ID: 1095959556

View in Genome Browser
Species Human (GRCh38)
Location 12:47825618-47825640
Sequence CTCAGGGTTGGGAGTGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 359}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095959556_1095959567 16 Left 1095959556 12:47825618-47825640 CCAGCTTCACTCCCAACCCTGAG 0: 1
1: 0
2: 2
3: 36
4: 359
Right 1095959567 12:47825657-47825679 TTAGGCCAGAACCTTGTTCATGG 0: 1
1: 0
2: 1
3: 8
4: 131
1095959556_1095959563 -2 Left 1095959556 12:47825618-47825640 CCAGCTTCACTCCCAACCCTGAG 0: 1
1: 0
2: 2
3: 36
4: 359
Right 1095959563 12:47825639-47825661 AGGTAAGCGAGGCCCCGCTTAGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095959556 Original CRISPR CTCAGGGTTGGGAGTGAAGC TGG (reversed) Intronic
900578533 1:3396065-3396087 CTCAGGGTGTGGAGTGAATCTGG - Intronic
900974050 1:6006502-6006524 CTGAGGGGTGGGAGTGGAGTGGG - Intronic
901396642 1:8986795-8986817 GTCAGGGTTGGGCGGGAGGCAGG + Intergenic
902240920 1:15088765-15088787 CTCAGGGGTGGGGGAGAAGGAGG + Intronic
902240941 1:15088915-15088937 CTCAGGGCTGTGAGGGGAGCTGG - Intronic
902263344 1:15243725-15243747 CCCAGGGCAGGGAGTGAAGGGGG - Intergenic
902398465 1:16144883-16144905 CTCTGGGTTGTGTGTGAAGATGG + Intronic
902405652 1:16182021-16182043 CACAGGGTTGGGGGTGACACAGG + Intergenic
902987779 1:20165897-20165919 CTCAGGGTTGGCAGTGAGGAGGG + Intronic
903279914 1:22244577-22244599 CTCAGGGTGTGCAGAGAAGCAGG - Intergenic
904295340 1:29516643-29516665 CTGTGTGTTGGGAGTGAAGTGGG + Intergenic
904682897 1:32241228-32241250 CCCAGGGTTGCGAGTGACTCGGG - Intergenic
905170422 1:36106633-36106655 CTGGGGGTTGGGAGTGATGGAGG + Intronic
905319366 1:37105022-37105044 CTCAGGGTTGGGAGATAATAGGG + Intergenic
905386106 1:37605476-37605498 CCCTGGGTTGGGCCTGAAGCTGG - Intergenic
905788481 1:40776614-40776636 CTCAGGGATTGGAGGGAGGCCGG - Intergenic
906581229 1:46936588-46936610 CACAGGGTTGAGAGTGGAGTTGG + Intronic
906602495 1:47142289-47142311 CACAGGGTTGAGAGTGGAGTTGG - Intronic
906678856 1:47711446-47711468 CTCAGGGTTGGGGCTGCTGCTGG + Intergenic
907281199 1:53348578-53348600 ATCAGGGCTGGGAGGAAAGCAGG - Intergenic
907919005 1:58895788-58895810 TGCAGGGTTGGGTGGGAAGCTGG - Intergenic
908316210 1:62935370-62935392 GTCAGGGTGGGGAGTGGAGCTGG - Intergenic
908820136 1:68077763-68077785 CTCAGGGGAGGGGGTGAATCAGG - Intergenic
908846553 1:68330201-68330223 CTCAGGATTTAGACTGAAGCAGG - Intergenic
908981685 1:69966960-69966982 CTCAGGGGAGGGTGTGAATCTGG + Intronic
911057460 1:93720944-93720966 AGCAGGGTTGGGAGTGCATCAGG + Intronic
911968529 1:104399213-104399235 CTGAGGATAGGGAGAGAAGCAGG + Intergenic
912080084 1:105925444-105925466 TTCAGGGTGGGTAGAGAAGCAGG - Intergenic
913196899 1:116464590-116464612 CACAGGATTTGGAGTTAAGCAGG - Intergenic
913610527 1:120505711-120505733 CTGTGGGTTTGGAGTTAAGCTGG + Intergenic
913984269 1:143551102-143551124 CTCTGGGTTTGGAGTTAAGCTGG - Intergenic
914580663 1:149016528-149016550 CTGTGGGTTTGGAGTTAAGCTGG - Exonic
915454544 1:156030875-156030897 CTGAGGGGTGGGAGGGATGCAGG - Intergenic
916832169 1:168504273-168504295 CTCAGCTTTGGGAGTGCAGTTGG + Intergenic
919071265 1:192758152-192758174 CTAAGGGTTAGGGGTGAGGCAGG - Intergenic
920650263 1:207832264-207832286 TTCAGGGGTGGGAGAGGAGCTGG + Intergenic
920670890 1:208002970-208002992 CTCAGGGTTGGGGGTTAAGGAGG + Intergenic
920715240 1:208334463-208334485 CTCAGGGCTGGGTGGGGAGCTGG - Intergenic
920865734 1:209751819-209751841 CTCAGGCTTGGGGGTGAAGGTGG - Intergenic
1066393059 10:34994255-34994277 CTCAGGAAGGGGAGTTAAGCTGG + Intergenic
