ID: 1095958297

View in Genome Browser
Species Human (GRCh38)
Location 12:47819044-47819066
Sequence CTGTGTGAGGGGTGGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1094
Summary {0: 1, 1: 0, 2: 11, 3: 112, 4: 970}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095958297_1095958309 10 Left 1095958297 12:47819044-47819066 CCTGTCCCCCACCCCTCACACAG 0: 1
1: 0
2: 11
3: 112
4: 970
Right 1095958309 12:47819077-47819099 CCCGCTTCCCGCGCCGCTGCCGG 0: 1
1: 1
2: 1
3: 22
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095958297 Original CRISPR CTGTGTGAGGGGTGGGGGAC AGG (reversed) Intronic
900244257 1:1630273-1630295 CCGTCTGCGGGGTGGGGGACGGG - Exonic
900319100 1:2073729-2073751 GGATGTGAGGGGCGGGGGACAGG + Intronic
900605602 1:3522332-3522354 CTGTGTGAGTGGTGGGCTCCCGG - Intronic
900629361 1:3625396-3625418 CGGGTTGCGGGGTGGGGGACGGG - Intronic
900635881 1:3664709-3664731 CTGTGAGATGGTTGGGGGGCAGG + Intronic
900655902 1:3756915-3756937 CAGAGAGAGGGGTGGGGGGCCGG - Intronic
901161201 1:7177687-7177709 CTGTGTGTGGGGAGGGGTACTGG - Intronic
901879412 1:12185203-12185225 CTGGGGGAGGGGTGGCGGAGGGG - Intronic
902092678 1:13915996-13916018 CTGTGGCAGGGGTTGGGGGCCGG + Intergenic
902250788 1:15153374-15153396 GTGTGTGACGGGTGGTGGTCGGG - Intronic
902383594 1:16064240-16064262 CAGTGTGTGGGGTAGGGGAGGGG - Intronic
902413483 1:16225741-16225763 CTGTGGAAGGGTTGGGGGATGGG - Intergenic
902529685 1:17082781-17082803 CAGTGTGAGGGGAGGAGGATGGG - Intronic
902667283 1:17948551-17948573 CAGGGTGAGGGCAGGGGGACAGG - Intergenic
902717671 1:18283577-18283599 CTGTGTAGGGGGAGGGGCACAGG - Intronic
902821271 1:18944770-18944792 CTGGCTGAGGGATGGGGGACAGG + Intronic
902943894 1:19820053-19820075 CTTGGTGAGGGGTGGGGGTGGGG - Intergenic
903224197 1:21885646-21885668 TGGAGTGAGGGGTGGGGGCCGGG - Intronic
903229538 1:21913490-21913512 CTGTCTGAGGGCAGGTGGACAGG - Intronic
903569442 1:24293691-24293713 GTGGGAGATGGGTGGGGGACAGG - Intergenic
904455295 1:30644179-30644201 CAGGGTGAGGGGTGTGGGCCGGG - Intergenic
905120885 1:35681031-35681053 GTGTGTGGGGGGTGGGGTGCAGG - Intergenic
905274107 1:36806065-36806087 CTGTGGGAGGGGTGGGTGTGTGG - Intronic
905751027 1:40464127-40464149 CTGGGTCGGGGGTGGGGGAGGGG - Intergenic
906079734 1:43077393-43077415 GTGGGGGAGGGGCGGGGGACGGG - Intergenic
906219697 1:44069026-44069048 TTCTGTGAGGGGAGGGGGTCAGG - Intergenic
906326667 1:44850439-44850461 CTGTGGGTGAGGTGGGGGAAGGG + Intergenic
906420897 1:45666039-45666061 GTTTTTGAGGGGTGGGGGAAAGG - Intronic
906609652 1:47192547-47192569 CTTTGGGAGTGGTGGGGGAAGGG + Intergenic
906918388 1:50036492-50036514 ATGTGAGAGGGGTGAGGGATGGG - Intergenic
907049177 1:51318173-51318195 CTGTGCTTGGGGTGTGGGACCGG + Intronic
907221168 1:52907837-52907859 CTGGGTGTGGGGTGGAGGAGGGG - Intronic
907512217 1:54970185-54970207 CCCTGTGAGGGTTGGGGGGCAGG + Intergenic
907663475 1:56414553-56414575 GTGTGTGTGTGGTGGGGGGCAGG - Intergenic
907847132 1:58219190-58219212 CTGTGTGAGGAGGGGAGGAGAGG - Intronic
907900560 1:58737393-58737415 ATGTGCGAGGGGTGGGGAAGAGG + Intergenic
909100868 1:71346099-71346121 CCTGTTGAGGGGTGGGGGACTGG + Intergenic
910453674 1:87372761-87372783 CTGTGTCAGGGTTGGGGCAGGGG - Intergenic
910981471 1:92962727-92962749 CTGTGTGTGGGTTGAGGGAAGGG - Intergenic
911090788 1:94015423-94015445 CTGGGTGAGGGGTTGGGGAATGG + Intronic
911168314 1:94744825-94744847 GTGTGGGAGGGGAGGTGGACAGG + Intergenic
911790313 1:102006698-102006720 TAGTGTGAGGGGTAGGGGAGAGG - Intergenic
913036541 1:114971283-114971305 CACTGTGAGGGGTGGGGTAGTGG + Intronic
913121720 1:115748512-115748534 CTGAATGAGGGGTGGGGGTGGGG - Intronic
913450292 1:118988314-118988336 CTGTCCGAGGGGTGAGGGAGAGG + Intronic
913688698 1:121257952-121257974 TTGTGTGTGGGGTGGGGGGGTGG + Intronic
914049265 1:144118171-144118193 CTATTGCAGGGGTGGGGGACTGG + Intergenic
914129919 1:144847274-144847296 CTATTGCAGGGGTGGGGGACTGG - Intergenic
914937052 1:151990847-151990869 CTCTATGAGGGCTGGGGCACTGG - Intronic
915061574 1:153190192-153190214 CTGTATGAAGGGTGGGAGACAGG - Intergenic
915443126 1:155958905-155958927 GTGGGTGGGGGGTGGGGGGCGGG + Intronic
915622643 1:157095322-157095344 CTGAGTGAGGGGTGGAGGTGAGG + Intronic
915686086 1:157636255-157636277 CTGGGCCAGGGGTGGGTGACTGG + Intergenic
915769682 1:158407292-158407314 CTGTGTGTGTGTCGGGGGACGGG + Intergenic
915932324 1:160068353-160068375 CTGAGTGGGGGGTGGGGGGATGG + Intronic
915932594 1:160069604-160069626 CTGTATGGGGAGTGGGGGAGGGG + Intronic
916273032 1:162964243-162964265 CTGTCTAAGGGGTGGGGGATAGG + Intergenic
916313995 1:163427387-163427409 GTGTGGGAGGGGCTGGGGACAGG + Intergenic
916854702 1:168737570-168737592 CTGTGTGGGTGGTGTGTGACAGG - Intergenic
917838729 1:178960734-178960756 CTGAGGGAGGGGTGGGTGGCAGG - Intergenic
918213210 1:182370143-182370165 TTGGGTGAGGGGCAGGGGACAGG + Intergenic
919365237 1:196651266-196651288 GTGTGTGGGGGGTGTGGGAGAGG + Intergenic
919723651 1:200866996-200867018 GTGTGAGTGGGGTGGGGGGCGGG - Intergenic
919918558 1:202154113-202154135 CTGTGTGTGGGGTGGGGGTGGGG + Intronic
919977992 1:202625451-202625473 CAGTGTGCGGGGAGGGGGAAGGG + Intronic
920048040 1:203146154-203146176 CAGTGTCAGGGGTGGGGGAGGGG + Intronic
920371837 1:205484082-205484104 GTGTTTGAGGGAGGGGGGACAGG - Intergenic
920387401 1:205578722-205578744 CTGAGAGAGGGGAGGGGGAAAGG - Intronic
920476022 1:206276453-206276475 TTGTGTGTGGGGTGGGGGGTGGG + Intronic
920587363 1:207179698-207179720 CTGTCTGAAGGATGGGAGACTGG + Intergenic
920694816 1:208174276-208174298 TTGTGTGTGGGGTTGGGGGCTGG + Intronic
921435052 1:215108832-215108854 GTGTGTGAGGGGTTGGGGAGAGG + Intronic
921598633 1:217082655-217082677 GTGTGTGTGGGGTGGGGGTGAGG - Intronic
921752885 1:218817994-218818016 CTCTGTAAGGGGAGGGGGGCGGG - Intergenic
922130470 1:222772239-222772261 TTGTGTGGGGGGCGGGGGGCGGG + Intergenic
922538573 1:226401891-226401913 CTGTGTGGTGGGAGGGGGAGGGG + Intronic
923663311 1:235977622-235977644 CTGTCTGAGGGTTGGGGGTAGGG + Exonic
924380718 1:243461843-243461865 GTGTGTGAGGGCTGTGGGCCAGG - Intronic
924432287 1:244007455-244007477 ATGTGGCAGGGGTGGGTGACAGG - Intergenic
924438541 1:244067491-244067513 CTGTGGGAGGCAGGGGGGACTGG + Intergenic
924554650 1:245108123-245108145 CTGGGTGACGGGTGGGTGACGGG - Intronic
1063370474 10:5518654-5518676 GTGTGTGGGGGGTGGGGTAGGGG + Intergenic
1063624290 10:7675023-7675045 TTGTGTGTGGGGGGGGGGGCGGG - Intergenic
1064906154 10:20348031-20348053 GTGTGTGTGTGGTGGGGGAGGGG - Intergenic
1065861749 10:29877819-29877841 GTGTGTGTGTGGTGGGGGAGAGG - Intergenic
1067081282 10:43213960-43213982 CTGTGTGCTGCCTGGGGGACGGG - Intronic
1067228333 10:44389717-44389739 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1067471523 10:46541582-46541604 GTGGGCGAGGGGTGGGGGAGGGG + Intergenic
1067477761 10:46578002-46578024 GTGTGTGTGGGGGGGGGGAGGGG - Intergenic
1067479460 10:46585475-46585497 CTGTGTGAGGGGTGGGGCCCTGG + Intronic
1067615278 10:47756323-47756345 CTGTGTGAGGGGTGGGGCCCTGG - Intergenic
1067699405 10:48557833-48557855 CTGGGTGGGGGTTGGGGGCCTGG + Intronic
1068045490 10:51881041-51881063 ATGTGGGATGGGTGGGGGAGGGG + Intronic
1068274305 10:54773091-54773113 CTGTCCAAGGGGTGGGGGGCAGG + Intronic
1068585810 10:58796923-58796945 CTGTATGAGGGGTGGGGAGGGGG + Intronic
1069219608 10:65867140-65867162 ATGTCTGAGGTGTGGGGGACAGG + Intergenic
1069778709 10:70941682-70941704 CTGTGTGAGGGGTGGGGAGGAGG + Intergenic
1069893679 10:71667404-71667426 GTGTGTGAGGGGTGGAGGTGTGG + Intronic
1069934030 10:71902771-71902793 ATGTGGCAGGGGTGGGGGATGGG - Intergenic
1070161340 10:73868366-73868388 AGGTGGGAGGGGAGGGGGACAGG + Intronic
1070428386 10:76311859-76311881 CTGTGTGAGGTTTGGGGACCTGG - Intronic
1070741583 10:78907048-78907070 CTGTGTGGAGGGAAGGGGACAGG - Intergenic
1070747715 10:78944848-78944870 CTGGGTGAGGGCAGGGGGAAGGG - Intergenic
1070783505 10:79150419-79150441 ATGTGTGGGGGGTGCAGGACGGG - Intronic
1071124830 10:82321289-82321311 CTGTGGCAGGGGTGGGGGTGGGG + Intronic
1071333321 10:84582567-84582589 CTGTGTGAGGCTTGGGGGTGGGG - Intergenic
1071630679 10:87216274-87216296 CTGTGTGAGGGGTGGGGCCCTGG - Intergenic
1071669119 10:87590692-87590714 CTGTTTGCGGGGAGGGGGCCTGG - Intergenic
1071965329 10:90846023-90846045 CTGTGGGAAGGATGGGTGACAGG + Intronic
1073134408 10:101212192-101212214 CTGTGTGACAGGAGGGGTACTGG - Intergenic
1073442100 10:103558249-103558271 GTGAGTGAGGGGAGGGTGACAGG + Intronic
1073539147 10:104304155-104304177 GTGTGTGTGTGGTGGGGGATGGG - Intronic
1073865789 10:107802018-107802040 GAGTGTGAGTGGTGGGTGACAGG - Intergenic
1074372729 10:112913366-112913388 GTGTGTGAGGGGTGGGTGTGTGG + Intergenic
1074707506 10:116148120-116148142 ATGTGTGTGGGGTGGGGGGTAGG + Intronic
1074722436 10:116274165-116274187 GTGTGTCAGGCGTGGGGGGCGGG - Intergenic
1075005544 10:118827407-118827429 CTCTGAGAGGGGTTGGGGAAGGG - Intergenic
1075280686 10:121135674-121135696 CGGAGTGTGGGGTGGGGGAGGGG + Intergenic
1075420865 10:122299293-122299315 CTGTGTGTGGGGCTGGGGAGAGG + Intronic
1075718624 10:124571946-124571968 GTGAGTGAGGGGTTGGGGAAGGG + Intronic
1075952818 10:126496811-126496833 CTGTGGGCTGGGTGGAGGACAGG - Intronic
1076290257 10:129340498-129340520 GTGTGTGCAGGGTGGGGGATGGG - Intergenic
1076319462 10:129567215-129567237 CTGTGAGAGGTGGAGGGGACGGG - Intronic
1076405186 10:130207125-130207147 GTGTGTGTGTGGGGGGGGACAGG - Intergenic
1076620259 10:131782696-131782718 CTGTATTGGGGGTGGGGAACAGG + Intergenic
1076749394 10:132535009-132535031 CTGGGTGAGTGCTGGGGGGCAGG + Intergenic
1076819323 10:132930829-132930851 CTGTGTGAGGAGTGTGGGGAAGG - Intronic
1076819341 10:132930891-132930913 CTGTGTGAGGAGTGTGGGGAAGG - Intronic
1077101403 11:824129-824151 CGGTGTGAGGGCTGGGGGGTCGG + Exonic
