTGGAGCTGGAGAAGTAGGTAGG - Intergenic
974716801 4:65678378-65678400 ATGGAGAAGGGGAACTTGTTGGG + Intergenic
974877728 4:67718191-67718213 CTGGAGCCGGGGAAGTGGGGAGG + Intergenic
975502306 4:75100345-75100367 GAGGAGAGGGGGAAGTGGGGAGG - Intergenic
975701023 4:77066818-77066840 CTGAAGAAGTGGGAATGGGTAGG - Intronic
976480238 4:85534550-85534572 TTGGAGAAGATGAAGTGGGGTGG + Intronic
977551555 4:98448754-98448776 CAGGAGAAGAGCATGTGGGTGGG + Intergenic
977739388 4:100459574-100459596 CTGGAGGTGGGGAGTTGGGTAGG - Intronic
978725271 4:111962235-111962257 ATTGAGAAGGGGAAGATGGTGGG - Intergenic
978847545 4:113292111-113292133 CTTAAGAAGGTGAAGGGGGTGGG - Intronic
978868748 4:113548583-113548605 CTGGGGAAAGGGCAGAGGGTGGG - Intronic
978961998 4:114691342-114691364 CTGAAGCAGGGAAGGTGGGTAGG - Intergenic
980644087 4:135619181-135619203 CTGGAGAAGAGGCAGGAGGTGGG - Intergenic
981430235 4:144648759-144648781 GAGGAGAAGGGGAAGGGGGATGG + Intronic
981599653 4:146471955-146471977 ATGGAGAACAGGAAATGGGTGGG - Intronic
981736750 4:147961655-147961677 CTGGAGAAGGGGAGAAGAGTGGG - Intronic
981756520 4:148146077-148146099 AAGAAGAAGGGGAAGTGGGCTGG + Intronic
981934723 4:150227473-150227495 CTGGAGCAGGAACAGTGGGTAGG + Intronic
982117925 4:152113378-152113400 GAGGAGAAGGGGAAGAGAGTGGG + Intergenic
982232682 4:153223164-153223186 CTGGAGCGGGTGCAGTGGGTCGG + Intronic
982707422 4:158725083-158725105 CTGGAGTCAGGTAAGTGGGTTGG + Intergenic
983272216 4:165575715-165575737 CAGAAGAAGGGGAAGTGACTGGG + Intergenic
984087730 4:175332933-175332955 CTGGGGATGGGTAAGTGGGCAGG - Intergenic
984100207 4:175475494-175475516 GTGGGGTAGGGGGAGTGGGTAGG - Intergenic
984392326 4:179151992-179152014 CTGGAGGAGGATGAGTGGGTGGG - Intergenic
984911437 4:184676929-184676951 AGGGAGAAGGGGAAGGGGGAAGG - Intronic
985475836 5:78558-78580 CAGGACAAGAGGAAATGGGTTGG - Intergenic
985628344 5:1001747-1001769 CTGGAGAAGGGGAAGCCCGCGGG + Intergenic
985913467 5:2900590-2900612 GTGGAGAAGGGGAAGGTGGAAGG - Intergenic
986116728 5:4782511-4782533 CAGGAGAGGGGGAAGTGGTGAGG + Intergenic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
986763536 5:10901836-10901858 CTGGAGAAGTGGAGGTGGCTAGG + Intergenic
986988040 5:13521300-13521322 CAGGAGAACTGGAAGTGGGGAGG - Intergenic
987243932 5:16029174-16029196 CTGGAGGAGGGGATGAGAGTGGG - Intergenic
988982657 5:36587018-36587040 CTGGTGAAGGGGAAGAGGCTTGG - Intergenic
989590015 5:43104577-43104599 CTGGAGAAGAGCAAGTGGTAGGG - Intronic
990429425 5:55719608-55719630 CTGGGGAAGCTGAAGTGGGGGGG - Intronic
990543955 5:56803710-56803732 CTGGAGAAATGGGAGAGGGTAGG - Intergenic
990888502 5:60621533-60621555 CTGGGGTAGGGGGAGTGGGGAGG + Intronic
991042976 5:62194619-62194641 CCTCAGAAGGGGAAGTGGGTAGG - Intergenic
991481943 5:67090342-67090364 GGGGGGAAGGGGAAGTGGGGAGG - Intronic