1066416975 10:35230811-35230833 CTCCCGGTTGGGAGGAAAGCTGG - Intergenic
1066963553 10:42242094-42242116 CTCGCGGCTGGGATTGAAGCCGG + Intergenic
1067414779 10:46094963-46094985 CTGAGTGTTGGGAGAAAAGCTGG + Intergenic
1067834516 10:49629911-49629933 GACAGGGTTGAGAGTGAAGATGG + Intronic
1068381068 10:56254740-56254762 TTCAGGGTTAGGAGGGATGCAGG - Intergenic
1069860928 10:71471388-71471410 CACAGTGGTGGGAGAGAAGCAGG - Intronic
1070154994 10:73827819-73827841 CCCAGGGTAGGATGTGAAGCTGG - Intronic
1070716066 10:78722196-78722218 CTCAATGTTGGAAGTGAGGCTGG + Intergenic
1070813519 10:79310184-79310206 CACAGGGTTGTGAGGGAGGCAGG - Intronic
1071010313 10:80931673-80931695 CTTAGGCTTGGGTGTGGAGCAGG + Intergenic
1071321539 10:84465038-84465060 CTCAGGGTTGGGAAGCAATCTGG - Intronic
1071701820 10:87946836-87946858 CTCAGGGTTCCCAGTAAAGCAGG + Intronic
1073031491 10:100529652-100529674 CTCCGGGTAGGGAGTGGAGGTGG - Intronic
1073300868 10:102470384-102470406 CTCAAGGTTGGGGGTGATGACGG - Intronic
1073766294 10:106686304-106686326 CACTGCGTTGGGGGTGAAGCAGG + Intronic
1074810402 10:117099225-117099247 CTCAGGGTGGGGAGGTAAGGAGG + Intronic
1074863864 10:117533807-117533829 CTCAGGGCTTGCAGTGAACCTGG - Intergenic
1074983410 10:118637514-118637536 CTCCAGGTTGAGGGTGAAGCTGG - Intergenic
1075093089 10:119454269-119454291 CTCAGGGCTGGGTTTGAACCCGG - Intronic
1076687501 10:132204660-132204682 CTCAGGGATGGGAGTCCTGCCGG + Intronic
1076883683 10:133251819-133251841 CTCGGGGTTGGCGGTGCAGCAGG - Intergenic
1077506068 11:2930452-2930474 CCCAGGGGTGGGGGTGGAGCCGG + Intergenic
1077842273 11:5987861-5987883 TTCAGGGTTGAGAGTGAATTGGG - Intergenic
1078448202 11:11420833-11420855 CTGAGTGTTGGGAGTAAATCAGG - Intronic
1078476762 11:11636847-11636869 CTCAGGGTGGTGGGAGAAGCAGG - Intergenic
1079129035 11:17736996-17737018 TTCAGTGTGGGGAGGGAAGCTGG + Intronic
1079481921 11:20890190-20890212 TCCAGGCATGGGAGTGAAGCAGG + Intronic
1083377957 11:62241648-62241670 CTCAGGTTTGGGAGTGAGACAGG + Intergenic
1083384798 11:62299662-62299684 TTCAGGTTTGGGAGTGAGGCAGG - Intergenic
1083633835 11:64109537-64109559 CTCAGGGGTGGGAGTGAGTGTGG + Intronic
1084840506 11:71842699-71842721 CTCAGGGGAGGGTGTGAATCCGG + Intergenic
1085139377 11:74126898-74126920 CTTAGGGCTGGGAGTGATGATGG - Intronic
1085869360 11:80331137-80331159 CTCAGTGTTGGTAGTGATGTGGG + Intergenic
1085925995 11:81021688-81021710 ATCAGGGTCAGGGGTGAAGCAGG + Intergenic
1085991359 11:81850336-81850358 CTCATGTTTTGGAGTGATGCTGG - Intergenic
1087191051 11:95255043-95255065 CTCATGGGTGGGAGTGGAGAGGG + Intergenic
1088207053 11:107404454-107404476 CTAAGGGCTGGGAGGGAACCCGG - Intronic
1089334342 11:117712849-117712871 CACAGGGTGGGGAGAGAGGCGGG - Intronic
1089515272 11:119028093-119028115 CTCTGGGTTGGGTGTGGAGGTGG + Intronic
1090703275 11:129315052-129315074 CCCAGGGTGGGGAGTGGAGTGGG + Intergenic
1090793363 11:130111976-130111998 GTCTGGGTGGGGAGTGAAGCTGG - Intronic
1091574019 12:1715500-1715522 CTCGGGGTTGAGAGGGTAGCGGG - Intronic
1091885618 12:4015179-4015201 CTCAGGGTTGGGAGAGGAAGGGG + Intergenic
1093507531 12:19885859-19885881 GACAGAGTTGGGACTGAAGCTGG + Intergenic
1095940187 12:47721599-47721621 CTCAGGGTGGGGAATGAGGCGGG + Intronic
1095959556 12:47825618-47825640 CTCAGGGTTGGGAGTGAAGCTGG - Intronic
1097009309 12:55941036-55941058 CTCATGGGTGGGAATGAAGTGGG + Intronic
1097283528 12:57860541-57860563 CTCAGAGGTGGGAGTGGGGCAGG + Intergenic
1101126704 12:101642680-101642702 CGCGGGGTTGGGAGTGGGGCTGG + Intronic
1102310389 12:111840432-111840454 CTCAGGGGTTGGAGAGCAGCCGG + Intergenic