1077274103 11:1695376-1695398 CTGTGTGTGGGGTGGGGCACTGG + Intergenic
1077275574 11:1705777-1705799 CAGTGTGGTGGGTGGGGGGCTGG + Intergenic
1077296264 11:1827620-1827642 CTGTGTGAGGTGCGGGGCACAGG + Intergenic
1077889243 11:6406787-6406809 CTGTGAGAGTGGTGGGGGAGAGG - Intronic
1078058896 11:8031203-8031225 CTGTGTGAACGGGGTGGGACTGG + Intronic
1078085760 11:8232262-8232284 CTGAGAGAGGGATGGGGCACAGG + Intronic
1078101144 11:8331047-8331069 CTCTGTGAGAGATGGGGGAATGG - Intergenic
1078216204 11:9314255-9314277 CTGTGTGTCGGGTGGGGAAAAGG - Intronic
1078469416 11:11575202-11575224 CTGTGGGTGGGGTGTGGGGCTGG + Intronic
1078672304 11:13376318-13376340 CTGTGTGAGGGGCCGGGGCTAGG + Intronic
1078741999 11:14075427-14075449 CTGTGGGTGGGGAGGGGGAGGGG + Intronic
1078852778 11:15179550-15179572 CTGTGGGAGGAGTGGGGGTGAGG - Intronic
1079026230 11:16950072-16950094 GTGTGTGTGGGGCGGGGGGCGGG + Intronic
1080438414 11:32268048-32268070 CTATGTGTGGGGTGGGGGAGTGG - Intergenic
1081581646 11:44356342-44356364 CTGAGGGAGGGGTTGGGCACAGG - Intergenic
1081626670 11:44660032-44660054 CCCTGTGAGGGATGGGGGCCTGG - Intergenic
1082071601 11:47943949-47943971 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
1082117416 11:48342529-48342551 CTGTGTGGGGGATGGGGGCTAGG - Intergenic
1082783536 11:57304120-57304142 GTGTGTGTGGGGTGGGGGTGTGG - Intronic
1083582266 11:63832590-63832612 CTGTGTGTGGGGTGGAGGTGGGG - Intergenic
1083610004 11:64000070-64000092 GGGTGTGCGGGGTGGGGGCCGGG + Intronic
1083656285 11:64231215-64231237 CTCTGTGGGGGGTGGGAGATGGG + Intronic
1083997269 11:66278561-66278583 CTGGGGGCGGGGTGGGGGGCAGG + Intronic
1084177866 11:67432902-67432924 CTGTGGGTGGGGTGGGGCCCTGG + Intronic
1084213748 11:67635680-67635702 ATGTGTGTGGGGCGGGGGAGGGG + Intronic
1084542775 11:69797752-69797774 CCGTATGAGGGGTGTGGGGCTGG + Intergenic
1084547631 11:69822281-69822303 TTGTGTGTGGGGTGGGGCAGAGG + Intergenic
1084587895 11:70073843-70073865 CTGTCTTGGGGGTGGGGGGCGGG - Intergenic
1084588024 11:70074473-70074495 TGGTTTGAGGGGTGGGGGTCAGG + Intergenic
1084824791 11:71722030-71722052 CTGTGTGAGGAGTGCATGACAGG + Intergenic
1085066956 11:73505004-73505026 CAGGGTGAGGGGTGAGGGAAGGG + Intronic
1086030847 11:82353283-82353305 CTGTCAGAGGGTTGGGGGATAGG + Intergenic
1086242397 11:84711409-84711431 GTGTGTGGGGGGTGGGGGAGGGG - Intronic
1086433926 11:86763097-86763119 CTGTGTGAGGGAGTGGGGGCAGG + Intergenic
1087385784 11:97466794-97466816 CTGAGGCAGGGGTGGGGGTCAGG - Intergenic
1087957507 11:104306839-104306861 TTGTGTGTGGGGTGGGGGGTTGG + Intergenic
1088884276 11:113994763-113994785 GTGTGTGATGGGGTGGGGACTGG - Intergenic
1089188544 11:116637434-116637456 CTGTGTGATGGGGGTGGGATGGG - Intergenic
1089430293 11:118418009-118418031 ATGAGTCAGGGGTAGGGGACTGG + Intronic
1089709729 11:120306316-120306338 CTCAGTGAGGGGTGGTGGCCGGG + Intronic
1090225731 11:125071130-125071152 GTGTGTGTGGGGTGGGGGGGCGG + Intronic
1090634802 11:128684256-128684278 CTGGGTGTGGGGGGGGGGGCAGG - Intergenic
1091345186 11:134847585-134847607 ATGTGTGAGGGGAGGGGTCCCGG + Intergenic
1091406517 12:212893-212915 GGGGGTGAGGGGTGGGGGATGGG + Intronic
1091479362 12:810867-810889 CTGGGGGTGGGGTGGGGGTCAGG - Intronic
1091658041 12:2360164-2360186 GTGTGTGTGGGGTGGGGGGGTGG - Intronic
1092075690 12:5671486-5671508 CTGTGTGGGGGGTGGCGGGGGGG + Intronic
1092253961 12:6916267-6916289 GTGTGTGTGGGGTGGGGGTGGGG + Intronic
1092346189 12:7716455-7716477 ATGTGTGGGGTGTGGGGGAAAGG - Intronic
1092996932 12:13959475-13959497 CTGTGTGGAGGGTGGAGGAGAGG + Intronic
1093008462 12:14078205-14078227 CTGTGAGGGGGGTCGGGGATGGG + Intergenic
1093347476 12:18056791-18056813 TTCTGTGAGGGCTGGGGGGCGGG - Intergenic
1094423785 12:30298541-30298563 CTGTGTGGGGGTGGGGGCACAGG - Intergenic
1094816104 12:34186409-34186431 CTGGGTGGGGGGTGGGGGAGTGG + Intergenic
1095100999 12:38183861-38183883 CTGGGTGGGGGGTGGGGTAATGG - Intergenic
1095958297 12:47819044-47819066 CTGTGTGAGGGGTGGGGGACAGG - Intronic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096465974 12:51848066-51848088 GTGTGGGAGGGGTGGGGGCTGGG - Intergenic
1096578818 12:52571325-52571347 CAGGGTGAGGGTGGGGGGACAGG + Intronic
1096800392 12:54106801-54106823 AAGGCTGAGGGGTGGGGGACAGG - Intergenic
1096837772 12:54361995-54362017 CAGAGTGAGGGCTGGGGGACTGG + Intergenic
1097223416 12:57463191-57463213 CTGAGTGAGGGGAGGGGTAAGGG - Intronic
1097232608 12:57521760-57521782 CTGTGTGAGGAGCGCGGCACAGG + Intronic
1098359085 12:69637679-69637701 CTGTCTGAGAGATGGGTGACTGG - Intergenic
1099478776 12:83140824-83140846 ATGTGTGTGGGGCGGGGGATGGG + Intergenic
1099566622 12:84256780-84256802 GTGTGTGAGGGTAGGGGGAGTGG + Intergenic
1099790194 12:87324239-87324261 TTGTGTGTGTGGTGGGGGAGTGG - Intergenic
1100542054 12:95566961-95566983 CTGTGTGTGGGGCGGGGGAGAGG - Intergenic
1101078392 12:101154972-101154994 CTGTGGTAGGGTTGGGGGAGGGG + Intergenic
1101140693 12:101792641-101792663 CTTTGTGAGAGGTGAGGGAAGGG - Intronic
1101399456 12:104375089-104375111 GGGTGTGAGGGGTGGTGGGCTGG + Intergenic
1101490011 12:105201576-105201598 GTCTGTGTGGGGTGGGGGAGGGG - Intronic
1102494471 12:113309855-113309877 CTATGTGGGGGGTGGGGAAATGG + Intronic
1102867337 12:116384679-116384701 CAGATTGAGGGGTGGGGGAGGGG - Intergenic
1103426981 12:120844523-120844545 GTGTGTGGGGTGTGGGGGGCAGG - Intronic
1103576759 12:121883226-121883248 GTGTGTGTGTGGTGGGGTACAGG + Intergenic
1103612479 12:122132394-122132416 CTGGGGGATGGGTGGGGGAAGGG + Intronic
1104661381 12:130613417-130613439 CTGCCTGCGGGGTGGGGGGCTGG - Intronic
1104958541 12:132477421-132477443 GTGGGGGAGGGGTGGGGGATGGG - Intergenic
1105064635 12:133185687-133185709 CTGAGTGCTGAGTGGGGGACAGG + Intronic
1105209202 13:18247886-18247908 GGATGTGAGGGGTGGGGCACCGG + Intergenic
1105681138 13:22728684-22728706 GGGTGTGGGGGGTGGGGGAGGGG + Intergenic
1106148916 13:27079209-27079231 CTGTGTGGGGCGGGGGGGAGTGG + Intronic
1106395089 13:29371973-29371995 GTGTGTGTGGGGGGGGGGGCGGG - Intronic
1106407411 13:29485916-29485938 CAGTGTGTGGGGTGGGGGCGGGG + Intronic
1106411890 13:29516389-29516411 CTGTGTGTGGGGTGTGGGAGTGG - Intronic
1106540746 13:30688203-30688225 CTTGTTGAGGGGTGGGGGGCTGG - Intergenic
1106620052 13:31364326-31364348 CTGTGTGAGAGGAGGGGGTCAGG - Intergenic
1106878679 13:34105159-34105181 GTCTGTGAGTGTTGGGGGACTGG + Intergenic
1107111835 13:36706574-36706596 CTGTCTGAGGGTTGGGGCAGGGG + Intergenic
1107169062 13:37317695-37317717 CTGTGTGAGCCTTGGGGGATGGG + Intergenic
1107552576 13:41491071-41491093 GTGTGTGTGGAGTGGGGGAGGGG + Intergenic
1108409847 13:50134437-50134459 ATGTGTGAAGGGTGGGGATCTGG + Intronic
1108443700 13:50484425-50484447 CTGTGAGATAGGTGGTGGACTGG - Intronic
1108714852 13:53068957-53068979 CTTTGTGAGGGTGGAGGGACTGG + Intergenic
1109008593 13:56910166-56910188 CTTTGTTAGCGGTGGGGGCCGGG - Intergenic
1109045222 13:57402166-57402188 GTGTGTGTGGGGTGGGGGGGAGG - Intergenic
1110480900 13:75974772-75974794 ATTTGTCGGGGGTGGGGGACAGG + Intergenic
1110504191 13:76266146-76266168 CTGTGTGTGGGCGGGGGGAGGGG - Intergenic
1111833207 13:93355725-93355747 CTGTGTGGGAGCTGGGGAACAGG + Intronic
1111968235 13:94882794-94882816 GTGTTTGGGGGGTGGGGGGCGGG - Intergenic
1112335838 13:98515288-98515310 CTGTGTGTGGGGTTGGGTAGGGG - Intronic
1113798566 13:113074711-113074733 GTGTGGGAGGGGAGGGGTACAGG - Intronic
1113798570 13:113074722-113074744 CTGTGGGTGGGGTGTGGGAGGGG - Intronic
1113804748 13:113106461-113106483 GTGTGTGGGGTGTGGGGGATGGG + Intronic
1113934520 13:113986686-113986708 GTGAGTGATGGGTGGAGGACAGG - Intronic
1113934973 13:113989178-113989200 GTGAGTGATGGGTGGAGGACAGG - Intronic
1114529792 14:23388552-23388574 CTGTGTGGGGGGTGAGGGCAGGG - Intronic
1114570057 14:23660610-23660632 GGGTGTGAGGGGTGGGGCCCAGG + Intergenic
1114835420 14:26197891-26197913 TGGTGTGTGTGGTGGGGGACTGG + Intergenic
1115003050 14:28444133-28444155 CTGTGTGTGGGGGGGGAGAGGGG + Intergenic
1115193890 14:30775862-30775884 GTGTGTGTGGGGTGGGGCAGCGG - Intergenic
1115269078 14:31531879-31531901 CTGTGTGTGGACTGGGGGAGTGG - Intronic
1115474357 14:33799713-33799735 CTCTGTGTGGGGCGGGGGGCCGG - Exonic
1115557139 14:34552849-34552871 CTGTGTGCGGGGGCGGGGAGGGG - Intergenic
1115671538 14:35617625-35617647 GTGTGTGTGGGGTGGGGGGGGGG + Intronic
1115759128 14:36560228-36560250 TTGTGTGTTTGGTGGGGGACAGG + Intergenic
1115888728 14:38003717-38003739 GTGTGTGTGTGGTGGGGGGCGGG + Intronic
1116234337 14:42258487-42258509 CTGGTTGTGGGGTGGGGGAGGGG + Intergenic
1116673892 14:47879992-47880014 GTGTGTGTGTGGTGGGGGAATGG + Intergenic
1117616483 14:57538963-57538985 CTGTCAGAGGGATGGGGGGCTGG - Intergenic
1118270509 14:64338637-64338659 CGGTCTGCGGGGAGGGGGACGGG - Intergenic
1118480418 14:66159240-66159262 CAATGTGAGGGCTGGAGGACGGG + Intergenic
1118495536 14:66304967-66304989 CTGGGGCAGGGTTGGGGGACTGG + Intergenic
1118952847 14:70450068-70450090 CAGTGAGTGGGGTGGGGGAGGGG + Intergenic
1119087161 14:71749299-71749321 CAGTGAGAGGAGTGGGGAACAGG - Intergenic
1119102270 14:71891004-71891026 CTCTGTGATGTCTGGGGGACAGG + Intergenic
1119526265 14:75324900-75324922 CTGAGTCAGTGGTGGAGGACTGG + Intergenic
1120240387 14:81943140-81943162 TTGTGTGTGTGGTGGGGGAAGGG + Intergenic
1120294020 14:82615937-82615959 CTGTGTGTGGGGGCGGGGAGGGG + Intergenic
1120305988 14:82771375-82771397 CTTTGGGAAGGGTGGGGGATAGG - Intergenic
1120392046 14:83921413-83921435 AAGTGTGAGGGGTGGGGAAATGG + Intergenic
1121117866 14:91356302-91356324 ACGTGTCAGGGCTGGGGGACGGG - Intronic
1121280305 14:92692814-92692836 GTGTATGTGGGGTGGGGGAAGGG - Intergenic
1121334588 14:93069584-93069606 CTGTCTGAGCTGTGGGGGAGTGG - Intronic
1122035124 14:98943197-98943219 TTTTGTGTGTGGTGGGGGACAGG - Intergenic