991481960 5:67090380-67090402 GGGGAGAAGGGGAAGTGGGGAGG - Intronic
991530618 5:67609884-67609906 CTGGAGAGGAGGGAGTGAGTAGG - Intergenic
992030220 5:72713648-72713670 ATGAAGAGGGGAAAGTGGGTAGG - Intergenic
992415095 5:76544768-76544790 TTTGGGAAGGGGAACTGGGTGGG - Intronic
992418993 5:76582336-76582358 CTTGAGAAGGGGAAGGGCCTTGG + Intronic
992482580 5:77166683-77166705 CTGGAGTGGGGGAAGAGGGCGGG + Intergenic
993270568 5:85791049-85791071 GTGGGGTAGGGGAAGTGGGGAGG - Intergenic
994144902 5:96383890-96383912 CTGGAGAAGAGTAAGTGGGCAGG + Intergenic
995468485 5:112475432-112475454 ATAGGGAAGGGGAAGTGGGGTGG + Intergenic
995912536 5:117204626-117204648 CTGGCGAAGGGGGAGGGGGGGGG + Intergenic
997107791 5:131041008-131041030 CTGGAGAAGGGGGTGTGGAATGG + Intergenic
997423655 5:133788168-133788190 CTGGAGAAGGGGACGTGAGATGG + Intergenic
997526418 5:134555915-134555937 ACGGAGAAGGGGAAGGGGCTTGG - Intronic
997601629 5:135142613-135142635 TTGGGGAAGGGGGAGTGTGTGGG - Intronic
997663341 5:135606567-135606589 CTGGAGAAGGTTAAGTGGCTTGG + Intergenic
997693242 5:135842288-135842310 CTGGGGTAGGGGGAGTGGGTGGG - Intronic
998169487 5:139864116-139864138 CTGGAGAAGAGGAGGTCGGGGGG + Intronic
998170436 5:139869517-139869539 CTGGAGAAGGGCAGGGGGGTGGG - Intronic
998779356 5:145639352-145639374 AGGGAGAAGGGCAAGAGGGTGGG + Intronic
999195002 5:149775819-149775841 GTGGAGAAAGAGAAGGGGGTAGG - Intronic
999400456 5:151259933-151259955 GTGGAGAAGGGGAGGTGCGAGGG + Intronic
999520727 5:152348320-152348342 CTGCAGGAGGGCAAGTGGCTTGG - Intergenic
999770761 5:154773880-154773902 TTGCAGAAGGGGACATGGGTTGG + Intronic
1000424905 5:161079131-161079153 CTGGAGACAGGGGAGTGAGTTGG - Intergenic
1001270773 5:170309923-170309945 CAAAAGAAGGGGCAGTGGGTAGG + Intergenic
1001321590 5:170686932-170686954 CTGGAGAGGGGGAAGAGGAAGGG - Intronic
1001400730 5:171444997-171445019 ATGGAGCAGGGGAATGGGGTAGG + Intronic
1001428927 5:171644541-171644563 CGGGAGATGGGGAGGTGGGGCGG + Intergenic
1001543977 5:172558703-172558725 GTGTGGAAGGGGAACTGGGTGGG - Intergenic
1001681267 5:173558792-173558814 CTGGAGATGGGAAAATGGGAGGG - Intergenic
1001721389 5:173859866-173859888 CTGGGGCAGGGGAAAAGGGTGGG + Intergenic
1001735366 5:173994058-173994080 CTGAAGAAGTGGTAGTTGGTTGG + Intronic
1002067540 5:176659591-176659613 CTGGAGAGGTGGGAGTGGGGAGG + Intergenic
1002173373 5:177387664-177387686 CTGGGGACTGGGACGTGGGTGGG + Intronic
1002576523 5:180177145-180177167 CTGGATGAGGGGCAGTGGGATGG + Intronic
1002703559 5:181144571-181144593 CTGCAGAAGGCAAAGGGGGTAGG - Intergenic
1003101756 6:3181215-3181237 ATGGAGGAGGGCAAGTGGATGGG + Intergenic
1003683747 6:8280886-8280908 AAGGACAAGGGAAAGTGGGTGGG - Intergenic
1004100804 6:12608996-12609018 CTGGAGAAGAGAAATGGGGTTGG + Intergenic
1004336141 6:14765942-14765964 CTGGAAAAGGGGAACTGGGGTGG + Intergenic