1103458535 12:121086080-121086102 GGCAGCGTAGGGAGTGAAGCCGG + Intergenic
1103764935 12:123272882-123272904 CTCAAGGATGGGGGTTAAGCTGG - Intergenic
1104366209 12:128179878-128179900 GTCAGGGTTGGGAGAGTGGCTGG + Intergenic
1104466327 12:128993837-128993859 CTCAGGCTGGGGAGTGGCGCAGG - Intergenic
1107203174 13:37747371-37747393 CTCAGGGTTGGGTGTCAGACAGG - Intronic
1111855190 13:93628268-93628290 CTCAGGGATGGAACTGAACCTGG - Intronic
1112323477 13:98428048-98428070 GTCGGGGGTGGGAGCGAAGCGGG - Intronic
1113240198 13:108328616-108328638 CTCAGGGAAGGGGGTGAATCAGG + Intergenic
1116723242 14:48527990-48528012 CTTAGGGGCGGGAGTGTAGCAGG - Intergenic
1117479327 14:56127640-56127662 CTCAGGGTTGGGAGAGCTACAGG + Intronic
1117742528 14:58833671-58833693 GACAGGGTGGGGAGGGAAGCAGG + Intergenic
1118495379 14:66303603-66303625 CTCATGGAGGAGAGTGAAGCAGG - Intergenic
1119058596 14:71449702-71449724 CTCAGGGTTGGAGGTGAGGTGGG + Intronic
1119094499 14:71816513-71816535 CTCATGGTAGGAACTGAAGCAGG + Intergenic
1119350269 14:73958825-73958847 CTAGGGGCTGTGAGTGAAGCAGG + Intronic
1122283748 14:100638970-100638992 CTCAGTGTTTGGAGTGAGGCAGG + Intergenic
1122293021 14:100689563-100689585 CTCAGGGTGGGGAACTAAGCTGG - Intergenic
1122722528 14:103730307-103730329 CTCAGGGATGTGTGTGGAGCCGG + Intronic
1122893925 14:104746056-104746078 CTCAGTGTTGGGTGGTAAGCAGG - Intronic
1123471987 15:20562450-20562472 CGCAGGGTGGGGAGGGAGGCGGG - Intergenic
1123646016 15:22437903-22437925 CGCAGGGTGGGGAGGGAGGCGGG + Intergenic
1123667321 15:22617757-22617779 CGCAGGGTGGGGAGGGAGGCAGG + Intergenic
1123750426 15:23354823-23354845 CGCAGGGTGGGGAGGGAGGCGGG - Intronic
1124200619 15:27675847-27675869 CTCATGGATAGGTGTGAAGCAGG + Intergenic
1124282796 15:28378739-28378761 CGCAGGGTGGGGAGGGAGGCGGG - Exonic
1124299903 15:28532874-28532896 CGCAGGGTGGGGAGGGAGGCGGG + Exonic
1124321163 15:28712324-28712346 CGCAGGGTGGGGAGGGAGGCAGG + Intronic
1124481334 15:30083030-30083052 CGCAGGGTGGGGAGGGAGGCAGG - Intergenic
1124487789 15:30135126-30135148 CGCAGGGTGGGGAGGGAGGCAGG - Intergenic
1124542880 15:30604103-30604125 CGCAGGGTGGGGAGGGAGGCAGG - Intergenic
1124755739 15:32403195-32403217 CGCAGGGTGGGGAGGGAGGCAGG + Exonic
1124803805 15:32860928-32860950 CTCAAGGTAGGCAGGGAAGCAGG + Intronic
1125346208 15:38721559-38721581 CTCAGGGTGGGTAGGGAAGCTGG + Intergenic
1126422066 15:48485289-48485311 CCCAGGCTTTGGAGTCAAGCAGG - Intronic
1126920219 15:53513309-53513331 TTCAAGGGTGGAAGTGAAGCGGG - Intergenic
1128152463 15:65371882-65371904 CTCAGGGTGTGGACTGAAGCTGG - Intronic
1128380492 15:67108365-67108387 CACAGGGTGGGGAGGCAAGCAGG - Intronic
1128798867 15:70484398-70484420 CTCAGGGTGGGGAGTGGAATGGG - Intergenic
1129236878 15:74229023-74229045 CTCAGGGTTGGCTCTGCAGCCGG - Intergenic
1129888736 15:79057123-79057145 CTGAGGGTTGGGGGTGATGGTGG - Intronic
1130246709 15:82258012-82258034 GTGTGGGTTGGGAGGGAAGCTGG - Intronic
1130453956 15:84085334-84085356 GTGTGGGTTGGGAGGGAAGCTGG + Intergenic
1130472219 15:84235848-84235870 CGCGGGGTGGGGAGGGAAGCGGG - Exonic
1131561463 15:93446703-93446725 TTAAGGGTTGGGGGTGAAGTAGG + Intergenic
1131829280 15:96344014-96344036 CTCTGGGTTGGGGGTGAGGTGGG + Intergenic
1132770597 16:1560545-1560567 CTCAGGGGTGTGTGTGGAGCCGG + Intronic
1133172841 16:3992523-3992545 GTCAGGGCTGGGATTGGAGCAGG - Intronic
1133791602 16:9013362-9013384 TGCAGGGGTGGGAGGGAAGCAGG + Intergenic
1133913648 16:10088444-10088466 CTCAGGGCTGTGAGTGAGGATGG + Intronic
1135399030 16:22152897-22152919 CTCAAGGCTGGGAAAGAAGCAGG + Intronic