1122075097 14:99230771-99230793 GTGTGTGAGGGGTGGGGGCGGGG - Intronic
1122203026 14:100133975-100133997 CTTTGTGAGGCCTGGGGGTCGGG - Intronic
1122740586 14:103869591-103869613 GTGTGGCAGGGGTGGGGGATGGG + Intergenic
1122776299 14:104118353-104118375 CTGGGTGAGGAGGTGGGGACTGG - Intergenic
1122913589 14:104845515-104845537 CTGTGGGTGGGGTGGGGGAGGGG - Intergenic
1122918856 14:104871381-104871403 CTGTGCGTGGGGTGGGGGTGGGG - Intronic
1123042062 14:105494337-105494359 CTGGGTGAAGGGTTGGGCACAGG + Intronic
1123061635 14:105597198-105597220 CTGGGTGAGGCTTGGGGGACGGG + Intergenic
1123086373 14:105718928-105718950 CTGGGTGAGGCTTGGGGGACGGG + Intergenic
1123419203 15:20117739-20117761 CTGTTGCAGGGGTGGGGGACTGG + Intergenic
1123432112 15:20226786-20226808 GTGTGTGAGGGGTGGAGGGGGGG - Intergenic
1123446660 15:20335760-20335782 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1123528425 15:21124282-21124304 CTGTTGCAGGGGTGGGGGACTGG + Intergenic
1124425481 15:29559294-29559316 CTGTGTGAGGTGAGGGGAACAGG - Intronic
1124493600 15:30173375-30173397 CAGTGTGCGGGGAGGGGGAAGGG + Intergenic
1124749968 15:32365274-32365296 CAGTGTGCGGGGAGGGGGAAGGG - Intergenic
1125350316 15:38759988-38760010 CTGTGGTAGGGGTGGGGCAGAGG + Intergenic
1125591313 15:40856193-40856215 CAGTGTGAGGTCTGGGGCACTGG + Intronic
1125685882 15:41563021-41563043 CCTTGGGAGGGGTGGGGGATGGG - Intronic
1125746346 15:42000064-42000086 CTGGGGGAGGTGTGGGGGACTGG - Intronic
1126197634 15:45949789-45949811 CTGGGTGCTGGGTGGGGTACAGG + Intergenic
1126604799 15:50465335-50465357 GTGTGTGGGTGGTGGGGGAGGGG + Intronic
1127194261 15:56567410-56567432 GCTTGTCAGGGGTGGGGGACTGG + Intergenic
1127625045 15:60772205-60772227 CTGTCAGGGGGGTGGGGGCCTGG - Intronic
1128067504 15:64774400-64774422 GTGTGTGCGGGGTGGGGTGCTGG - Intronic
1128332402 15:66764058-66764080 CTGAGTGAGTGGTGGGTGATTGG + Intronic
1128527386 15:68421700-68421722 CTGGGTGGGGGGTGGGGGTGAGG + Intronic
1129269462 15:74411738-74411760 CTGAGTGTGGGGTGGGGCCCGGG - Intronic
1129354924 15:74983881-74983903 CTAAGTGAGGGGTTGGAGACCGG + Intronic
1129441391 15:75583463-75583485 CTGACTGTGGGGTGGGGGATGGG - Intergenic
1129465908 15:75724092-75724114 CCGTGTCTGGGGTGGGGGATGGG + Exonic
1129582082 15:76821986-76822008 TGGGGTTAGGGGTGGGGGACTGG + Intronic
1129660145 15:77548820-77548842 CTGTGTGAAGGGTGGGGGAAGGG + Intergenic
1129778347 15:78251991-78252013 AGGGGTGAGGGGTGGAGGACAGG - Intergenic
1130270403 15:82443303-82443325 CTGTGGGGAGGGTGGGGCACAGG - Intergenic
1130275565 15:82474528-82474550 CTGTGGGGAGGGTGGGGCACAGG + Intergenic
1130462748 15:84170622-84170644 CTGTGGGGAGGGTGGGGCACAGG - Intergenic
1130467924 15:84201920-84201942 CTGTGGGGAGGGTGGGGCACAGG + Intergenic
1130485762 15:84397587-84397609 CTGTGGGGAGGGTGGGGCACAGG - Intergenic
1130489929 15:84424165-84424187 CTGTGGGGAGGGTGGGGCACAGG + Intergenic
1130496342 15:84471622-84471644 CTGTGGGGAGGGTGGGGCACAGG - Intergenic
1130501517 15:84502915-84502937 CTGTGGGGAGGGTGGGGCACAGG + Intergenic
1130556526 15:84926783-84926805 CTGTGTGGGGGGTGGGGGGAGGG + Intronic
1130590216 15:85206518-85206540 CTGTGGGGAGGGTGGGGCACAGG + Intergenic
1131091771 15:89629198-89629220 CTGTGGGCTGGGTGGGGGCCGGG + Intronic
1131530839 15:93190438-93190460 CTGTGTGTGGGGAGGGTGAGAGG - Intergenic
1131534152 15:93220495-93220517 GTGTGGGTGTGGTGGGGGACAGG - Intergenic
1132637294 16:957781-957803 CTGTGTGTCGGGTCGGGGGCAGG - Intronic
1132671150 16:1102779-1102801 CTGTGGGAGGTGAGGGGGGCTGG - Intergenic
1132712828 16:1276910-1276932 CGGGGTCAGGGGTGGGGGCCAGG + Intergenic
1132826651 16:1908573-1908595 AGCTGTGAGGGGTGGGGCACTGG - Intergenic
1132878115 16:2149180-2149202 CCGCCTGGGGGGTGGGGGACAGG - Intronic
1133109151 16:3535318-3535340 TTGTGTGAGGGGAGAGAGACAGG + Intronic
1133216723 16:4297111-4297133 ATGTGTCATGGGAGGGGGACAGG + Intergenic
1133278773 16:4653283-4653305 CAGGGTGAGGTGTGGGGGAAGGG + Intronic
1133287377 16:4696913-4696935 CGGTGAGAAGGGAGGGGGACAGG + Intronic
1134619246 16:15675200-15675222 CTCTGGCAGTGGTGGGGGACTGG - Intronic
1134925280 16:18153726-18153748 CTGTTGGTGGGGTGGGGGGCTGG + Intergenic
1135585825 16:23670106-23670128 GTGTGTGAGGGTTGGGGGTGAGG - Exonic
1135771689 16:25222673-25222695 GTGTGTGGGGGGTGGTGGATGGG + Intronic
1135811998 16:25596060-25596082 CTGGTTGGGGGGTGGGGGGCTGG + Intergenic
1135896191 16:26405287-26405309 TTTTTTGGGGGGTGGGGGACAGG - Intergenic
1135932416 16:26749669-26749691 CTGTGTGAGGGGCTGGAGAAGGG - Intergenic
1136040259 16:27572969-27572991 GTGAGTGAGGGGTAGGGGAGGGG - Intronic
1136075933 16:27817232-27817254 CTGTGGCAGGGGTGGGTGTCAGG + Intronic
1136561090 16:31039700-31039722 CTGTGGGAGAGGAGGGGGTCAGG - Intronic
1136591274 16:31219210-31219232 ATGTCTGAGGGCTGGGGGCCAGG + Intronic
1136751371 16:32638322-32638344 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1136852526 16:33624353-33624375 GTGTGTGAGGGGTGGAGGGGGGG + Intergenic
1137272196 16:46909161-46909183 CTATGTCAGGGGTGGGGCCCAGG - Intronic
1137592332 16:49701260-49701282 GTGTGTGTAGGGTGGGGGACAGG + Intronic
1137626837 16:49914373-49914395 GTGTGTGAGGGATGGAGGAATGG + Intergenic
1137673564 16:50292832-50292854 CAGGGTGAGGAGTGGGGGCCGGG - Intronic
1137940380 16:52677869-52677891 CTGTGTAATGAGTGGGGGACTGG - Intergenic
1138198013 16:55068490-55068512 CTGTGTGGGGGGGGGGGGGCAGG - Intergenic
1138380197 16:56595352-56595374 AATAGTGAGGGGTGGGGGACTGG + Intergenic
1138531448 16:57636558-57636580 CTATGTGAGGGGTAGGGGATAGG - Intronic
1138618078 16:58188027-58188049 CTGTGTGTGGGGTGGGGAAGGGG + Intronic
1139628300 16:68209828-68209850 CTGTGTGTGTGTTGGGGGGCAGG - Intronic
1139751782 16:69113369-69113391 CTGGCAGTGGGGTGGGGGACAGG + Intronic
1140067856 16:71626015-71626037 CTGTGTGCTGGGTGGGGGCTGGG - Intergenic
1140256662 16:73342889-73342911 CTGTGTGGGGGCTGGGGAACTGG + Intergenic
1140295615 16:73706790-73706812 CTGGGTGGAGGGTGGGGGAACGG - Intergenic
1140409047 16:74730300-74730322 CTGTGGCAGGGGTGGGGGTTGGG + Intronic
1140472788 16:75224600-75224622 CTGTGTGTGGGGTCCTGGACTGG + Intronic
1140866597 16:79067618-79067640 GTGTGGGTGGGGTGGGGGGCGGG + Intronic
1141132833 16:81446840-81446862 TGGGGTGGGGGGTGGGGGACTGG - Intronic
1141166054 16:81661746-81661768 TGGGGTGAGGGGTGGGGGGCCGG - Intronic
1141188395 16:81805623-81805645 TTGTGAGTGGGGTGGGGGAAGGG - Intronic
1141436499 16:84002613-84002635 CCATGTGAGGGGTAGGGGAGAGG - Exonic
1141521021 16:84579605-84579627 CTGTGTGAGGTGGGGGGTAGTGG + Intronic
1141706115 16:85665653-85665675 GTGTGTGAGGGGCCGAGGACTGG - Intronic
1141893576 16:86944273-86944295 CTGGGTGAGGGGTGTGGACCTGG - Intergenic
1141896122 16:86959658-86959680 CTGGGTGAGGGGTGGGGATGGGG - Intergenic
1142203100 16:88770401-88770423 CTGTCTGTGGGGTGGGGGGACGG + Intronic
1203053505 16_KI270728v1_random:897577-897599 CTGTGGAAGGGGTGGGGGCAGGG + Intergenic
1203114126 16_KI270728v1_random:1472821-1472843 GTGTGTGAGGGGTGGAGGGGGGG + Intergenic
1203137893 16_KI270728v1_random:1740973-1740995 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1142703105 17:1676460-1676482 GGGTGTGAGTGGTGGGGGAGTGG - Intronic
1143016131 17:3892266-3892288 CTGCGTGGGGGGTGCAGGACAGG - Intronic
1143136799 17:4716655-4716677 CTGTGTCTGGGGTGGGGGTAAGG + Exonic
1143166758 17:4900740-4900762 CAGTGTGAAGGGTGGGGGCGTGG - Exonic
1143188507 17:5024425-5024447 CTATGGGTGGGGTGGGGGGCTGG + Exonic
1143324574 17:6090437-6090459 CTGTGTGCGGGGCTGTGGACCGG + Exonic
1143359712 17:6358990-6359012 CTATCTGAGGTGTAGGGGACAGG + Intergenic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1143471831 17:7180100-7180122 CTGTGTGATGGGTGTGGTTCTGG - Intergenic
1143615060 17:8044808-8044830 CTCTGCAGGGGGTGGGGGACAGG - Exonic
1143644847 17:8223507-8223529 CTGGGTGACTGGAGGGGGACAGG + Intergenic
1143653192 17:8277070-8277092 CTGTCTCAGGGGTGGGGGTGGGG + Intergenic
1143841682 17:9737224-9737246 GTGTGTGGGGGGTGGGGGGGTGG + Intergenic
1144012517 17:11163185-11163207 CTGTCAGGGTGGTGGGGGACAGG + Intergenic
1144452251 17:15390819-15390841 CTCGGTGAGAGGTGGTGGACGGG + Intergenic
1144890048 17:18489323-18489345 GGGTGTGGGGGGTGGGGAACTGG - Intronic
1145142168 17:20454994-20455016 GGGTGTGGGGGGTGGGGAACTGG + Intronic
1145230476 17:21170032-21170054 CTGGTTGAGGGGTGGGGGCTTGG - Intronic
1145808558 17:27751455-27751477 GGGTGTGGGGGGTGGGGAACTGG - Intergenic
1145897134 17:28465698-28465720 GTGTGTATGGGGTGGGGGAAGGG + Intronic
1146056644 17:29584676-29584698 CTGGGGTGGGGGTGGGGGACTGG + Intronic
1146169485 17:30621688-30621710 CTGGGTGAGGAGTTGGGGAGCGG + Intergenic
1146170077 17:30625761-30625783 CTGGGTGAGGAGTTGGGGAGCGG - Intergenic
1146393670 17:32444723-32444745 CTGTGTGAGGGGGGCCGGGCCGG + Intronic
1146619957 17:34389477-34389499 CTGGCTGAGGGGTGGGGGTAAGG + Intergenic
1146699231 17:34940167-34940189 CAGTGGGAGGGGAGGGGCACTGG - Intronic
1146833193 17:36088404-36088426 CGGTGTGAGGGAAGGGGGAGGGG + Exonic
1147167754 17:38602466-38602488 ATTTGTGGGGGGTGGGGGACAGG - Intronic
1147213837 17:38887627-38887649 CCAGGTGAGGGCTGGGGGACGGG + Intronic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147357725 17:39910824-39910846 CTGTATGTGGGGTGGGGCACTGG - Intronic
1147446400 17:40477748-40477770 CTGAGTGAGGGGTGGGACCCAGG + Intronic
1147887031 17:43691086-43691108 GTGTGTGAGGGGTGGGGGCAGGG + Intergenic
1148150941 17:45396178-45396200 CTGGGGCAGGGGTTGGGGACGGG + Intronic
1148243201 17:46013288-46013310 CTGTGTGGGGCCTGGGGGGCAGG - Intronic
1148700622 17:49584555-49584577 GGGAGTGAGGGGTGGGGGAGTGG + Intergenic
1148847698 17:50538884-50538906 CTGTGGGAGGCTGGGGGGACAGG - Exonic
1148920338 17:51026139-51026161 TTTTGTGGGGAGTGGGGGACTGG - Intronic
1149497782 17:57131204-57131226 CTGGGTGCGGGGTGGGGGTGGGG - Intergenic