1004834799 6:19518348-19518370 CTGGAGGTGGGGAAGTGAATGGG - Intergenic
1005934476 6:30509764-30509786 CTGGGGAGGCTGAAGTGGGTGGG - Intergenic
1006192337 6:32217267-32217289 CTGGTGGGGCGGAAGTGGGTGGG + Intronic
1006302152 6:33199373-33199395 CTGGGGAAGGGGATTTGGGGAGG + Exonic
1006360438 6:33584307-33584329 CTGGAGATGGGGATTTGGTTTGG + Intergenic
1006397203 6:33795270-33795292 CTGGAGCAGGGGAGTGGGGTGGG + Intronic
1006652441 6:35562820-35562842 AAGGAGAAAGGGAAGGGGGTGGG + Intergenic
1006909696 6:37555842-37555864 CAGGAGAAGGTGGGGTGGGTGGG + Intergenic
1007032610 6:38641600-38641622 CTGGAGCAGGGCCTGTGGGTAGG + Intergenic
1007183492 6:39947925-39947947 CTGGAGAAAGGGATGGGTGTAGG + Intergenic
1007246449 6:40466647-40466669 ATGAAGAAGTGGAAGTGGATTGG - Intronic
1007349179 6:41256148-41256170 CTGCATAGGGGGAAGTGTGTGGG - Intergenic
1007361429 6:41359318-41359340 CAGGAGAGGGGGAAGAGGTTGGG + Intergenic
1007693805 6:43719261-43719283 CTGGAGAAGAAGGGGTGGGTAGG - Intergenic
1007700569 6:43763922-43763944 GTGGAGAAAGGGGAGTGGGTGGG + Intergenic
1008195648 6:48516908-48516930 GTGGAGTGGGGGAAGTGGGGAGG - Intergenic
1008379408 6:50824724-50824746 CTGCAGATGGGATAGTGGGTGGG - Intronic
1008450959 6:51650516-51650538 GTGGGGAAGGGGAGGTGGTTAGG - Intronic
1009796570 6:68476893-68476915 CTGGGGAAGGAGAAGTGGCAAGG - Intergenic
1009993835 6:70877403-70877425 CTGCAGAAGAGGCAGAGGGTCGG - Intronic
1010250066 6:73697842-73697864 TGGGAGAAGGGGAAGAGGATGGG + Intronic
1011268206 6:85548160-85548182 CTGGAGATGGGGAATGGGGATGG + Intronic
1011330241 6:86196756-86196778 CTGGAGAAGGGAAAGTTTGTGGG + Intergenic
1011348582 6:86398578-86398600 GTGGAGTAGGGGGAGTGGGGAGG + Intergenic
1012906514 6:105073107-105073129 CTGGTGGTGGGGAGGTGGGTGGG - Intronic
1013182881 6:107732749-107732771 CTGGGGGAGGCGAAGTGGGTGGG + Intronic
1013377107 6:109528108-109528130 CTGGAGAAGGGATACTGCGTAGG + Intronic
1013512359 6:110856646-110856668 TCTGAGATGGGGAAGTGGGTAGG + Intronic
1014001965 6:116374279-116374301 TTGGGGAAGGGGCAGTGGGGTGG - Intronic
1015486819 6:133781002-133781024 AAGAAGAAAGGGAAGTGGGTAGG + Intergenic
1015588814 6:134803062-134803084 CTAGAGCAGGTGAAGTGGGGAGG - Intergenic
1016069763 6:139725900-139725922 CTGTAGAAGGGGACCCGGGTGGG + Intergenic
1016283962 6:142451795-142451817 CTGAGGAAGGGGTAGTGGGGAGG - Intergenic
1016430296 6:143977092-143977114 ATGGAGAAGGCTAAGTGTGTTGG - Intronic
1016786904 6:148020885-148020907 CTGGAGATGGGACAGTGGGGGGG + Intergenic
1016939422 6:149472174-149472196 CTGCAGAAGGGGCAGAGGATGGG + Intronic
1017125999 6:151065344-151065366 CTGGAGAAGAGGAAGAGGCCAGG - Intronic
1017295509 6:152789418-152789440 CTGGTGAAGGTGATCTGGGTGGG - Intergenic
1017768878 6:157629524-157629546 ATGGGGGTGGGGAAGTGGGTGGG + Intronic
1018129035 6:160710601-160710623 CTGAAGAAATAGAAGTGGGTTGG + Intronic