1136428857 16:30185750-30185772 CTCAGGGTTGGGAGGGACTCTGG + Intronic
1138595075 16:58025549-58025571 CGCTGGGTTGGGAGTGACGCGGG + Exonic
1139854871 16:69972306-69972328 CTCAGGGCTGGGCATGAGGCAGG + Intergenic
1139883866 16:70195200-70195222 CTCAGGGCTGGGCATGAGGCAGG + Intergenic
1140368650 16:74400298-74400320 CTCAGGGCTGGGCATGAGGCAGG - Intergenic
1141785906 16:86200811-86200833 TTCAGTGTTAGGAGTGAATCTGG - Intergenic
1141804245 16:86332274-86332296 CTCTGGGTTGGGAGAGGGGCTGG - Intergenic
1142195562 16:88737843-88737865 CTCTGGGTGGGGTGTGGAGCTGG - Intronic
1142249908 16:88986483-88986505 GGCAGAGTTGGGAGTGGAGCGGG - Intergenic
1142330567 16:89449936-89449958 CTCAGGGTGCTCAGTGAAGCAGG - Intronic
1143402905 17:6657435-6657457 CTCTGGGGTGCGAGAGAAGCTGG + Intergenic
1144780482 17:17805882-17805904 AGCAGGGCTGGGAGTGGAGCGGG - Intronic
1144891734 17:18498188-18498210 CCCGGGGGTGGGAGTTAAGCTGG - Intergenic
1145140488 17:20446129-20446151 CCCGGGGGTGGGAGTTAAGCTGG + Intergenic
1145795381 17:27652536-27652558 CCCGGGGGTGGGAGTTAAGCTGG - Intergenic
1145809815 17:27757867-27757889 CCCGGGGGTGGGAGTTAAGCTGG - Intronic
1146126063 17:30232584-30232606 TTCAGGGTTGGGATGGAAGCTGG + Intronic
1146616175 17:34359006-34359028 CTCAGGATTGGTAGGGAAGAGGG + Intergenic
1146936537 17:36815701-36815723 CTCTGGGCTGGGAGTCAAGGTGG + Intergenic
1147450505 17:40501117-40501139 CTCAGGGCTCAGAGTGAAGGTGG - Intronic
1148384228 17:47222718-47222740 CTGAGGGATGGGGGTGATGCTGG + Intronic
1149511375 17:57244354-57244376 CTTAGGGTTGGGAGTGAGGCTGG - Intergenic
1150294699 17:64001565-64001587 CCCAGGCCTGGGAGTGAATCAGG + Intronic
1150439246 17:65177948-65177970 CTCAGGGTTAGGGGAGAAGTGGG + Intronic
1153065387 18:1039512-1039534 CTCAGGGGAGGGTGTGAATCCGG + Intergenic
1153306317 18:3634985-3635007 AGCAGGGTTTGGAATGAAGCAGG + Intronic
1153614364 18:6920776-6920798 CCCAGGGTAGGGGGTGAGGCCGG - Intergenic
1153990979 18:10400145-10400167 CTTATGTTGGGGAGTGAAGCAGG + Intergenic
1155014352 18:21817720-21817742 CTCAGTGTTGGAGATGAAGCTGG + Intronic
1156891806 18:42198870-42198892 ATTAGAGTTGGGGGTGAAGCAGG - Intergenic
1158973748 18:62692179-62692201 CTGGTGGTTGGGTGTGAAGCTGG + Intergenic
1160816143 19:1036643-1036665 CTGAGAGTGGGGAGAGAAGCTGG - Intronic
1161851480 19:6740005-6740027 CACAGGGTTGCGAATGAGGCGGG + Intronic
1162373584 19:10292617-10292639 CTCAGGGTCAGGAGTGGTGCCGG - Exonic
1162793573 19:13075417-13075439 CTCTGGGTGGGGAGTGGTGCCGG - Intronic
1162856668 19:13473851-13473873 CTCAGAGTTAGAAGTGAAGGTGG - Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1165170408 19:33888104-33888126 CTCAGGGTTGGCCGAGAAGCTGG + Intergenic
1166082589 19:40453429-40453451 CTAAGGGCTGGGATTGGAGCAGG - Intronic
1166287259 19:41838808-41838830 CTCGGTGCTGGGAGTGGAGCTGG + Intronic
1166717369 19:44977196-44977218 CTCAGGGTGGGGCATGTAGCTGG - Intronic
1167486034 19:49763387-49763409 CACAGGGTAGGGAGAGATGCTGG + Intergenic
1167551735 19:50165872-50165894 CTCAGGCCTGGGTGTGAGGCAGG + Intergenic
1167650034 19:50724050-50724072 CTCAGGGGTGGGAGAGGGGCTGG - Exonic
1168156239 19:54474269-54474291 CGCAGGGGATGGAGTGAAGCAGG + Intergenic
1168318442 19:55494363-55494385 CTTAGGGGTGGCAGAGAAGCGGG - Intronic
1168352823 19:55686337-55686359 CTCAGGACTGGGAGGGAGGCTGG + Intronic
1168398450 19:56068221-56068243 CCCAGGGCTGGGAGAGGAGCAGG + Intergenic
925005691 2:441463-441485 GTCAGGGTGGTGAGGGAAGCAGG - Intergenic
926663548 2:15494748-15494770 CTAAGTGCTGGGAGTGGAGCAGG - Intronic
926809819 2:16746242-16746264 CTCAGGGTAGTGAATCAAGCAGG - Intergenic