1149539099 17:57455286-57455308 CTGTGTGTGAGTTGGGGGGCAGG - Intronic
1149560533 17:57604955-57604977 TTGTGTGTGGGGAGGGGGGCGGG + Intronic
1149560552 17:57605197-57605219 GTGTGTGATGCGTGGGGGGCAGG - Intronic
1149570834 17:57671353-57671375 GCGTGTGAGGGGGCGGGGACAGG - Intronic
1149577000 17:57720951-57720973 CTGTGTGTGGGCTGGGGGTGGGG + Intergenic
1149768167 17:59297787-59297809 CTGAGTGGGGTGTGGGGGGCGGG + Intergenic
1150138144 17:62707040-62707062 CTGGGTCTGGGGTGAGGGACAGG - Intronic
1150198296 17:63325053-63325075 CTTTGTGTGGGGTGGGGGGCGGG + Intronic
1150273704 17:63882525-63882547 GTGTGGGAGGGGTGGGGGGGGGG + Intergenic
1150289132 17:63971665-63971687 GTGGGTGAGGGGAGGGGGCCAGG - Intronic
1150947568 17:69765300-69765322 CTGGGGGAGGGGAGGGGGAAGGG - Intergenic
1151294046 17:73170503-73170525 AGGTGTGAGGGGTGGGAGGCAGG - Exonic
1151354834 17:73552066-73552088 CTGGCCGAGGGGTGGGGGGCAGG - Intronic
1151454194 17:74216314-74216336 CTGTGTGGGGTGTGGGGGGTGGG + Intronic
1151473537 17:74332456-74332478 CTTTGGGAGGGATGGGGGATTGG - Intronic
1151475876 17:74344188-74344210 GTGGGGGAGGGGTGGGGGAAGGG - Intronic
1151658786 17:75508012-75508034 CTGAGTGAGGGGAGGGGCCCTGG - Intronic
1152095446 17:78269366-78269388 CAGAGTGGGGGGTGGGGGGCCGG - Intergenic
1152130379 17:78472624-78472646 CTGTGTGTGGGGTGTGGGGAGGG + Intronic
1152242576 17:79168025-79168047 CTGGGTGAGGGGTGGGTAACTGG + Intronic
1152350425 17:79781207-79781229 CTCTGCGAGGGCTGGAGGACAGG + Intronic
1152383966 17:79957759-79957781 CTGTGCGTGTGGTGGGGGAGGGG + Intronic
1152515428 17:80820812-80820834 CTGTGTGGGTGGTGGAGGGCAGG - Intronic
1152723033 17:81932096-81932118 CTGTGTGAGGGGAGCTGGGCTGG - Intergenic
1152760149 17:82103473-82103495 CAGTGTGGGGGGTGGGGGGAGGG - Intronic
1152762135 17:82114336-82114358 CTGGGTGAGGGGGGAGGGACGGG + Intronic
1152802840 17:82339908-82339930 CTGGGGGAGGGGTTGGGGGCAGG - Intergenic
1153835918 18:8963657-8963679 CTGTGTGTGTGGGTGGGGACGGG - Intergenic
1153946647 18:10023823-10023845 CTGTGAGAGGGGAGGGCCACTGG + Intergenic
1154074117 18:11182417-11182439 CTGTGTGACAGCTGGAGGACTGG + Intergenic
1154966538 18:21363284-21363306 GTGTGTGGGGGGGGGGGGGCGGG - Intronic
1155177297 18:23312188-23312210 CTGTGGGTATGGTGGGGGACAGG - Intronic
1155243504 18:23885340-23885362 GTGTGTGTGGGGTGGGGGTGGGG - Intronic
1156281001 18:35638453-35638475 GTGTGTGTGGGGTGGGGAAGGGG - Intronic
1156450187 18:37262387-37262409 GTGTGTGTGGGGTGGGGGAGGGG + Intronic
1156466933 18:37353642-37353664 CTGGGGGAAAGGTGGGGGACTGG + Intronic
1156474123 18:37394942-37394964 CCGGGTGGGGGGTGGGGGGCGGG - Intronic
1157086924 18:44590038-44590060 CTGTGTGTGTGTTGGTGGACTGG + Intergenic
1157305983 18:46518090-46518112 ATGTGGGAGGGGTGAGGGGCAGG + Intronic
1157446572 18:47750945-47750967 TTATGTGAGGGCTGGTGGACAGG - Intergenic
1157514547 18:48301519-48301541 CTGAGGGAGGAGTGGGGGAGTGG + Intronic
1157700660 18:49759930-49759952 GTGTGTAGGGGGTGGGGGGCTGG + Intergenic
1158023635 18:52870681-52870703 CTGGGTGGGGGGTGGGGCACGGG - Intronic
1158412582 18:57221256-57221278 CATAGTGAGGGGTGGGGGAGGGG + Intergenic
1158889833 18:61862647-61862669 TGGGGTGAGGGGTGGGGGACAGG - Intronic
1159011417 18:63062273-63062295 CTGAGTGGGGAGTGGGGGAGGGG - Intergenic
1159705191 18:71677591-71677613 CCTGTTGAGGGGTGGGGGACTGG - Intergenic
1160148871 18:76384597-76384619 CTGTAGGGGGGGTGGGGGATGGG - Intronic
1160427499 18:78788157-78788179 CTTTGTGGGGGGCGGGGGTCGGG - Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160531180 18:79565651-79565673 TTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1160537140 18:79600742-79600764 ATGTGAGAGAGGTGGGGGTCTGG - Intergenic
1160748667 19:723368-723390 AGGGGTGAGGGGTGGGAGACAGG - Intronic
1160876948 19:1300804-1300826 CCGTGTGAGGCGAGGGGGACGGG - Intergenic
1160897707 19:1410405-1410427 TCTTGTGAAGGGTGGGGGACAGG + Intronic
1161080688 19:2308517-2308539 CTGGACTAGGGGTGGGGGACGGG - Intronic
1161169546 19:2805981-2806003 CACTGCGGGGGGTGGGGGACGGG + Intronic
1161377896 19:3949583-3949605 CCCTGTGAGGGGTTGGGGAGGGG + Intergenic
1161983918 19:7643894-7643916 CTGAGTGAGGGGTGGGGCCTTGG + Intronic
1162395781 19:10417506-10417528 CTGTGTGAGGGGTCAGCGAGTGG + Intronic
1162929938 19:13952725-13952747 CGGGGTGAGGGGTTGGGGGCGGG + Intronic
1162966042 19:14156563-14156585 GTGTGGGGGGGGTGGGGGGCGGG + Intronic
1162967748 19:14164086-14164108 CTGGGTGGGGGGTGGGGAGCAGG - Intronic
1163233971 19:16020476-16020498 CTGGGGCGGGGGTGGGGGACAGG + Intergenic
1163241563 19:16067033-16067055 GTGTGTGGGCGGTGGGGGAGGGG + Intronic
1163260221 19:16185188-16185210 CTGTGTGAAGAATGGGAGACCGG + Intergenic
1163315810 19:16539798-16539820 CTGTCTAAGGGGTGGTGAACTGG - Intronic
1163505640 19:17704409-17704431 CCGGGTGGGGGGTGGGGGGCGGG + Intergenic
1163572367 19:18090008-18090030 ATGTGTGAGGCCTGGGGGAGGGG + Intronic
1163611929 19:18306134-18306156 TTGTGTGTGGGGTGGGGGACAGG - Intergenic
1163721290 19:18899368-18899390 CTGTGTGAGGGGCGGGGTGGGGG + Intergenic
1163727920 19:18932912-18932934 TTGTCTGAGGGGTGAGGGGCGGG - Exonic
1164534790 19:29077007-29077029 CTGAGTGTGTGGTGGGGGAAAGG - Intergenic
1164667321 19:30050161-30050183 CTGTGTTGGGGGTGGGGGTAGGG + Intergenic
1164720747 19:30430034-30430056 GGGTGTGAAGGGTGGGGGAGGGG + Intronic
1164750288 19:30648655-30648677 CTATGTTAGGGATGAGGGACGGG - Intronic
1165355866 19:35303619-35303641 CTCTGTGAGAGGTGGAGGATAGG + Intronic
1165705527 19:37973657-37973679 GTGAGTGTGGGATGGGGGACAGG - Intronic
1165850522 19:38847918-38847940 GGGTGTGAGTGGTGGGGAACAGG - Intronic
1165879291 19:39031563-39031585 CTGTGGGAGGGGTGGGAGTGGGG - Intronic
1165917506 19:39269634-39269656 CTGTGTGAGTCGTTGGGGCCTGG + Exonic
1165959041 19:39519195-39519217 CGGTGGGAGGGGTGGAGGCCGGG + Intronic
1166117922 19:40667193-40667215 CTGTGTCTGGGGTTGGGGAAGGG + Exonic
1166741392 19:45116835-45116857 CTGGGTGTGGTGTGGGGGATGGG + Intronic
1166803838 19:45473366-45473388 CTGTGTGAGGATTAAGGGACGGG + Exonic
1166863315 19:45821908-45821930 CTGTGTGGGGCCTGGGGGAGTGG + Intronic
1167044278 19:47040731-47040753 GTGTGTGTGGGGGGGGGGTCTGG + Intronic
1167078830 19:47265465-47265487 CTGTGTGAGGGGTGGGGACCTGG + Intronic
1167116680 19:47492712-47492734 CTCTGCGAGGGGTGTGGGAGGGG + Intronic
1167135186 19:47611395-47611417 GTGTGTGAGGAGTGGGGGAGGGG + Intronic
1167215499 19:48161700-48161722 ATGTGTGATGGGTGGGTGAGTGG - Intronic
1167230391 19:48279437-48279459 CTGTGTGGGGGGCGGGGGTGGGG + Intronic
1167566695 19:50261454-50261476 ATCTGTGAGGGGTGGGAGAGGGG - Exonic
1167631801 19:50630141-50630163 CTGGGTGAGGGGTCGGGGCAGGG + Exonic
1167712836 19:51123016-51123038 CTGTCAGAGGGGTGGAGGCCTGG + Intergenic
1167735827 19:51294032-51294054 CTGTGTGGGGCGAGGGGGCCTGG - Intergenic
1168097060 19:54121940-54121962 CTGAGTGAGTGCTGGGGGGCAGG + Exonic
1168103269 19:54152405-54152427 CTGTGGGGAGGGTGGGGGTCCGG - Intronic
1168403004 19:56096927-56096949 GAGGGTGAGGGGTGTGGGACCGG - Intronic
1168603596 19:57740331-57740353 TTTTGTGCGGGGTGTGGGACAGG + Intronic
1202688713 1_KI270712v1_random:71065-71087 CTATTGCAGGGGTGGGGGACTGG + Intergenic
925081344 2:1070130-1070152 CAGTCTGAGGGGCGGGGGATGGG + Intronic
925285271 2:2711728-2711750 GTATGTGTGTGGTGGGGGACAGG + Intergenic
925348263 2:3184968-3184990 CTGTGCGTGGGGTGGTGGAGGGG - Intergenic
925711565 2:6746203-6746225 GTGTGTGTGTGGTGGGGGAGGGG + Intergenic
925758253 2:7156186-7156208 ATGTGTGTGGGGTGGAGGACAGG - Intergenic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
926104558 2:10142159-10142181 CAGAGTGAGGGGTGGGAGATGGG + Intronic
926300219 2:11596769-11596791 CAGTGAGGGGGGTGGGGCACTGG + Intronic
926583324 2:14656351-14656373 CTGGGTGGGGGATGGGGGAGTGG - Intergenic
926969575 2:18453246-18453268 CTGTATGAGGGGTAGAGAACAGG + Intergenic
927424937 2:22971098-22971120 CTGTGGGGGGGGTGGGGGGGGGG + Intergenic
928020441 2:27700510-27700532 GTGTGTGGGGGGTGGGGGACAGG - Intergenic
928167443 2:28981395-28981417 CTGTGTGGCTGGTGGGGGCCAGG + Exonic
928175065 2:29027898-29027920 GTGAGTGAGGGGTGGGGGTGAGG + Intronic
928273423 2:29877708-29877730 GTGTGGGAGGGGTGTGGGAGTGG - Intronic
928294518 2:30071072-30071094 CTAGGTTAGGGGTGGGGGAGGGG + Intergenic
928535012 2:32231573-32231595 GTGGGGGGGGGGTGGGGGACTGG + Intronic
928806440 2:35162284-35162306 CTGTGTGTGTGGTGGGGGCGCGG - Intergenic
928907237 2:36381107-36381129 CTGTGTGGGGGGTAGGGGCGGGG - Intronic
929045187 2:37782536-37782558 CTGTGTGAGGCGAGGTGGAGTGG - Intergenic
929074545 2:38068909-38068931 GTGTGTGTGGGGTGGGGGGATGG - Exonic
929253195 2:39781031-39781053 GCGTGTGGGGGGTGGGGAACAGG + Intergenic
929367449 2:41177193-41177215 CTGTGTGGGGGGTGGGGGTAGGG - Intergenic
929565940 2:42984830-42984852 CTGACTGAGGTGTGGGGCACAGG + Intergenic
929836522 2:45406100-45406122 AAATGTGAGGGGTGGGGGAGTGG - Intronic
930034505 2:47077025-47077047 CTGAGTGCTGGGTGGGGGATAGG - Intronic
930422026 2:51165804-51165826 CAGTGTGGGGGCTGGGGGAGTGG + Intergenic
930787678 2:55286451-55286473 TTTTTTGGGGGGTGGGGGACAGG - Intergenic
930827726 2:55711156-55711178 CAGGGTGTGGGGTGGGGGAAGGG - Intergenic
930946144 2:57078371-57078393 CTGTGTAAGGAGAGGGGGGCGGG - Intergenic
931321553 2:61177968-61177990 CTGTGTTAGGGGCGGGGGTATGG + Exonic
931450412 2:62363476-62363498 CTGTGTGAGGGGAGTTGGAGGGG - Intergenic
932501712 2:72188045-72188067 CTGTGCTGGGGGTGGAGGACCGG + Intronic
932668403 2:73716545-73716567 CTTTGTGTGGGGTGAGGGATGGG - Intergenic
933124589 2:78588384-78588406 CTTTGTGAGTGGTAGGGGACAGG - Intergenic
933132665 2:78691875-78691897 GTGTGTGTGGGGTGGGGGGGAGG - Intergenic
933821202 2:86113793-86113815 TTGTGTGTGGCGGGGGGGACAGG - Intronic
934556329 2:95288871-95288893 CTGTGTCAGGGCTGAGGGTCTGG + Intronic