1018965520 6:168484937-168484959 CTGGGGAAGGGGAAATGGGGAGG + Intronic
1019357327 7:587501-587523 TAGGAGAGGGGGCAGTGGGTAGG - Intronic
1019732167 7:2634363-2634385 TGGGAGAATGGGCAGTGGGTGGG + Intronic
1019937778 7:4267500-4267522 CCGGAGAGGGCGAAGTGGGCGGG + Exonic
1020317303 7:6914947-6914969 CTGGGGAAGGGGGGGTGGGGAGG + Intergenic
1021807465 7:24371423-24371445 CTGGAGGAGGGTTATTGGGTAGG + Intergenic
1021892379 7:25198481-25198503 CTGGAGAGTGGGCTGTGGGTGGG - Intergenic
1022098354 7:27154733-27154755 CTGGAGTAGGTGATGGGGGTGGG + Exonic
1022099669 7:27161619-27161641 GTGGAGTGGGGGAAGGGGGTCGG + Intergenic
1022662376 7:32379066-32379088 CTGGAGCAGGAGAGGTAGGTAGG - Intergenic
1022801288 7:33779805-33779827 CTGGGGAAGTAGAAGTGGATGGG - Intergenic
1023045934 7:36210089-36210111 CTGGAGATGAGGTGGTGGGTGGG + Intronic
1023161539 7:37301551-37301573 CTGGAGAGGGGTGGGTGGGTGGG - Intronic
1023288694 7:38646360-38646382 CTGGAAAAGTGGCAGAGGGTGGG + Intergenic
1023526174 7:41106268-41106290 CTGGAGAAGGGGCGGTGGGAGGG - Intergenic
1023752470 7:43385477-43385499 CTGGGGGTGGGGAGGTGGGTGGG - Intronic
1024298335 7:47864095-47864117 CTGGAGAAGGCAAGGTGGGCAGG + Intronic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024667769 7:51563530-51563552 CTGGGGAAGGGGAGGTGCCTGGG - Intergenic
1025229503 7:57192126-57192148 ATGGAGAAGGGAATGTGGGTGGG - Intergenic
1026181676 7:68046770-68046792 CTGGAGAAGGGGAGGAGGAAAGG + Intergenic
1026558610 7:71429263-71429285 CTGAAGAAGGAGGCGTGGGTGGG + Intronic
1026723818 7:72855382-72855404 CTGGAGCAGGAGGAGAGGGTTGG - Intergenic
1026994570 7:74606977-74606999 TTGGAGCAGGGGAAGGGGGTGGG - Intergenic
1027137052 7:75631915-75631937 CAGGAAATGGGGAAGTGGGAGGG + Intronic
1027236864 7:76303461-76303483 CTGGGGATGGGGCTGTGGGTGGG - Intronic
1027511440 7:79086854-79086876 CTAGATAAGGGGAAGGGTGTGGG + Intronic
1027564948 7:79780072-79780094 GTGGAGTAGGGGAAGGGGGAAGG - Intergenic
1028409157 7:90509187-90509209 GGGGGGATGGGGAAGTGGGTTGG + Intronic
1029123715 7:98283951-98283973 CTAGGGAAGGGGAAGTGGCAGGG - Intronic
1029481657 7:100817163-100817185 CTGGGGAAGGGGGTGAGGGTGGG - Intronic
1029851805 7:103469381-103469403 CTGGGGATGGGGATGGGGGTGGG - Intergenic
1030110997 7:106026855-106026877 CTGGAGAATGGGAAGGGTGGGGG + Intronic
1030295490 7:107921851-107921873 ATGGACAAGGGGATGGGGGTGGG - Intronic
1031010708 7:116523782-116523804 ATGGAGAGGGGAATGTGGGTTGG - Intergenic
1031417066 7:121507540-121507562 GAGGAGAAAGGGAAGGGGGTGGG + Intergenic
1031595108 7:123640723-123640745 GAGGAGAAGGGGAAGGGGGAAGG + Intergenic
1032261911 7:130345192-130345214 ATGGAGTAGGGCAGGTGGGTGGG + Exonic
1032323039 7:130901607-130901629 CTGGAAAAGTGGAGGGGGGTGGG - Intergenic
1032473358 7:132194248-132194270 GTGGAGAAAGGGACCTGGGTAGG - Intronic
1033589515 7:142797630-142797652 CTGGGGAAGAGGGAGGGGGTGGG + Intergenic