927216226 2:20669187-20669209 CTCAGGGTGGAGAGGGAGGCCGG - Intronic
928024655 2:27729701-27729723 CTCAGCTGTGGGAGTGAAGTGGG - Intergenic
928078229 2:28285181-28285203 CTCAGGGTTGGAAATGAAGCAGG - Intronic
928142375 2:28740887-28740909 CTCAGCATTGGGAGTGGAGGAGG - Intergenic
928317429 2:30256886-30256908 CTCAGGCTTGGGAGAGTAGGTGG - Intronic
929106818 2:38373602-38373624 CTCAGAGTAGGTAGTGAAGGTGG + Intronic
929528133 2:42725557-42725579 CTCAGGGTTGGGAGAGCACAAGG + Intronic
929951404 2:46412334-46412356 ACCAGGGCTGGGTGTGAAGCAGG - Intergenic
930986905 2:57600362-57600384 CTCAGAACTGGAAGTGAAGCTGG + Intergenic
931248788 2:60512504-60512526 TTCTGGGTTGGGAGGGGAGCCGG - Intronic
931569485 2:63653323-63653345 CACAGGATTGGGACTGAATCAGG + Intronic
931759821 2:65406828-65406850 CTCAGCCTTGAGAGTGAGGCAGG + Intronic
933843252 2:86304717-86304739 CCCAGGGGTGGGGGTGAAGGTGG - Intronic
934754066 2:96813167-96813189 CTAAGGCTTGAGAGAGAAGCAGG + Intergenic
935198938 2:100839017-100839039 CTCAGGGGTGGGAGAGACGGAGG - Intronic
935831731 2:107007549-107007571 CTCAGGGTAGGCTGTCAAGCTGG - Intergenic
937075832 2:119105903-119105925 CTCACAGTTGGGGGTGAAGGAGG - Intergenic
937220685 2:120341688-120341710 CCTAGGGTTGGGGGTCAAGCTGG - Intergenic
937736724 2:125299475-125299497 CTAAGGCTTGGAGGTGAAGCTGG + Intergenic
939167345 2:138653869-138653891 CTCATGGTGGAGGGTGAAGCAGG + Intergenic
940992433 2:160111301-160111323 CAGAGGGTTGGGAGTGTAGTTGG + Intronic
943618109 2:190116716-190116738 CCCAGAGTTGGGTGTGAGGCAGG + Intronic
944442090 2:199753052-199753074 CACATGGTGGGGAGTGAAACGGG + Intergenic
945513003 2:210725736-210725758 ATGAGGGGTGGGAGTGAAGAGGG + Intergenic
945581589 2:211602084-211602106 CACAGGTTTGGGAGTGGAGTAGG + Intronic
946121858 2:217523279-217523301 TCCAGGGTTAGGGGTGAAGCTGG + Intronic
946173367 2:217908496-217908518 CTCAGGGATGGGGTTGGAGCAGG - Intronic
947960702 2:234234414-234234436 CTCAGGGTTGGTAAGGATGCAGG + Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948926216 2:241100089-241100111 CACAGAGATGGGAGTCAAGCAGG + Intronic
1169485090 20:6023461-6023483 CACAGGGTTGGGAGAAAAGATGG - Intronic
1169494385 20:6100431-6100453 CTCAGGGCTGGGAGGGTAGGAGG + Intronic
1171040247 20:21756174-21756196 CTCAGGGTTGGGTGTGGATGGGG + Intergenic
1172158763 20:32849691-32849713 CTTAGAGTTGGAAGTGCAGCAGG + Exonic
1172944910 20:38679750-38679772 CTTAGAGTTGGGAGTGTAACAGG - Intergenic
1173191953 20:40883474-40883496 CTCAGTGGTGGGATGGAAGCAGG - Intergenic
1173230662 20:41193816-41193838 CTCAGGGTTAGGGCTGAGGCAGG - Intronic
1173569782 20:44068688-44068710 CTCAGGGATGGTAGGGAGGCGGG - Exonic
1174078160 20:47952597-47952619 CCCTGGGTTGGGAATGAACCTGG - Intergenic
1174362488 20:50037736-50037758 CTCAGGGCTCGGAGGGAAGGGGG - Intergenic
1175299080 20:57930157-57930179 CTCAGAGATGAGAGAGAAGCGGG + Intergenic
1175573620 20:60042827-60042849 TTCAGGGGTGGGAGGGAGGCAGG + Intergenic
1176224881 20:63991303-63991325 CTCAGCCTTGGGAATGTAGCTGG - Intronic
1179574813 21:42301455-42301477 CCCAGAGGTGGGAGGGAAGCTGG - Intergenic
1179678000 21:42997825-42997847 CTCAGGGGTGGGAGAGAACCTGG + Intronic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1181002318 22:19993636-19993658 CTCAGAGTTGGGCATGAAGCTGG - Intronic
1181429938 22:22873114-22873136 CTCAGTGCAGGGAGTGATGCAGG + Intronic
1181719731 22:24764252-24764274 CCCAGGGATGGGAGTGGGGCTGG + Intronic
1181782710 22:25204753-25204775 CTGCGGGGTGTGAGTGAAGCAGG - Intronic
1182352079 22:29704804-29704826 CTCAGGGTTGGGAGGGCAGTGGG + Intergenic