934572065 2:95379124-95379146 CTGGGGGATGGGTGGGGGGCTGG - Intronic
934883554 2:98004976-98004998 TTGTGTGTTGGGTGGGGGATGGG + Intergenic
934919876 2:98334198-98334220 CTGTGGCAGGGGTGGGGGTGGGG + Intronic
935116393 2:100140449-100140471 GGGTGTGATGGGTGGGGGATTGG + Intronic
936039989 2:109142452-109142474 CTGTGTGGGTGCTGGGGGCCAGG - Intronic
936251686 2:110872791-110872813 GTGTGTGAGTGCTGGGGGATAGG + Intronic
936527433 2:113251170-113251192 CTGTGTCCGGTGTGGGGGAGTGG + Intronic
937342309 2:121099057-121099079 CTGGGAGAGGGGCTGGGGACAGG + Intergenic
937378841 2:121357410-121357432 CTGGGTGGGAGGTGGGGGGCAGG - Intronic
937975663 2:127580915-127580937 CTGGGAAAGGGGTGGGGGCCTGG - Intronic
938081649 2:128373448-128373470 GTGTGTGTGGGGTGGGGGTGGGG - Intergenic
938855684 2:135308133-135308155 TTTTGTTAGTGGTGGGGGACAGG - Intronic
938945919 2:136211920-136211942 TTGGGTGTGGGTTGGGGGACAGG + Intergenic
939420212 2:141957378-141957400 GTGTGTGGGGGGGGGGGGGCGGG + Intronic
940021576 2:149161573-149161595 CTGTGTGAGGCTTCGGGGACTGG + Intronic
940030969 2:149260858-149260880 GTGTGTGGGGGGTGTGGGGCGGG + Intergenic
940367276 2:152862059-152862081 CTGTGTGAGTGTAGGAGGACAGG + Intergenic
940951734 2:159682905-159682927 GTGTGTGTGGGGGGGGGGAGGGG - Intergenic
941725177 2:168852742-168852764 CTGTCTGAAGGGTGGGGAAAGGG - Intronic
941926912 2:170904927-170904949 TTGTGTGGGGGGTGGGGGCTTGG + Intergenic
942017901 2:171835785-171835807 GTGTGTGAGGGGTGGTGGGGTGG - Intronic
942070495 2:172311725-172311747 TTGTGTGAGGGGTGTGGGGTGGG - Intergenic
942313248 2:174675815-174675837 CTGTGTGTGGGGTGGAGGCGGGG + Intronic
943350475 2:186791300-186791322 CAGGGGGAGGGGTGGGGGAAGGG + Intergenic
943536783 2:189162080-189162102 CTGCCTGAGAGGTGGAGGACTGG - Intronic
943552748 2:189360766-189360788 CTGTTGGAGGGGTGGGGGAAGGG - Intergenic
944221614 2:197310028-197310050 CTGTGTGCGTGGTGCGGGATGGG - Intronic
944316144 2:198287584-198287606 CTATGTGTGGGGTGGAGGAAAGG + Intronic
944875575 2:203961344-203961366 CTGTGTGTGGGGTGGGGTATGGG + Exonic
945017960 2:205539738-205539760 CTGGGGGAGGGGTGGGGTTCGGG - Intronic
945055981 2:205869368-205869390 CTGTGGGAGGGCTGGGGGTGTGG - Intergenic
945166345 2:206950923-206950945 TTGTGGGTGGGGTGGGGGCCTGG + Intronic
945254431 2:207791881-207791903 TGGTGTGGGGGGTGGGGGGCGGG + Intergenic
946088744 2:217200453-217200475 CTCTGTAGGGGGTGGGGGACTGG - Intergenic
946160300 2:217831627-217831649 CTTAGTGAGGGCTGGGGGGCTGG + Intronic
946178330 2:217935433-217935455 CAGGGTGAGGGGTGGGGGCTGGG - Intronic
946245441 2:218384534-218384556 TTGTGTGGGGGGTAGGGGACTGG + Intronic
946371909 2:219286116-219286138 CTGGGTGGCGGGTGGGGGCCGGG + Exonic
946506945 2:220311972-220311994 CAGTGCCAGGGGTGGAGGACTGG - Intergenic
947448263 2:230181320-230181342 CTGTGTGAGGCATGGGGAGCTGG + Intronic
947454511 2:230241593-230241615 CTGTGTGAGGGGAGGAGGACTGG - Intronic
947724293 2:232387743-232387765 GTGTGTGCAGGGAGGGGGACAGG - Intergenic
947819099 2:233058535-233058557 AGGTGTGAGAGGTGGGGGGCTGG + Intergenic
948025427 2:234772507-234772529 CTGTGTGGGGGGTGGAGCAGAGG - Intergenic
948469763 2:238169499-238169521 GTGTGTGTTGGGTGGGGGCCAGG + Intergenic
948563416 2:238868448-238868470 CTCAGTGGGGGATGGGGGACTGG + Intronic
948614913 2:239192229-239192251 CTATGTGTGGGGTGGGGGGTGGG - Intronic
948765389 2:240216672-240216694 CAGGGTGAGGGGTGGGGGTGGGG + Intergenic
948765578 2:240217089-240217111 CAGGGTGAGGGGTGGGGGGGTGG + Intergenic
948823940 2:240565447-240565469 CTTTGTGAGGCTTGGGGGCCAGG - Intronic
1168868493 20:1109065-1109087 GTGTGTGTGTGGTGGGGGTCGGG - Intergenic
1168878343 20:1185819-1185841 CTGCGTGCGGGGTGGGGGTGGGG - Intronic
1168937737 20:1681420-1681442 GTGTGTGTGTGGTGGGGGGCAGG + Intergenic
1169207701 20:3749458-3749480 CTGTGAGTGGGGTGGGGGTGCGG - Intronic
1170549396 20:17463655-17463677 GTGTGTGGGGGGTGGGGGGATGG - Intronic
1171210282 20:23311183-23311205 GAGTGGGAGGGGAGGGGGACAGG - Intergenic
1171290375 20:23979599-23979621 GGATGTGAGGGGTGGGGCACCGG + Intergenic
1171777953 20:29388230-29388252 CTGGGTGGGGGGTGGGGGAGTGG + Intergenic
1171796061 20:29567541-29567563 AAGGCTGAGGGGTGGGGGACAGG + Intergenic
1171852173 20:30316626-30316648 AAGGCTGAGGGGTGGGGGACAGG - Intergenic
1172110803 20:32543885-32543907 CTGTGAAAAGGGTGGTGGACAGG + Intronic
1172625256 20:36343008-36343030 CTGAGTGAGGGGGAGGGGAGAGG + Intronic
1172763247 20:37336615-37336637 CTGTGGTGGGGCTGGGGGACGGG - Intergenic
1172930914 20:38585967-38585989 CTGGGTCAGGGGTAGGAGACAGG + Intronic
1173074994 20:39809699-39809721 CAGCGTGAGGGGATGGGGACAGG + Intergenic
1173285802 20:41670572-41670594 GTGTGTGAGGGGGGTGGGAGTGG + Intergenic
1173564964 20:44032076-44032098 CGGTGTGAGGGGCAGGGGAGCGG + Intronic
1173860687 20:46281317-46281339 CTGTGAGATGCCTGGGGGACTGG + Intronic
1174814898 20:53678183-53678205 GTGTGTGCGGGGTGGGGGAAGGG + Intergenic
1175175967 20:57112314-57112336 CACTGTGAGGGGTGAGGGAAAGG + Intergenic
1175309619 20:58002690-58002712 CTGTCAGGGGGGTGGGGGGCTGG + Intergenic
1175314930 20:58040533-58040555 GTGTGTGTGGGGTGGGGGGTGGG - Intergenic
1175375847 20:58523453-58523475 CTGGGTGGGGGGTGGGGGTGGGG - Intergenic
1175671174 20:60903715-60903737 CTGAGTGTGGGGTGGGGGTGGGG + Intergenic
1175793347 20:61756463-61756485 CCATGTGAGTAGTGGGGGACAGG - Intronic
1175877443 20:62237063-62237085 CTGTGGCAGGGGTGGGGCCCAGG - Intronic
1175895350 20:62333528-62333550 CAGAGTGAGGGCTGGGGGCCGGG - Intronic
1176073737 20:63239252-63239274 CTGGGTGAGGGCTGGGGCAGGGG + Intronic
1176132337 20:63501658-63501680 CAGTGTGGGGGACGGGGGACAGG + Intergenic
1176239153 20:64067911-64067933 CTGGGTGAGGGGCTGGGGGCGGG + Intronic
1177176772 21:17708148-17708170 CTGTTGGAGGGTTGGGGGAAGGG - Intergenic
1177621352 21:23598927-23598949 GTGTGTATGAGGTGGGGGACAGG + Intergenic
1177769886 21:25502609-25502631 ATGTGTCAAGGGTGGGGGCCAGG - Intergenic
1177819632 21:26016925-26016947 CTTTGTGGGGGGCGGGGGGCGGG + Intronic
1178113258 21:29391511-29391533 CTGTTTGGGGAGTGGGGGAGGGG - Intronic
1178434957 21:32550000-32550022 CTGTGTCAGGGGTGGGCTGCAGG - Intergenic
1178437970 21:32576006-32576028 CTGTGTGTGGGGTGGAGGGCTGG + Intergenic
1178701928 21:34841173-34841195 GTGTGGGCGGGGTGGGTGACAGG - Intronic
1179286141 21:39978830-39978852 AGGTGAGAGGGGTTGGGGACAGG + Intergenic
1179331668 21:40408285-40408307 CTGTGATAGGGTGGGGGGACAGG + Intronic
1179452305 21:41474879-41474901 GTGGGTGAGGGGTGGGTGAGGGG + Intronic
1179824410 21:43956108-43956130 CTGTGTGCCAGGTGGGGGCCAGG + Intronic
1179976525 21:44871331-44871353 CTGTGTGAGGGCTGGCGCAGTGG - Intronic
1180005904 21:45020452-45020474 CTGCGGGAGGGGTGGGGGTGGGG - Intergenic
1180135524 21:45859635-45859657 CAGTGTGATGGGTGGGCGCCTGG + Intronic
1180259889 21:46661959-46661981 CGGGGTGCGGGGTGGGGGGCAGG + Intronic
1180278804 22:10673504-10673526 CTGTCAGGGGGGTGGGAGACTGG - Intergenic
1180301571 22:11040611-11040633 CTGTCTGGGGGTTGGGGGAAAGG + Intergenic
1180552713 22:16553530-16553552 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1180767053 22:18351411-18351433 GGATGTGAGGGGTGGGGCACCGG - Intergenic
1180779258 22:18510968-18510990 GGATGTGAGGGGTGGGGCACCGG + Intergenic
1180780574 22:18517328-18517350 AGGTCTGGGGGGTGGGGGACTGG - Intronic
1180811977 22:18768288-18768310 GGATGTGAGGGGTGGGGCACCGG + Intergenic
1181198132 22:21202532-21202554 GGATGTGAGGGGTGGGGCACCGG + Intergenic
1181207430 22:21263535-21263557 CTGTCTGAAGGGTGGTGGGCTGG - Intergenic
1181401612 22:22653272-22653294 GGATGTGAGGGGTGGGGCACCGG - Intergenic
1181436810 22:22915936-22915958 CTGTGGGTGGGGTGAGGGTCGGG - Intergenic
1181437651 22:22919862-22919884 CTGTGGGTGGGGTGAGGGTCGGG - Intergenic
1181438299 22:22922917-22922939 CTGTGGGTGGGGTGAGGGTCGGG - Intergenic
1181613662 22:24036886-24036908 CTGTGGGAGGGAGGGGGCACTGG - Intronic
1181647940 22:24243845-24243867 GGATGTGAGGGGTGGGGCACCGG + Intronic
1181690612 22:24557308-24557330 GTGTGTCAGGGGAGGGGGACTGG - Intronic
1181703571 22:24634369-24634391 GGATGTGAGGGGTGGGGCACCGG - Intergenic
1181713510 22:24706929-24706951 CAGGGTGAGTGGTGGGGGGCGGG - Intergenic
1181797388 22:25320090-25320112 CTGTGGGTGGGGTGGGGGCTGGG - Intergenic
1182184402 22:28386990-28387012 CTGTTTTGGGGGTGGGGGAGTGG - Intronic
1182221223 22:28760519-28760541 GTGTGTTGGGGGTGGCGGACAGG - Intergenic
1182353482 22:29711523-29711545 CGGGGGGATGGGTGGGGGACAGG + Intergenic
1182395655 22:30034019-30034041 CTGTGGGAGGAGTCGGGGAAAGG + Intergenic
1182409158 22:30167958-30167980 GTGTGTGATGGGAGGGGGAGTGG - Intronic
1182417943 22:30233165-30233187 CTGTGGGAGGAGTGGGGGAGGGG + Intergenic
1182923271 22:34099440-34099462 GTGTGGGTGGGGTGGGGGAAAGG + Intergenic
1183142941 22:35961524-35961546 GTGTGTGGGGGGTGGTGGAGTGG - Intronic
1183144533 22:35977827-35977849 CTCTGTGACGGAAGGGGGACAGG - Intronic
1183152719 22:36050623-36050645 GGGTGTGAGTGATGGGGGACGGG + Intergenic
1183300540 22:37056935-37056957 ATGTGTGAGGGTTGGGGGACAGG + Intronic
1183705229 22:39471647-39471669 CCCTGTGTGGTGTGGGGGACAGG - Intronic
1183709031 22:39491654-39491676 CTGTCAGAGGGCTGGGGGCCAGG + Exonic
1183931816 22:41239771-41239793 CTGCGTGGGGGGTGGGGGGCAGG - Intronic
1183952279 22:41358484-41358506 CTGTGTGAGGTGTGGGAGGTGGG + Exonic
1183994230 22:41620956-41620978 CGGGCTGAGGGGTGGGGGAGAGG + Exonic
1184035449 22:41915681-41915703 AGGTGTGAGGAGAGGGGGACTGG + Intergenic
1184217725 22:43078836-43078858 GGGTGTGAGGGGTGTGGGATGGG - Intronic
1184217744 22:43078900-43078922 GGGTGTGAGGGGTGTGGGATGGG - Intronic
1184217763 22:43078964-43078986 GGGTGTGAGGGGTGTGGGATGGG - Intronic
1184217836 22:43079220-43079242 GGGTGTGAGGGGTGTGGGATGGG - Intronic
1184217874 22:43079347-43079369 GGGTGTGAGGGGTGTGGGATGGG - Intronic
1184257354 22:43294819-43294841 CTGTGTGAGGGCTTGGGGGTGGG - Intronic