1033614850 7:143004234-143004256 CTGGAGGAGGAGGAGGGGGTTGG + Intergenic
1034083557 7:148302700-148302722 ATGGGGAAGGGGAAGTAGGCAGG - Intronic
1034189998 7:149206630-149206652 CAGGAGAAGGGGAGGTGGTGGGG + Intronic
1034557639 7:151860180-151860202 CTGGAGAAGGGGCAGTGGCTGGG - Intronic
1035035483 7:155891582-155891604 ATGGTGAAGGGGATGGGGGTAGG + Intergenic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1035121694 7:156573516-156573538 CTAGAGAAAGGGAGGTGGGGAGG - Intergenic
1035303755 7:157916778-157916800 CTGGGGAGGGGGACGTGTGTTGG - Intronic
1035303806 7:157916940-157916962 CTGGGGAGGGGGACGTGTGTTGG - Intronic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1036620714 8:10423187-10423209 CTGGAGAGGAGGAAGAGGGTGGG - Intronic
1037645284 8:20787370-20787392 CTGGAGGATGGGGAGTGGGTGGG - Intergenic
1037680880 8:21096574-21096596 CTGGAGAACGGGGGGTGGGGGGG - Intergenic
1037782709 8:21881697-21881719 CAGCAGTAGGGGAAGGGGGTGGG - Intergenic
1039331311 8:36540080-36540102 CTACAGAATGGGAAGGGGGTGGG + Intergenic
1039567787 8:38563861-38563883 CTGGAGAAAGGGGAATGGGGAGG - Intergenic
1041192488 8:55367855-55367877 CTGGAGAAGGGTAACTGAGCTGG - Intronic
1041600136 8:59707016-59707038 GTGGAGTAGGGGAAGTGGGGAGG + Intergenic
1042177832 8:66054877-66054899 CTGGGGTAGGGGAGGTGGGAGGG + Intronic
1043148278 8:76682289-76682311 CTTGAGAAGGGGAAGAGGGGCGG - Intronic
1043810808 8:84737701-84737723 CTGGAGGAGGGGTATTGGGGAGG + Intronic
1045097934 8:98817496-98817518 CTTTAGAAGAGGAAGTGGGTAGG - Intronic
1045217759 8:100165555-100165577 CTGGATAAGGGTGAGTGGGGCGG - Intronic
1045422233 8:102027441-102027463 ATGGAGATGGGGAACTGGTTGGG - Intronic
1045476326 8:102555830-102555852 CTGCAGAAGTGGAAGTGAGTTGG + Intronic
1045541949 8:103094898-103094920 CCGGAGCAGGGGAAGAGGGATGG + Intergenic
1046070911 8:109252160-109252182 ATGGTGAGGGGGATGTGGGTTGG + Intronic
1046778334 8:118188014-118188036 AAGGAGAAGGGTAAATGGGTTGG + Intergenic
1046854800 8:119019029-119019051 CTGCAGAAGGGGAAGATAGTAGG - Intronic
1047002557 8:120587400-120587422 GTGGGGAATGGGTAGTGGGTTGG - Intronic
1047217469 8:122888060-122888082 CTGGAGAAGGGGTAGAGAGGGGG - Intronic
1048027694 8:130601771-130601793 CTGGTGTGGGAGAAGTGGGTGGG - Intergenic
1048214783 8:132484131-132484153 ATGGAGGAGGGGAAGCAGGTGGG - Intergenic
1048317912 8:133375552-133375574 CTGGAGAAGGGGAGGGCAGTGGG + Intergenic
1048349433 8:133604114-133604136 CTGGAGGATGAGAAGTGGGGTGG - Intergenic
1048983386 8:139715368-139715390 CAGTAGAAGGGGAAGTGAGCAGG + Intergenic
1049277541 8:141727394-141727416 CTGCAGAAGGAGAGCTGGGTGGG + Intergenic
1049280842 8:141743387-141743409 CTGGAGAAGGGTAATGGGGAAGG + Intergenic
1049532062 8:143159824-143159846 CTGGAGAAGGGGCTGGGGGTGGG - Intronic
1049687207 8:143943794-143943816 CTGGCGCAGGGGACGTCGGTGGG - Intronic