1182520876 22:30883921-30883943 GACAGGGTTGTGGGTGAAGCAGG + Intronic
1182818142 22:33187479-33187501 CTCAGGGATGGGAGTGAGGTGGG + Intronic
1183093509 22:35539386-35539408 ATCTGGGTTGGGGGTGAGGCTGG + Intergenic
1183172432 22:36198111-36198133 CTCAGGGGTGGGAGTGCAGGCGG - Intronic
1183177032 22:36231916-36231938 CTCAGGGATGGAAGTGCAGGTGG - Intronic
1183180834 22:36258629-36258651 CTCAGGGGTGGGAGTGCAGGCGG + Intronic
1183927561 22:41216960-41216982 ATCAGGTATGGGAGTGAAGGAGG + Intronic
1183979732 22:41532428-41532450 TTCAGGGTGGGCACTGAAGCTGG - Intronic
1184268003 22:43360301-43360323 CTGTGGGTGGGGAGTGAAGCGGG + Intergenic
1184595903 22:45514159-45514181 CTGAGGGGTGGGAGTGGAGTTGG + Intronic
1184877163 22:47283165-47283187 CTCAGCGCTGGGAGGGAGGCAGG + Intergenic
949554200 3:5138661-5138683 ATCAGGGTGGGGAGTGTGGCAGG - Intronic
949951640 3:9234064-9234086 CTCAGGGTGGGGCCTGAACCTGG + Intronic
950173618 3:10856290-10856312 CTGCGGGTTGAGAGGGAAGCAGG + Intronic
952441242 3:33331507-33331529 CTCAGGGCTCTGGGTGAAGCGGG + Intronic
952767907 3:36970899-36970921 GTGAGGGTTGGGAGTGGAGATGG - Intergenic
953724011 3:45381875-45381897 CTCAGGGGAGGGTGTGAATCTGG - Intergenic
953813402 3:46133414-46133436 CACAGAGCTGGAAGTGAAGCTGG + Intergenic
954735993 3:52706735-52706757 CTGAGGGTTGGGAGGGAGGCGGG - Intronic
954775293 3:53011744-53011766 CTGAGGTTTGGGAGTGAGGGAGG + Intronic
954998304 3:54902216-54902238 GTCAGGCCTGGGAGCGAAGCTGG - Intronic
955631181 3:60977241-60977263 CTCAGAGCTGAGAGTGAACCTGG + Intronic
955788888 3:62568049-62568071 CTAAAAGTTGGGAGTGAACCAGG + Intronic
956881120 3:73511563-73511585 CTCCGGGTTGGGATTGTAGGGGG - Intronic
958080704 3:88742849-88742871 ATCAGTGTTGGGACTGGAGCAGG - Intergenic
959715790 3:109431444-109431466 CTCAGGGCAGGGTGTGAATCTGG - Intergenic
960499726 3:118422693-118422715 CTTGGGGCGGGGAGTGAAGCTGG - Intergenic
960844716 3:121994979-121995001 CTCAGGGGTGGGGTGGAAGCAGG + Intronic
961530547 3:127537458-127537480 CTGAGGGTTGGGAATGGAACAGG + Intergenic
961794997 3:129402990-129403012 CTCAGGGTTGGAGGGGAAGGGGG - Intronic
962352932 3:134668872-134668894 GTTGGGGTTGGGAGTGAAGGTGG - Intronic
962598961 3:136976207-136976229 CTCAGAGAAGGGAGTGAAGCTGG + Intronic
963015411 3:140819938-140819960 CTCAGGGAGGAGAGAGAAGCAGG + Intergenic
964389693 3:156184435-156184457 CTCAGGGCTGGGAGGCAGGCTGG + Intronic
965220519 3:165921092-165921114 CTGAGTGTTGGGAGAGAAGCTGG + Intergenic
966076510 3:175941467-175941489 CTGAGGTGTGGGAGTGATGCTGG - Intergenic
966283958 3:178270888-178270910 CTCAGGGTTGGGAAGGAGGAAGG + Intergenic
969963963 4:10975272-10975294 CTGAGGGATGGGAGCTAAGCTGG - Intergenic
970346637 4:15159077-15159099 CTCAGGGGAGGGCGTGAATCAGG - Intergenic
972028517 4:34419623-34419645 ATGAGTGCTGGGAGTGAAGCAGG - Intergenic
973732041 4:53832314-53832336 TTCAGGGTTGGAATTCAAGCAGG + Intronic
977852539 4:101847843-101847865 CTCAGGGGAGGGAGCGAATCCGG - Intronic
979304859 4:119130777-119130799 CTCATTGTTGGCAGTGAAGGTGG + Intergenic
980873133 4:138632916-138632938 CTCAGGGGTGGCAGTAAAGATGG - Intergenic
982616643 4:157645267-157645289 CTCATGGTGGAGAGTGAAGCAGG - Intergenic
985151864 4:186955401-186955423 GTTAGGGGTGGGAGTGAAGATGG - Intergenic
985428544 4:189855447-189855469 CTCAGGGTAGGGTCTGAGGCTGG + Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
986535302 5:8780276-8780298 CAGAGGGTTAGGAGTGAAGGGGG + Intergenic
986994843 5:13595490-13595512 ATCAGGGTTGAGAGTAAAGGAGG + Intergenic
988590242 5:32542485-32542507 CTCAATGTTGGGTGTGCAGCTGG + Intronic