1184270422 22:43378365-43378387 CTGTGTGAGGTGCAAGGGACAGG + Intergenic
1184731436 22:46373118-46373140 ATGAGTGAGGGGTGGGGGATGGG + Intronic
1184742998 22:46439924-46439946 CTGTGTGAGGGGTGGGAGGGCGG - Intronic
1185106278 22:48871701-48871723 CAGGGTGGTGGGTGGGGGACAGG - Intergenic
1185116442 22:48940897-48940919 GTGTTTGACGGGTGGGGGAAGGG + Intergenic
1185338406 22:50281016-50281038 CTGTGTGTAGCGTGGGGGTCAGG - Intronic
1203228675 22_KI270731v1_random:92305-92327 GGATGTGAGGGGTGGGGCACCGG - Intergenic
949980856 3:9500930-9500952 GTGTGTGTGTGTTGGGGGACAGG - Exonic
950103282 3:10371546-10371568 CTGTGTGTGGGCAGGGGGAGTGG + Intronic
950560351 3:13717809-13717831 CTGTGGGTGGGGTGGGGGAGTGG + Intergenic
950937321 3:16852588-16852610 ATGTGTGTGTGGTGGGGGAGTGG - Intronic
951628516 3:24693270-24693292 CTGTCTGGGGGGTGGGGGTAAGG - Intergenic
953069594 3:39506049-39506071 CACAGGGAGGGGTGGGGGACTGG - Intronic
953374989 3:42421040-42421062 CTGTGTGAGGGGTGAGGAGGTGG - Intergenic
953404510 3:42653947-42653969 CTGGGATAGGGATGGGGGACTGG + Intronic
953418012 3:42734090-42734112 TTGAGGGAGGGGTGGGGGCCTGG - Intronic
953814285 3:46141741-46141763 ATGTGGGCGAGGTGGGGGACAGG - Intergenic
953980115 3:47409394-47409416 CTGAGGAAGGGGTGGGGGCCAGG - Intronic
954230984 3:49217478-49217500 CTGGTTGGGGGGTGGGGGGCTGG + Intronic
954419483 3:50411067-50411089 CTGTGTGTGGGGTGGCTCACTGG + Intronic
954449214 3:50562719-50562741 CTAAGGTAGGGGTGGGGGACTGG + Intronic
954609213 3:51935403-51935425 CTGTGTGACGGCTGGGGGCCGGG - Exonic
954611083 3:51944907-51944929 CTGGGTGAGGGGTGAGAGGCAGG + Exonic
956182112 3:66527284-66527306 CTCTGTATGGGGTGGGGGGCGGG + Intergenic
956245316 3:67176098-67176120 GTGTGTGAGAGGTGGGGGGAGGG + Intergenic
958033390 3:88142013-88142035 GTGTGTGTGGGGAGGGGGGCTGG + Exonic
958165906 3:89877443-89877465 CTGGGTGAGGCTTGGGGGACTGG + Intergenic
958513821 3:95086007-95086029 TTGTGTGTGTGGTGGGGGAGTGG + Intergenic
958905556 3:99938212-99938234 CTGTGAGAGGGCTGGGGGTGAGG - Intronic
959320855 3:104873374-104873396 CTTTTTGCGGGGTGGGTGACTGG + Intergenic
960848209 3:122023826-122023848 CAGTGTGAGGGTTGAGGGTCAGG + Intergenic
961475239 3:127141855-127141877 CTGTGTTAGGGGAGGAGGCCTGG - Intergenic
961496642 3:127297729-127297751 GTGTGAGAGGTGTGGGGGAGAGG + Intergenic
961567860 3:127776362-127776384 ATCTCTGAGGGGTGGGGGAGGGG + Intronic
961629231 3:128284114-128284136 TTGTGTGGGGGGTGGAGGGCTGG - Intronic
961779935 3:129315473-129315495 CTTTGTGCGCGGTGGGGGCCGGG + Exonic
961895997 3:130168064-130168086 CTGTGTGAGGAGTGCATGACAGG - Intergenic
963197830 3:142552951-142552973 CTGTAAGGGGGGTGGGGGAAGGG + Intronic
964386698 3:156155213-156155235 CTGTGTGAGGGGTGGTGGCAGGG - Intronic
965008327 3:163054916-163054938 CTGTTTGAGGGTTTGGGGAAGGG + Intergenic
965502207 3:169470564-169470586 GTGTATGAGGGGGAGGGGACAGG + Intronic
965510521 3:169563677-169563699 CGGTGTGAAGGGTGCTGGACAGG + Intronic
965770188 3:172173817-172173839 CTGGGGGAGGGGTGGGGCGCGGG + Intronic
966824873 3:183955028-183955050 GTGGGGGAGTGGTGGGGGACAGG + Intronic
966863602 3:184244062-184244084 CTCATTGAGGGGTGTGGGACGGG + Intronic
966917985 3:184595127-184595149 GTGTGTGTGTGGTGGGGGAAGGG + Intronic
967135693 3:186510833-186510855 CCGTGTGAGGGGAGTGGTACGGG - Intergenic
967221701 3:187252865-187252887 CTGTGTGAGGGGTAGAGTTCAGG + Intronic
967291647 3:187926684-187926706 CAGTGATAGGGGTGGGGGAAAGG - Intergenic
967893119 3:194377141-194377163 CTGGGAGAGGAGTGGGGGATGGG + Intergenic
968004036 3:195227070-195227092 CTGTGTGAGGGGTGGCATGCAGG + Intronic
968420400 4:479352-479374 CTGGCTGAGGGCTGGGTGACAGG - Intronic
968568750 4:1328507-1328529 CTGTGTGGGGTGTGTGGGCCTGG + Intronic
968624117 4:1618838-1618860 CAGTGAGAGGGCTGGGGGTCGGG - Intronic
968739494 4:2320126-2320148 GTGGGGGAGGGGAGGGGGACAGG - Intronic
968900133 4:3427074-3427096 CTCTGTGAGGAGTTGGGGAGGGG - Intronic
969568760 4:7995793-7995815 ATGTGAGAGGGGCGGGGGTCGGG + Intronic
969576573 4:8039425-8039447 CTGTCTGAGGGGTCGGGCAGGGG - Intronic
969594285 4:8140096-8140118 CTGTCAGAGGGGTGGGGGGAGGG + Intronic
969716370 4:8870215-8870237 CTGTGTTGGGGGTGGGGGGCTGG + Intronic
969746771 4:9078902-9078924 CTGTGTGAGGAGTGCATGACAGG + Intergenic
970093656 4:12437498-12437520 CGGGGTGGGGGGCGGGGGACAGG + Intergenic
970212236 4:13721623-13721645 CTGTCTGAGGGGTGGGGTGTGGG + Intergenic
970392633 4:15631064-15631086 CTGTGGTGGGGGTAGGGGACTGG - Intronic
970471869 4:16387083-16387105 GTATGTGAGGGGTGGTGGATGGG + Intergenic
970616411 4:17772312-17772334 CTGTTTTGGGGGTGGGGGATGGG - Intronic
970886475 4:20992585-20992607 TTGTATGTGGGGTGGGGGAGAGG - Intronic
971353184 4:25871010-25871032 TTTTGTGTGGGGTGGGGGAGTGG - Intronic
971511371 4:27429499-27429521 CAGTCTGAGGGGCGGGGGAAGGG - Intergenic
971534140 4:27727105-27727127 TTTTGTGGGGGGGGGGGGACAGG - Intergenic
972572955 4:40327302-40327324 CTGTGGGAGAGGTTGGGGGCTGG + Intergenic
972627395 4:40814024-40814046 ATTCATGAGGGGTGGGGGACAGG - Intronic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
973181124 4:47269506-47269528 TAGTGTGAGGTGTGGGGGAGGGG + Intronic
973773494 4:54226697-54226719 CCGTGTGGGGGGTGGGGGGAGGG - Intronic
973906467 4:55536763-55536785 TTGGGAGAGGGGTGGGGGAAGGG - Intronic
974288349 4:59897969-59897991 CTGGGTTTGGGGTGGGGGAGGGG + Intergenic
976025686 4:80685616-80685638 TTGTGTGTGGGGTGGGGGGTGGG + Intronic
976030163 4:80742058-80742080 CTGTGGGAGAGATGGGGGAAGGG + Intronic
976441136 4:85076075-85076097 CTGTGTGTTGGGTGGGGGGCAGG - Intergenic
976973853 4:91142125-91142147 ACGTGTCAAGGGTGGGGGACAGG + Intronic
977150254 4:93502703-93502725 GTGTGTGTGGGGGGGGGGAGTGG - Intronic
977310273 4:95377696-95377718 CTTTGTGAGGAGTGGGAGTCTGG + Intronic
978076691 4:104539989-104540011 CTGTTGGAGGGTTGGGGGATAGG - Intergenic
978399494 4:108315598-108315620 AAGTGTGAGGGGTGGGGCAGGGG - Intergenic
978567818 4:110102909-110102931 TTGTGGGAGGGATGGGGGACGGG + Intronic
978624857 4:110673698-110673720 GTGAGTGAGTGGTGGGGGAATGG - Intergenic
978886625 4:113772721-113772743 CTGGGTGTGCAGTGGGGGACTGG + Intergenic
980973384 4:139587776-139587798 GTGTTTGTGGGGAGGGGGACAGG + Intronic
981106515 4:140887766-140887788 CTCTGGGAGGGGTGGGGAAGAGG + Intronic
981622126 4:146713136-146713158 GTGTGTAAGAGGTGGGGGAGGGG + Intronic
981761517 4:148200339-148200361 CTGTGTGGGGGGTGGGGATGTGG - Intronic
981851297 4:149233356-149233378 TTGTTTGTGGGGTGGGGGGCTGG + Intergenic
982090472 4:151876028-151876050 CTCAGTGGGGGGTGGGGGAGTGG - Intergenic
982213484 4:153060055-153060077 CTGTATGAGGGATGGGCCACTGG + Intergenic
982260247 4:153488402-153488424 CTGTGGGAGGAGTGGGGACCGGG + Intronic
984468837 4:180138766-180138788 GTGTGTGTGGGGTGGGGGTGGGG + Intergenic
984528226 4:180882689-180882711 GTGTGTGGGGGGTTGGGGGCAGG - Intergenic
984804603 4:183739726-183739748 CTGTGTGAGGTGGCGGGGGCGGG - Intergenic
985513440 5:324892-324914 CTGTGGGCGGTGTGGGGGAGGGG - Intronic
985555270 5:555069-555091 CGGGGTGAGGGGTGGGTCACCGG + Intergenic
985712787 5:1439311-1439333 ATGTGTGTGGGGTGGGGGTGGGG + Intronic
986249336 5:6042510-6042532 CTGTGGGTGGGGAGAGGGACAGG + Intergenic
986437582 5:7749000-7749022 CTGTGTGTGGGGTGAGTCACAGG + Intronic
986746301 5:10747926-10747948 CTGGGTGTGGGGTGGGGAACAGG + Intronic
986806370 5:11312134-11312156 GTGTGTGTGTGGTGGGGGAGAGG - Intronic
987011827 5:13774134-13774156 ATGTGAGATGGATGGGGGACAGG + Intronic
987041262 5:14064968-14064990 GTTGGGGAGGGGTGGGGGACAGG - Intergenic
987129828 5:14850176-14850198 CGGTGGGAGTGGTGGGGGGCAGG - Intronic
988043150 5:25912977-25912999 CAGAGTGGGGGGTGGTGGACGGG - Intergenic
990888734 5:60624892-60624914 CTGTGTGGGGGGTCGGGGGCAGG - Intronic
990951747 5:61305243-61305265 GTGTGTGTGGGGGGGGGGGCGGG + Intergenic
991049356 5:62255802-62255824 GTGTGTGAGGGGTGGAGGCGGGG - Intergenic
991395651 5:66202505-66202527 GTGTGTGGGGGGTGGTGGGCGGG - Intergenic
991405002 5:66293241-66293263 ATGGGTGGGGGGTGGGGGACAGG - Intergenic
992025760 5:72667266-72667288 GCTTGTGAGGGGTGGGGGAATGG - Intergenic
992194268 5:74324449-74324471 CTGGGTGAGAGGTGGGGCATGGG - Intergenic
992409738 5:76493467-76493489 CAGGGTTAGGGCTGGGGGACAGG - Intronic
992416626 5:76558292-76558314 ATGTGTGAGGGGTAGGGGCTGGG - Intronic
993457380 5:88141756-88141778 GTGTGTGGGGGGTGGGGGCGGGG - Intergenic
993752047 5:91682245-91682267 CTGAGAAGGGGGTGGGGGACAGG + Intergenic
994208818 5:97065043-97065065 TTGTGTGGGGGGGGGGGGGCGGG + Intergenic
994623152 5:102187247-102187269 CTGGCTGGGGGGTGGGGGGCTGG - Intergenic
994946955 5:106406863-106406885 GTGTGTTAGGGGTTGGGGAGTGG + Intergenic
995227394 5:109716936-109716958 CGGGGTCAGGGGTGGGGGAAGGG - Intronic
996888849 5:128393156-128393178 CGGTGTGGGGGCCGGGGGACAGG - Exonic
997335530 5:133106529-133106551 GTGTGTGTGGGGTGGGGGCGGGG + Intergenic
997419600 5:133755520-133755542 ATGTGTGAGAGGTGGTGGGCAGG - Intergenic
997454377 5:134006121-134006143 CTGTGTAGGGGCTGGGGGAGGGG + Intergenic
997496155 5:134327938-134327960 GTGTGTGTGGGTTGGGGGGCTGG + Intronic
997588751 5:135060253-135060275 CTGTGGAAGAGGTGGGGGCCAGG + Intronic
997597139 5:135114629-135114651 CTGTGTGTGGGGGGGGGAACAGG - Intronic
997830694 5:137147092-137147114 GTGTGTGTGAGGTGGGGGAGAGG + Intronic
998000224 5:138619216-138619238 CTTTTTTAGGGGTGGGGGATGGG - Intronic
998092863 5:139381200-139381222 CTGTTTGAGCAGCGGGGGACAGG - Intronic
998200220 5:140113294-140113316 GTGTGTGCGGGGAGGGGGAGCGG + Intronic
998369071 5:141649706-141649728 CTGTGGGTGGGGTGGAGGGCAGG - Intronic
998453763 5:142254504-142254526 CTGGTTGGGGAGTGGGGGACAGG + Intergenic
998459305 5:142297620-142297642 CTGTGTCAGGGGTTGGCGAGGGG + Intergenic
999320852 5:150614282-150614304 CTGTGTGTGTGGTGGGGGAAGGG - Intronic