1049748817 8:144274053-144274075 GAGGAGAAGGGGAGGTAGGTGGG + Intronic
1049825863 8:144667385-144667407 CTGGAGATTGGGAAGGGGGTGGG - Intergenic
1049844280 8:144792518-144792540 CTGGAGGAGGAGAAGTAGGCGGG - Exonic
1049986268 9:954574-954596 TTGGAGGAGGAGAAGTTGGTAGG + Intronic
1050306646 9:4311788-4311810 CAGGAGCAGGGAAAGTGGTTAGG + Intronic
1050516751 9:6452541-6452563 CTAAAGATGGGGAAGTGTGTTGG + Intronic
1050690750 9:8223835-8223857 CAGGAGAAGAGGAAGGGGGAAGG + Intergenic
1051524768 9:18031602-18031624 CTGGGGAAGGGGAGATGGGAGGG + Intergenic
1051965331 9:22821576-22821598 CTGAAGAAGTGGTAGTTGGTTGG - Intergenic
1053336001 9:37271942-37271964 GAGGACAAGGGTAAGTGGGTAGG + Intronic
1053453742 9:38214719-38214741 AAGGAGAAGGGGAAAGGGGTTGG + Intergenic
1054734081 9:68732896-68732918 CTGGTGATGTGGAGGTGGGTTGG + Intronic
1054803974 9:69380656-69380678 CTGGAGTAGCGGAGGTGGGGTGG - Intronic
1055858267 9:80718052-80718074 CAGGAGTAGGGGAAATGGGAAGG - Intergenic
1056424972 9:86466815-86466837 GTGGAAGATGGGAAGTGGGTTGG + Intergenic
1056728965 9:89147503-89147525 GTGGAGAAGGGGAAGCGGAGAGG - Intronic
1057164879 9:92917580-92917602 CAAGAAAAGGGGAAGTGGCTGGG - Intergenic
1057220134 9:93253101-93253123 ATGGGGATGGGGAAGGGGGTGGG - Intronic
1057314325 9:93958903-93958925 CTGGAGTAGGAGAAGGGTGTGGG - Intergenic
1057546391 9:96022318-96022340 CAGGCTAAGGGGAATTGGGTAGG + Intergenic
1057721429 9:97535056-97535078 CTGGAGAGGTGGGAGTAGGTTGG + Intronic
1058999847 9:110337153-110337175 CTGGAGGAGGGGAGGGGGTTTGG - Intronic
1059269127 9:113061204-113061226 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059270263 9:113066653-113066675 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059271399 9:113072103-113072125 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059272530 9:113077547-113077569 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059273665 9:113082989-113083011 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059274801 9:113088435-113088457 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059520218 9:114933797-114933819 CTGGAGATGGTGAGGCGGGTTGG - Intergenic
1059891933 9:118813556-118813578 CTGGGGAAGAGGGAGTGGGGCGG - Intergenic
1060013365 9:120064437-120064459 AAGGAGAAGGGGAAGTGAGCAGG - Intergenic
1060215902 9:121738035-121738057 CTGGAGGTGGGGAGGTGGGCTGG + Intronic
1060634409 9:125189153-125189175 CTGAGGAAGGGGAAGGCGGTGGG - Intronic
1060765214 9:126290498-126290520 CTGGAGAATGGAAATTGGGTTGG - Intergenic
1061430251 9:130526335-130526357 CTGGCCGAGGGGAAGTGGGATGG + Intergenic
1062576603 9:137211792-137211814 CACGGGAAGGGGAGGTGGGTGGG + Intronic
1062722263 9:138050613-138050635 CAGGAGGAGGGGAAGGGGTTGGG + Intronic
1203734228 Un_GL000216v2:120493-120515 CTGGGGAGGCTGAAGTGGGTTGG + Intergenic