991164405 5:63546776-63546798 TTCAGGGCTGGGAGGGTAGCAGG - Intergenic
993186293 5:84625655-84625677 AGCAGGGTTAGGAGAGAAGCTGG - Intergenic
993468839 5:88281836-88281858 CTCAGTGTTGGAAGTGGGGCTGG + Intergenic
996369876 5:122741849-122741871 ATCAGGGTGGGGAGAGGAGCTGG - Intergenic
997605303 5:135171100-135171122 CACAGCCTGGGGAGTGAAGCTGG - Intronic
998134222 5:139666311-139666333 CACAGGGATGGGGGTGAAGGGGG - Intronic
999453902 5:151699000-151699022 TTCAGGGGAGGGAGAGAAGCAGG - Intergenic
1001166560 5:169374228-169374250 CTCAGGGGAGGGCGTGAAACCGG + Intergenic
1004194027 6:13487861-13487883 GGCGGGGTTTGGAGTGAAGCAGG - Intergenic
1004200128 6:13540630-13540652 CTTAGGGTTGGGAGTGGAAAAGG + Intergenic
1005994659 6:30923929-30923951 CTCTGGGGTGGCAGTGGAGCGGG - Intronic
1006442732 6:34062137-34062159 CCCAGGGCTGGGAGTCAGGCTGG - Intronic
1006735556 6:36270343-36270365 CTCCGGGGTGGCAGGGAAGCTGG + Intronic
1007238737 6:40410120-40410142 TCCAGGGTTGGGAGTGCATCAGG - Intronic
1007725102 6:43911378-43911400 CTCTGGGCTGGAAGTGATGCAGG - Intergenic
1007741169 6:44010459-44010481 CTCAGGGTTAGGAGTGGGGTTGG + Intergenic
1007747114 6:44049988-44050010 AGCAGGGTGGGGAGGGAAGCAGG + Intergenic
1007843790 6:44737829-44737851 CGGAGGGGTGGGAGTGATGCTGG - Intergenic
1008584771 6:52938570-52938592 CTCAGGGTGGGGAATGAGGTGGG + Intergenic
1012225018 6:96694064-96694086 CTCAGGGAAGGGCGTGAATCCGG + Intergenic
1012369291 6:98483055-98483077 CACAGGATTGGGAGTGAACCTGG - Intergenic
1013608977 6:111776253-111776275 CCCAGGGGTTGGAGTGGAGCAGG + Intronic
1014246425 6:119074729-119074751 CTCAAGATAGGCAGTGAAGCTGG - Intronic
1014893674 6:126873185-126873207 CTCATGGTGGAGGGTGAAGCAGG - Intergenic
1015156446 6:130101711-130101733 ATCAGGGTTGGGTAGGAAGCAGG - Intronic
1015196543 6:130529874-130529896 CTCAGGGGAGGGGGTGAATCAGG + Intergenic
1016369155 6:143353857-143353879 CTCATGTTTGGGAGTTAAGAAGG - Intergenic
1016459417 6:144266369-144266391 CGCAGGGCTGGGAGTGGAACAGG + Intergenic
1019324091 7:429552-429574 CTGAGGGTTGGGGGTGCAGGAGG - Intergenic
1020416213 7:7948968-7948990 ATGAGGTTTGGGAGTGAGGCAGG + Intronic
1022869896 7:34465882-34465904 GTCAGAGGTGGGAGTGAAGAGGG - Intergenic
1023081833 7:36533770-36533792 CCCAGGGTGGGGAGTGGAGAAGG - Intronic
1024603565 7:51007670-51007692 CCCAAGGTTGGGAGCCAAGCTGG + Intergenic
1024692116 7:51814358-51814380 CTGAGGTTTGGGAGAGAGGCTGG + Intergenic
1025819203 7:64947260-64947282 GTGCGGTTTGGGAGTGAAGCCGG - Intergenic
1027519671 7:79189782-79189804 GTCAGGGGTGGGAGGGAAGAAGG - Intronic
1029379691 7:100204944-100204966 CTCAGGCCTGGGAGGGAAGTGGG + Intronic
1030834612 7:114266455-114266477 CTCATGGTGGAAAGTGAAGCAGG + Intronic
1031612811 7:123846628-123846650 CTCAGGGGAGGGTGTGAATCTGG - Intronic
1033409853 7:141107447-141107469 CACAGTGTTGGCAGTGGAGCGGG + Intronic
1033639603 7:143248904-143248926 CTCAGGTTGGGCTGTGAAGCAGG - Intronic
1034349857 7:150408519-150408541 CTCAGGGCTGGGAGTGGTGGGGG + Intronic
1034411779 7:150945850-150945872 CTCTGTGTTGGGACAGAAGCTGG + Intronic
1034691974 7:153021320-153021342 CTCATGGTGGAGGGTGAAGCAGG + Intergenic
1034987002 7:155522463-155522485 CTCAGGGTAGGAACTGGAGCTGG - Intronic
1035824453 8:2629410-2629432 TACAGGGTTGGGAGTGAGGTAGG + Intergenic
1036685292 8:10905355-10905377 CTAAGGGTGGGGTGTGAAGAAGG - Intronic
1038186356 8:25278466-25278488 TTCAAGGTTGAGAATGAAGCTGG - Intronic
1041292362 8:56319778-56319800 CTCCGGGTGGGGAGGGAGGCTGG + Intronic
1041638800 8:60174663-60174685 CTCAGCCCTGGAAGTGAAGCAGG + Intergenic