999831031 5:155320258-155320280 CTGTGTGGGTGGTTGGGGAGGGG + Intergenic
999964911 5:156798840-156798862 CTGTGTGTGGCGTGGGGGGATGG + Intergenic
1000369110 5:160517956-160517978 CTGTGTGTGTGGTGGGGGCCAGG + Intergenic
1001377479 5:171275808-171275830 TTGTGTGAGGGGTGGGGGTAGGG - Intronic
1001725180 5:173890500-173890522 ATGTGTGAAGGGTGGGGGATGGG - Exonic
1001857245 5:175023578-175023600 ATGTGTGAGGCGAGGGAGACTGG - Intergenic
1001865510 5:175100884-175100906 ATGTGTGTGGGGTGGGGGGCGGG - Intergenic
1002001802 5:176200203-176200225 CTGAGGGAGGGGTGAGGGGCAGG + Intergenic
1002394955 5:178945520-178945542 CTGTGTGGGGGGTGTGGGTATGG + Intronic
1002591378 5:180293149-180293171 CTCTGAGAGGAGTGGGGGGCGGG + Intergenic
1002837914 6:880840-880862 CTCAGTGAGGGGTGGGGCAGTGG - Intergenic
1003025739 6:2554085-2554107 CTCTGTGAGGGGTGGGGAGAAGG - Intergenic
1003069282 6:2931982-2932004 GTGTGTGTGGGGTGGGGGTGCGG - Intergenic
1003098705 6:3160744-3160766 CGGGGTGAGGGGCGGGGGGCGGG + Intergenic
1003142534 6:3483279-3483301 CTGTCTGAGAGGTGAGGGAGTGG + Intergenic
1003165321 6:3672336-3672358 GTGGGTGAGGGGTGGGGGCTGGG - Intergenic
1003322921 6:5068367-5068389 CTCTGTGTGGGGTGAGGGGCCGG - Intergenic
1003339291 6:5204277-5204299 CTGGGGGTGGGCTGGGGGACAGG + Intronic
1004934323 6:20492352-20492374 GTGTGTGAGGGGAGGAGGCCAGG - Exonic
1005283780 6:24302772-24302794 CTGTGGGAGGAGTGGAGGGCTGG - Intronic
1005872013 6:29981368-29981390 CTGAGTGAGCGTTGTGGGACAGG - Intergenic
1005915164 6:30345127-30345149 CTGTGCGAGGGGTGGGGCTGCGG + Exonic
1005919744 6:30390161-30390183 CTGTGTGTGTGGTGGGGGGCGGG + Intergenic
1006030179 6:31172117-31172139 CTGTGTGAGGGGATTGGGACTGG - Intronic
1006224018 6:32521423-32521445 CTGCGTGAAGGGTGGGTGCCAGG + Intronic
1006322890 6:33330865-33330887 CTGAGGGAGGGGAGGGGGAACGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006509649 6:34515095-34515117 CTGTGTGGAGAGTGGGGAACGGG + Intronic
1006712770 6:36089374-36089396 CTGTTGGTGGGGTGGGGGTCAGG + Intronic
1006801908 6:36765177-36765199 GTGTGTGGAGGGTGGGGGAGGGG - Intronic
1007134967 6:39511937-39511959 CCTGTTGAGGGGTGGGGGACTGG + Intronic
1007163720 6:39813034-39813056 GTTTGTGAGGGGTGGGTGGCTGG - Intronic
1007171149 6:39864571-39864593 GTGTGTGGGGGGTGGGGGCTGGG - Intronic
1007341602 6:41194283-41194305 CTGAATGTGAGGTGGGGGACTGG - Intronic
1007424676 6:41739329-41739351 CTGTGTGCAGGATGGGGGCCTGG - Intronic
1007707504 6:43799721-43799743 CTATGTTTGAGGTGGGGGACTGG + Intergenic
1007731821 6:43951987-43952009 TTGTGTGTGGGGTGGGGGTATGG + Intergenic
1007784493 6:44271898-44271920 GTGTGTGTGTGGTGGGGGATGGG + Intronic
1008883880 6:56410931-56410953 GTGTGTGTGGGGTGGGGGGGGGG - Intergenic
1009029993 6:58045358-58045380 CTGTGTGTGGGGTGAGGGGTGGG + Intergenic
1009205521 6:60796588-60796610 CTGTGTGTGGGGTGAGGGGTGGG + Intergenic
1009754456 6:67918533-67918555 CTGGGTGTGGGGTGGGGCATGGG + Intergenic
1010204926 6:73314415-73314437 CTGTCTGTGGGGTGGGGGGACGG + Intergenic
1010250648 6:73703755-73703777 CTGTATAAGGGGTGGGGGCTGGG + Intronic
1011316541 6:86038467-86038489 CTGTGTGTGGAGTGGGGGGATGG - Intergenic
1011616637 6:89203335-89203357 CTTGGTGAGGGGTCGGGGAGGGG + Intronic
1011700414 6:89950184-89950206 ATGTGGGAGTGGTGGGGGGCAGG + Intronic
1011763969 6:90599023-90599045 CTGAGTGAGGGGCTGGAGACTGG + Intergenic
1013293305 6:108736948-108736970 CAGGGAGAGGGGTGGGGGCCGGG + Intergenic
1013346555 6:109266015-109266037 GTGTGTGTGGGGTGGGGTACTGG - Intergenic
1013580901 6:111533627-111533649 CTGTGGGCGGGGGGGGGGAGGGG - Intergenic
1014022904 6:116611218-116611240 CAGTGTGTGTGGTGGGGGATGGG - Intergenic
1015034791 6:128640751-128640773 CCGTGTGGGGGCTGGGGGACAGG + Intergenic
1015222776 6:130824015-130824037 GAGTGGGAGGGGTGGGGGACAGG + Intergenic
1015561182 6:134517723-134517745 CTGTGGGAGGGGTGAGGAAGAGG - Intergenic
1015594608 6:134854466-134854488 GTGTGTGTGGGGTGGGTGATGGG - Intergenic
1016388111 6:143548646-143548668 CTCGATGAGAGGTGGGGGACTGG + Intronic
1016495674 6:144659283-144659305 CTGGGTGAGGGGTGGTGGAAAGG + Intronic
1016813549 6:148283253-148283275 CTGTGGGGGAGGTGGGGGAGAGG - Intronic
1017270966 6:152504891-152504913 GTGTATGAGGGGTAGGTGACAGG - Intronic
1017326051 6:153142557-153142579 ATGTCAGCGGGGTGGGGGACGGG - Intergenic
1017903564 6:158739001-158739023 CTGTGTGAGTGGGAGGGGAAAGG - Intronic
1017990370 6:159482758-159482780 GTTTGAGAGGGGTGGGAGACGGG - Intergenic
1018014373 6:159698926-159698948 CTGTCTGGGGGGTGGGGGGCGGG + Intronic
1018330586 6:162723463-162723485 GTGAGAGAGAGGTGGGGGACCGG + Intronic
1018682486 6:166275529-166275551 AGGTATGAGGGGTGGGGGAGAGG + Intergenic
1019322752 7:423017-423039 CAGGGTGAGGGGTGTGGCACCGG + Intergenic
1019348324 7:541354-541376 CTGTGGGTGGGGTGGGGGTGGGG - Intergenic
1019746796 7:2705299-2705321 CTGTTTCTGGGGTGGGGGAGTGG - Intronic
1019811340 7:3167374-3167396 CTGTGTGTGGGGATGGGGATGGG - Intronic
1020244549 7:6420607-6420629 TTGTGTTAGGGGTGTGGGACTGG + Intronic
1020997051 7:15278492-15278514 CTGTGATAGGGATGGGTGACTGG + Intronic
1021272516 7:18608286-18608308 GAGTGGGAGGGGAGGGGGACTGG + Intronic
1021277073 7:18664630-18664652 ATGTGTGAGGGGTGGGAAGCAGG - Intronic
1021513915 7:21461971-21461993 ATTTTTGAGGGGTAGGGGACAGG + Intronic
1021655079 7:22866525-22866547 CTGTGTGAGGTCTGGGGTGCAGG - Intergenic
1021912678 7:25401878-25401900 CTGTGTGCATGGTGGGGGAAGGG - Intergenic
1022162759 7:27728246-27728268 CTGTGTGGACGGTGGGGGAAAGG - Intergenic
1022231001 7:28411549-28411571 CGGTGTGGGGGGTGGGGGGGTGG + Intronic
1022514454 7:30966390-30966412 GTGTGTGTGGGGTGGGGGTGGGG + Intronic
1022603228 7:31781688-31781710 GTGTGTGGGGGGTGGGGGGTGGG - Intronic
1022638391 7:32159091-32159113 CTCTGTGAGGTCTGGGAGACGGG + Intronic
1023071521 7:36439598-36439620 CTGTGTGTGGGGTGGGATAAAGG + Intronic
1023216968 7:37872873-37872895 TTGTGTGTGGGGTGGGGGTGTGG - Intronic
1023259994 7:38349149-38349171 GTGGGGGAGGGGTGGGGAACAGG + Intergenic
1023260977 7:38358306-38358328 GTGGGGGAGGGGTGGGGAACAGG + Intergenic
1023915043 7:44582356-44582378 CTGTGTGAGGGGGCGGGGCGCGG - Intergenic
1023990936 7:45127853-45127875 CTAGGTGTGGGGTGGGGGGCAGG - Intergenic
1024254331 7:47528493-47528515 ATGTGGGAGTGGTGGGGGGCAGG - Intronic
1024265902 7:47606256-47606278 CTGTGGCAGGGGTGGGGTAAGGG + Intergenic
1024442934 7:49442769-49442791 CTGGGTGGGGGGTGGGAGAGGGG - Intergenic
1024453869 7:49580466-49580488 CTCTGGGAGGGGTGAGGGATTGG - Intergenic
1024479939 7:49852677-49852699 TGGTGTGACGGATGGGGGACGGG + Intronic
1025280254 7:57621691-57621713 CTGTGTGAGGGCTGGGCAATAGG + Intergenic
1025304479 7:57843810-57843832 CTGTGTGAGGGCTGGGCAATAGG - Intergenic
1026199854 7:68205388-68205410 CTGTGTCAGGGGTGGGGCTGTGG - Intergenic
1026765435 7:73156830-73156852 TTGTGTGAGGGGTGGGGGCGCGG - Intergenic
1026848037 7:73708564-73708586 GAGTGTGTGGGGCGGGGGACGGG - Intronic
1026857046 7:73762073-73762095 CTGGGGGAGGGATGGGGGAAGGG - Intergenic
1026941655 7:74290619-74290641 CTGGGTGAGAAGTGGGGGTCTGG + Intronic
1026962672 7:74418388-74418410 CTGAGCTGGGGGTGGGGGACAGG - Intergenic
1027041909 7:74966524-74966546 TTGTGTGAGGGGTGGGGGCGCGG - Intronic
1027081733 7:75235831-75235853 TTGTGTGAGGGGTGGGGGCGCGG + Intergenic
1027241190 7:76330351-76330373 CTTTGTGTGGGCTGGGGGAAGGG + Intronic
1027469448 7:78554904-78554926 CGGTGTGAGGGGTGTGAGAATGG + Intronic
1029284137 7:99454535-99454557 CTGGGGGAGGGGATGGGGACAGG - Intronic
1029371637 7:100154565-100154587 CTGTCTCAGGGGTTGGGGACAGG - Exonic
1029390321 7:100270412-100270434 TTGTGTGAGGGGTGGGGGCGCGG + Intronic
1029632342 7:101760817-101760839 CAGGGCGAGGGGTGGGGGACTGG + Intergenic
1029941554 7:104485767-104485789 CTGTCAGAGGGGTGGGAGGCTGG - Intronic
1030923489 7:115421719-115421741 CTGTTTGAGGGGTGGGGTGGGGG - Intergenic
1031001279 7:116418053-116418075 CTGTGTGACGGGAGGAGGAGGGG - Intronic
1032002073 7:128271987-128272009 CTCTGTGAAGAGTCGGGGACGGG - Intergenic
1032416112 7:131736826-131736848 GGGTATGAGGAGTGGGGGACAGG + Intergenic
1032424697 7:131812996-131813018 CTGTATGAGGGGTGGCAAACTGG + Intergenic
1033624673 7:143097209-143097231 CTTTGTGGGGGGTGGGGGGAAGG - Intergenic
1033806236 7:144957222-144957244 CTTTGTGCGGGGTGGGGGAATGG - Intergenic
1034412802 7:150950149-150950171 CTGGGTATGGGGTGGGGGGCGGG - Exonic
1034937281 7:155208395-155208417 CTGTGTGTGGGGGGAGGGAATGG + Intergenic
1035054929 7:156028912-156028934 ATGTGTGGGGTGTAGGGGACGGG + Intergenic
1036184140 8:6609815-6609837 CTGTGTGTGGGGGGGGGGCGGGG - Intronic
1037002948 8:13743129-13743151 GTGTGTGTGGGGAGGGGGGCTGG + Intergenic
1037770045 8:21793285-21793307 CTGTGTGAGGGATGGAGACCAGG + Intronic
1037849014 8:22310718-22310740 GTGTGTGAGGGGTAAGGGATAGG - Intronic
1038023211 8:23567534-23567556 GTGTGTGTGTGGTGGGGGAGTGG + Intronic
1038179218 8:25210868-25210890 CTGAATGAGGGGAGGGGGAAGGG + Intronic
1038842457 8:31197768-31197790 CGGCGTGAGGGATGGGGGAGGGG - Intergenic
1039434009 8:37547271-37547293 GTGTGTATGGGGTGGGGGGCGGG - Intergenic
1039485624 8:37907559-37907581 CTTTTGGAGGGGAGGGGGACTGG - Intergenic
1040383888 8:46899948-46899970 GTGTGTGGGGTGTGGGGGATGGG + Intergenic
1041213569 8:55577431-55577453 CTGTTTGGGGGGTGGGGGCCTGG + Intergenic
1041364644 8:57089133-57089155 CTGTTGGAGGGGTGGGGGGAGGG - Intergenic
1041387656 8:57321096-57321118 CTGTTGCAGGGTTGGGGGACGGG - Intergenic
1041406226 8:57502184-57502206 CTGTGTGTGGGGTTGGGGGCAGG + Intergenic
1041467120 8:58168001-58168023 CTGGGTGGGGGGTGGGGAGCTGG - Intronic
1041526865 8:58816015-58816037 GTTTGTGGAGGGTGGGGGACGGG + Intronic
1041617737 8:59928007-59928029 TTGTGTGAGGGGTAGGTGAGTGG + Intergenic
1041734496 8:61095424-61095446 ATGGGTGAGAGGTGAGGGACTGG + Intronic