1185967149 X:4619478-4619500 TTGGAGAAGGGTAGGTGAGTTGG + Intergenic
1185993329 X:4915806-4915828 CTGGAGAAGTGGCTGTGGCTTGG + Intergenic
1186443911 X:9609463-9609485 CTGGAGAAGGTCAAGTGGAAGGG - Intronic
1186732883 X:12429140-12429162 CTGGAGAAGGGGAAGACACTGGG + Intronic
1186748207 X:12592444-12592466 CTGGAGAAAGAGAAGTGTGTAGG - Intronic
1187522931 X:20029243-20029265 CTGGACTGGGGGGAGTGGGTGGG + Intronic
1188456146 X:30368645-30368667 CTGAAAGAGAGGAAGTGGGTAGG + Intergenic
1188471287 X:30542528-30542550 CTGAAGAAGTGGTAGTCGGTTGG - Intergenic
1188994150 X:36861731-36861753 CTGGAGACAGGGAGGTGGCTGGG - Intergenic
1189943867 X:46156750-46156772 GTGCAGAAGGGGGTGTGGGTGGG - Intergenic
1190101532 X:47526013-47526035 TGGGAGCAGGGGAGGTGGGTGGG + Intergenic
1190407664 X:50103747-50103769 ATTGAGAAGTGGAAATGGGTGGG + Intergenic
1190455559 X:50624524-50624546 CTTGAGAAGGGGACCTGGTTTGG - Intronic
1190511037 X:51174714-51174736 CTGAAGAGGGGGAAATGGGAAGG + Intergenic
1190559723 X:51675070-51675092 TTGGAGAAGGAGAACAGGGTGGG - Intergenic
1190564568 X:51718251-51718273 TTGGAGAAGGAGAACAGGGTGGG + Intergenic
1190873066 X:54440726-54440748 CAGGAGAAGGCCAAGTGGCTGGG + Exonic
1192086249 X:68100490-68100512 TGGGAGGAGGGGAAATGGGTGGG + Intronic
1192238705 X:69313234-69313256 GTGTAGAAGTGCAAGTGGGTGGG - Intergenic
1193399056 X:81020825-81020847 CTGGTGAAGAGGAGGTGGTTGGG + Intergenic
1194756046 X:97741210-97741232 CTGGAGAAGGGGCTGGGAGTGGG + Intergenic
1195375208 X:104219860-104219882 TTGGTGAAGTGGGAGTGGGTTGG + Intergenic
1195534048 X:105990625-105990647 GTGGATAAATGGAAGTGGGTAGG - Intergenic
1195668918 X:107452903-107452925 CTGGAGATGGGGGTGGGGGTGGG + Intergenic
1195681118 X:107547367-107547389 GTGGAGAAGGGGAAGTAGAAGGG - Intronic
1196126009 X:112099572-112099594 CTGGAGCCTAGGAAGTGGGTGGG + Intergenic
1196754199 X:119143595-119143617 CTGGAGAAGAGGAAAGGGGGAGG - Intronic
1197063628 X:122212843-122212865 TGGGGGAAGGGGAAGTGGGGAGG + Intergenic
1197160156 X:123313876-123313898 CTGGAGAAGGGGCAGCAGGGTGG + Intronic
1198270373 X:135051401-135051423 CTGGAGGAGTGGAGGTGGGTTGG + Exonic
1198278145 X:135116949-135116971 CTCGGGACGGGGAAGGGGGTGGG - Intergenic
1198292817 X:135255567-135255589 CTCGGGACGGGGAAGGGGGTGGG + Intronic
1198839800 X:140844276-140844298 CTGGAGAATGGGGGATGGGTAGG + Intergenic
1199118186 X:144017686-144017708 ATTGGGAAGGGGATGTGGGTGGG - Intergenic
1199392671 X:147299061-147299083 CTGCAGCTGGGAAAGTGGGTAGG - Intergenic
1199559841 X:149150951-149150973 CTGGTGAAGAGCAAGAGGGTGGG + Intergenic
1199692752 X:150321048-150321070 CTGGAGCAAGAGAAGTGTGTAGG + Intergenic
1199812003 X:151359449-151359471 CTGCAGCAGGGAAAGTGTGTTGG - Intergenic
1199987403 X:152962600-152962622 CTGGAGAAGGTGGACTGGATGGG - Intronic
1201010899 Y:9547656-9547678 TTGGACTAGGGGAAGTGAGTCGG - Intergenic