1043048000 8:75352099-75352121 CTCAGGGCAGGGCGTGAATCTGG + Intergenic
1043383816 8:79729742-79729764 CACAGGGAGGTGAGTGAAGCTGG - Intergenic
1044361014 8:91283728-91283750 CTGAGAGTTGGGAGTGGAGATGG - Intronic
1044426642 8:92059073-92059095 TTCAGGGTTTGAAGGGAAGCTGG + Intronic
1044570458 8:93712221-93712243 CTTAGGGTTGGGAGGCAGGCAGG - Intronic
1045328330 8:101134017-101134039 CTCAGGGATTAGAGTGAAGTAGG + Intergenic
1046074356 8:109299258-109299280 CTCAGGGAAGGGTGTGAATCTGG + Intronic
1046189643 8:110776241-110776263 GTTAGGGTTGGGGGTGAAGCAGG - Intergenic
1046207705 8:111023149-111023171 TTCAGTGTTGGAAGTGAAGCTGG - Intergenic
1046604040 8:116350950-116350972 CTCAGGGTTTGGAGTAGAGACGG - Intergenic
1046827766 8:118710519-118710541 CTAAGGTAAGGGAGTGAAGCAGG - Intergenic
1048004633 8:130409397-130409419 ATCAGGGTTGGTAGGGAGGCAGG - Intronic
1048033029 8:130651105-130651127 CTCAGGATGGGGAGTGCCGCTGG - Intergenic
1049606964 8:143534237-143534259 CTCTGGCCTGGGAGGGAAGCAGG + Intronic
1054877060 9:70107911-70107933 CTCAGTGTGAGGAGTGAAGAGGG + Intronic
1056535076 9:87519810-87519832 CTCAGGGGTGTCAGTGAAGTAGG + Intronic
1056677084 9:88685014-88685036 CGCAGGGGTGGGGGTGGAGCTGG + Intergenic
1057184413 9:93048875-93048897 CTCAGGGTGAGGAGTGCAGGGGG + Intergenic
1058767128 9:108192467-108192489 CTGAGGGTGGGGAGAGAATCAGG - Intergenic
1060101778 9:120847057-120847079 CTCTGGGTGAGGAGAGAAGCAGG - Intergenic
1060299728 9:122368202-122368224 CTCAGGGCCTGGGGTGAAGCTGG + Intergenic
1060587906 9:124798005-124798027 CTCAGTGCTGGGAGAGGAGCCGG + Intronic
1060790581 9:126483047-126483069 CTCAGGGATGGGAGGGGAGCTGG - Intronic
1062114917 9:134803186-134803208 CTCAGGGATGGGCTTGAAGGGGG + Intronic
1062265068 9:135683275-135683297 CTCAGGGCTAGGTGTGAGGCTGG - Intergenic
1185672996 X:1826548-1826570 CCCAGTGTTGGTGGTGAAGCTGG - Intergenic
1185673142 X:1827197-1827219 CCCAGTGTTGGAGGTGAAGCCGG - Intergenic
1187020784 X:15379278-15379300 CTAGGGGCTGGGAATGAAGCAGG - Intronic
1187952638 X:24485828-24485850 GTCAGGTTTGGGAAGGAAGCAGG - Intronic
1188116765 X:26254252-26254274 CACAGGATTGGGAGTGGGGCAGG - Intergenic
1190448867 X:50557762-50557784 CTCAGGGGAGGGAGCGAATCAGG + Intergenic
1190726281 X:53192831-53192853 CTCAGGGGTGGGCGGGTAGCAGG + Exonic
1191903631 X:66064660-66064682 CTCAGGGAAGGGTGTGAATCCGG - Intergenic
1192153222 X:68724625-68724647 TACAGGGTTGGGGGTGAAGGGGG - Exonic
1192496281 X:71618319-71618341 CACAGGGTTGGGTGAGTAGCTGG - Intronic
1192546882 X:72021706-72021728 GTCAGGGATGGGACTGAGGCTGG + Intergenic
1192979104 X:76319432-76319454 CTCAGGGGAGGGCGTGAATCTGG - Intergenic
1193154536 X:78158580-78158602 CTCAGGGGAGGGCGTGAATCCGG + Intergenic
1193423807 X:81316455-81316477 CTCAGGGGAGGGCGTGAATCTGG - Intergenic
1194299144 X:92163320-92163342 CTCAGGGTAGGGCGTGAATCTGG - Intronic
1194423941 X:93713681-93713703 CTCATGGTTGACGGTGAAGCAGG + Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1196464774 X:115960570-115960592 CTCAGGGGAGGGTGTGAATCAGG + Intergenic
1197032435 X:121833588-121833610 GTGAGGGTTGGGAGGGAAGTGGG + Intergenic
1197146276 X:123175957-123175979 CTCAGGGTTGGGCAGAAAGCTGG - Intergenic
1197272130 X:124436420-124436442 CTCAGGGTAGGGAGAGGAGCTGG - Intronic
1198718797 X:139592755-139592777 CTGTGGGTTCAGAGTGAAGCAGG + Intronic
1198821716 X:140655120-140655142 CTAAGGGTTGGGGGTGGAGGTGG + Intergenic
1199731300 X:150635064-150635086 CTCAGAATTGGGGGTGAAGTGGG - Intronic
1199834216 X:151572945-151572967 CTCATGGTGGAAAGTGAAGCGGG + Intronic
1200616748 Y:5388154-5388176 CTCAGGGTAGGGTGTGAATCTGG - Intronic