1041792132 8:61708875-61708897 TTGGTTGAGGGGTGGGGGGCTGG - Intronic
1042670262 8:71254841-71254863 CTGTGTGTGTGGTGGGGGGCGGG - Intronic
1042693314 8:71527985-71528007 ATGTGTGAGGGGTGGGGGCGAGG - Intronic
1042793747 8:72637499-72637521 CTGTGTGTGGGCTGGGAGACGGG + Intronic
1043057232 8:75454122-75454144 CTGTATGTGGAGTGGGGGAGAGG - Intronic
1043769873 8:84184647-84184669 CCGTGGGAGGGGTGGGGGGAGGG - Intronic
1044391874 8:91661418-91661440 ATGTGTGATGGGTGGAGGACAGG + Intergenic
1044646492 8:94449189-94449211 GTGTGTGTGTGGTGGGGGGCGGG - Intronic
1045035882 8:98176227-98176249 CTGTGGTGGGGGTGGGGGTCGGG + Intergenic
1045275033 8:100696452-100696474 CAGTCTGAGAGGTGGGGGATGGG - Intronic
1045412432 8:101932190-101932212 CTGTGGCAGGGGAGGGGGCCTGG - Intronic
1046379486 8:113433882-113433904 CTGTGTGGGGGGTGCGGGGGAGG + Intronic
1047525854 8:125633479-125633501 GTGTGTGGGGGTTGGGGGGCGGG - Intergenic
1047615722 8:126560991-126561013 GTACGTGAGGTGTGGGGGACAGG - Intergenic
1047704753 8:127486719-127486741 GTGTGTGGGGGTGGGGGGACAGG + Intergenic
1047980964 8:130181659-130181681 CTGTGTGTGGGGAGGGGGCCAGG + Intronic
1048064143 8:130950477-130950499 CTGTGTCAGGGTTTGGGGGCTGG + Intronic
1048155680 8:131947565-131947587 GTGTTTGGGGGGTGGTGGACAGG + Intronic
1048480766 8:134790514-134790536 GTTTTTGAGGCGTGGGGGACAGG - Intergenic
1048607243 8:135982412-135982434 CTGGGTGAGGAGTGGGGCTCAGG - Intergenic
1049406897 8:142455636-142455658 CTGAGTGAGGAGTGGGGGACAGG - Intronic
1049502480 8:142974818-142974840 CTGTGCGGGGGGCGGGGGGCGGG - Intergenic
1049604552 8:143523220-143523242 CAGTGGGAGGTGTGGGGGCCAGG - Intronic
1049662900 8:143828329-143828351 CTGGGTGTGGGCTGGGGGAAGGG + Intronic
1051079428 9:13278725-13278747 CGGTGCCAGGGGTGAGGGACGGG + Intronic
1051519000 9:17962960-17962982 CTGTGTCAGGGCTTGGGGCCAGG + Intergenic
1052328873 9:27246948-27246970 GTGTGTGTGGGGTGGGGGGGGGG - Intergenic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052713561 9:32087832-32087854 CAGTGGGTGGGGTGGGGGAAGGG + Intergenic
1052816693 9:33107423-33107445 CTGTGTGGGGGTGGGGGGAGAGG - Intronic
1052817146 9:33110577-33110599 CTGTGGGATGGGGTGGGGACAGG - Intronic
1053348546 9:37395994-37396016 GTGTGGGAGGGGAGGGGGCCGGG - Intergenic
1053412905 9:37927170-37927192 CTGTCTGAGGCGTGGGGCAGGGG + Intronic
1053475519 9:38379435-38379457 GTGTGTGGGGGGTGGGGGGGAGG + Intergenic
1053591842 9:39522137-39522159 TTGGGTGATGGGTGGGTGACGGG + Intergenic
1053683443 9:40499917-40499939 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1053750672 9:41251349-41251371 CTAGGTGGGGGGTGGGGGAGTGG - Intergenic
1053789955 9:41679884-41679906 AAGGCTGAGGGGTGGGGGACAGG - Intergenic
1053933422 9:43128232-43128254 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054155182 9:61634873-61634895 AAGGCTGAGGGGTGGGGGACAGG + Intergenic
1054178294 9:61891573-61891595 AAGGCTGAGGGGTGGGGGACAGG - Intergenic
1054256184 9:62815692-62815714 CTAGGTGGGGGGTGGGGGAGTGG - Intergenic
1054280272 9:63125011-63125033 GTGTGTGTGGGGGTGGGGACTGG + Intergenic
1054296546 9:63335415-63335437 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054335121 9:63799922-63799944 CTAGGTGGGGGGTGGGGGAGTGG + Intergenic
1054394564 9:64639920-64639942 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054429213 9:65145119-65145141 GTGTGTGTGGGGGTGGGGACTGG - Intergenic
1054474974 9:65565981-65566003 AAGGCTGAGGGGTGGGGGACAGG + Intergenic
1054501171 9:65876416-65876438 GTGTGTGTGGGGGTGGGGACTGG + Intergenic
1054574463 9:66843152-66843174 TTGGGTGATGGGTGGGTGACGGG - Intergenic
1054659235 9:67689251-67689273 AAGGCTGAGGGGTGGGGGACAGG + Intergenic
1055467527 9:76580200-76580222 CTGTTTGATGGGTGGGGGTGGGG - Intergenic
1055632143 9:78235841-78235863 CTGTGTGAGGCGGGGGCGAGCGG - Intergenic
1056520300 9:87395160-87395182 CTGTGTGAGAGGCAGGGGAGAGG - Intergenic
1056553081 9:87667039-87667061 CTGTGTGGGAGCTGGGCGACAGG + Intronic
1058099736 9:100905690-100905712 GTGTGTGGGGGGGGGGGGGCGGG + Intergenic
1059332087 9:113542106-113542128 CTGTGTGTGGGGGTGGGGATGGG + Intronic
1059395672 9:114032629-114032651 CTTTCTGCTGGGTGGGGGACAGG - Exonic
1059965130 9:119606254-119606276 ATGTGTCAGGGGTGGGGGGCTGG - Intergenic
1060030902 9:120214032-120214054 GTGGGTGATTGGTGGGGGACAGG - Intergenic
1060204468 9:121674421-121674443 CTGGGTGTGGGCTGGGAGACTGG + Intronic
1060228251 9:121809091-121809113 CTCTGTGAGGGGTCAGGGGCGGG + Intergenic
1060404315 9:123365766-123365788 GTGGTTGGGGGGTGGGGGACGGG - Intronic
1060512296 9:124242910-124242932 GTGTGGGAGGGGTGGGAGGCAGG - Intergenic
1060877860 9:127096141-127096163 CTGAGGGAGTGGTGGGGGAAAGG - Intronic
1060902463 9:127272227-127272249 TTGTGTTAGGGGTGCTGGACAGG - Intronic
1061208114 9:129176059-129176081 CTGGGTAAGGGGTGGGGGGCGGG - Exonic
1061296694 9:129680693-129680715 CTGTGTGCGGGCTGGGGGCGGGG - Intronic
1061527307 9:131176870-131176892 CTGTTTCAGGGGTGGAGGACAGG - Intronic
1061767035 9:132888024-132888046 CTGGGTTAGGGGTGAGGAACTGG - Intronic
1061802928 9:133121893-133121915 CTGTGTGTGCAGTGGGGGAAAGG + Intronic
1061818645 9:133210402-133210424 CCGTGGGAGGGGTGAGGGACTGG - Intergenic
1061923019 9:133792680-133792702 CTGGGTGGGGGGTGGGGGGGGGG - Intronic
1061941789 9:133887790-133887812 CTGGGTGGGGGGCGGGGGATGGG - Intronic
1062055865 9:134469532-134469554 GGTGGTGAGGGGTGGGGGACAGG - Intergenic
1062169442 9:135126847-135126869 GTGTGTGTGTGGTGGGGCACAGG - Intergenic
1062241801 9:135544937-135544959 CCGTGAGAGGGGTGAGGCACTGG + Intergenic
1062324324 9:136005012-136005034 CCGTGGGAAGGATGGGGGACGGG + Intergenic
1062629223 9:137456200-137456222 GTGTGTGTGGGGGGGGGGGCTGG + Intronic
1062635006 9:137486071-137486093 CTGTGAGAGGGCTGGGCCACGGG - Intronic
1185459517 X:328291-328313 CGGGGAGAGGGGAGGGGGACGGG - Intergenic
1185532896 X:835845-835867 CTGTTGCAGGGGTGGGGGACTGG - Intergenic
1185540534 X:899768-899790 CTGTCTGGGGGTTGGGGGAAAGG - Intergenic
1185652599 X:1659935-1659957 GTGTGTGAGAGGAGGGGCACAGG + Intergenic
1185764557 X:2715133-2715155 CTGGGTGAGGAGCGGGAGACAGG - Intronic
1186036804 X:5431896-5431918 TTGTGGGAGGGGTGGGGGAGTGG - Intergenic
1186343123 X:8664040-8664062 CTGTCAAAGGGGTGGGGGAAGGG + Intronic
1186744517 X:12553587-12553609 CTTTGGCTGGGGTGGGGGACTGG - Intronic
1187010427 X:15273022-15273044 CTAAGTGAGGGGTGGGGCAGAGG - Intergenic
1187128956 X:16482229-16482251 GGGTGTGGGGGGAGGGGGACTGG + Intergenic
1187133999 X:16529433-16529455 CTGTGTGGGAGGTGGGGAGCTGG - Intergenic
1187249049 X:17580560-17580582 CAGTGGGAGGCGTGGGGAACTGG + Intronic
1187780230 X:22813293-22813315 CTGTGTGGGGGTTGGGGGTTTGG + Intergenic
1188003174 X:25001035-25001057 CTGTGGGAGGGTTGAGGGAAAGG - Intergenic
1188274094 X:28178646-28178668 CGGGGTGGGGGGTGCGGGACGGG + Intergenic
1188726077 X:33583816-33583838 CTGTGTGTGGGGGTGGGGAGGGG - Intergenic
1188946155 X:36304678-36304700 CTGTGTCAGGGGTGAGGAATGGG - Intronic
1189074689 X:37903955-37903977 CAGACTGAGGGGTGGGGGAAGGG - Intronic
1189207831 X:39257025-39257047 CTGGGGGAGGGGTGGGGGGGAGG - Intergenic
1189288201 X:39866896-39866918 CTGTTTGGGGGGTGGGGGTGGGG - Intergenic
1189289982 X:39878129-39878151 CTGGGAGAGGTGGGGGGGACGGG - Intergenic
1189333136 X:40155054-40155076 CTGCGGGAGGGGAGGGGGTCGGG + Intronic
1189665406 X:43349963-43349985 CTGTGTGTGGGGTGGGGGTGGGG + Intergenic
1189779972 X:44504966-44504988 GTGTGTGCGGGGTGGGGGCGGGG - Intergenic
1189882919 X:45510766-45510788 CTGTGTGTGGGTAGGGGGATAGG - Intergenic
1190096582 X:47486073-47486095 TTTTGCGGGGGGTGGGGGACGGG - Intergenic
1190110051 X:47583489-47583511 CTGTGGGTGGGGTGGGACACAGG - Exonic
1190263934 X:48816389-48816411 CTGTCTTAGGGGTGGGGACCAGG + Intronic
1190526677 X:51335021-51335043 ATGGGTGGGGGCTGGGGGACCGG + Intronic
1190666942 X:52704829-52704851 GTGTGTGTGGGGTGGGGGTAGGG + Intronic
1190672476 X:52753579-52753601 GTGTGTGTGGGGTGGGGGTAGGG - Intronic
1190873652 X:54445037-54445059 GTGTGTGTGGGGTGGGGTAAGGG - Exonic
1191727489 X:64296727-64296749 CTGTGTTGGGGGCGGGGGAGGGG - Intronic
1192177594 X:68895515-68895537 CAGTGGGAGGGGAGTGGGACAGG + Intergenic
1192233423 X:69281251-69281273 GTGTGTAAGGGGTGGGAGAGAGG + Intergenic
1194250729 X:91571639-91571661 CTGTGTGTGGGGTGGAGGTGAGG + Intergenic
1194290331 X:92064133-92064155 GTGTGGTGGGGGTGGGGGACTGG + Intronic
1194561444 X:95427238-95427260 CTGTGGGTGGGGTTGGGGAGGGG - Intergenic
1194806816 X:98339328-98339350 GTGTGTGTGGGGTGGGAGAAGGG - Intergenic
1195820801 X:108943820-108943842 CTGTATGAAGGGTGAGGCACGGG + Intergenic
1196655112 X:118209986-118210008 CGGTGTGAGGGGTGGGTGTGTGG + Intergenic
1196751904 X:119125890-119125912 TTGTGTGGGGGGTGGGGGTGGGG + Intronic
1197206790 X:123797928-123797950 GTGTGTGGGGGGTGGGGGCAGGG - Intergenic
1197447300 X:126566031-126566053 TGGGGTGAGGGGAGGGGGACGGG + Intergenic
1197605561 X:128581371-128581393 TTTTGTGAGGGCGGGGGGACAGG + Intergenic
1197905413 X:131419694-131419716 CTGTGGGAGGGGTGAGGGGAGGG + Intergenic
1198802803 X:140464690-140464712 GTGTGTGTGGGGTGGGGGGTGGG - Intergenic
1198960145 X:142174783-142174805 CTGGGTGAGGGGTGGAGGGGAGG - Intergenic
1199694924 X:150337160-150337182 CTGTGAGAGGGGCTGGGGTCAGG - Intergenic
1199694962 X:150337416-150337438 CCGTGTGTGGGGTGGGGGAGGGG - Intergenic
1200045061 X:153396810-153396832 CTGAATGTGGGGTGAGGGACTGG + Intergenic
1200569673 Y:4812885-4812907 CTGTGTGTGGGGTGGAGGTGAGG + Intergenic
1200607845 Y:5288737-5288759 GTGTGGTGGGGGTGGGGGACTGG + Intronic
1202368261 Y:24181207-24181229 CTGTGGGGAGGGTGGGGCACCGG - Intergenic
1202372436 Y:24207975-24207997 CTGTGGGGAGGGTGGGGCACCGG + Intergenic
1202498349 Y:25462145-25462167 CTGTGGGGAGGGTGGGGCACCGG - Intergenic
1202502524 Y:25488910-25488932 CTGTGGGGAGGGTGGGGCACCGG + Intergenic