ID: 1095960733

View in Genome Browser
Species Human (GRCh38)
Location 12:47832879-47832901
Sequence CACCAGAGGAGGGCCCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 273}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095960720_1095960733 -2 Left 1095960720 12:47832858-47832880 CCCACCTCCCCAGCCCAGCTCCA 0: 1
1: 0
2: 16
3: 161
4: 1149
Right 1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 273
1095960723_1095960733 -9 Left 1095960723 12:47832865-47832887 CCCCAGCCCAGCTCCACCAGAGG 0: 1
1: 0
2: 1
3: 58
4: 468
Right 1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 273
1095960721_1095960733 -3 Left 1095960721 12:47832859-47832881 CCACCTCCCCAGCCCAGCTCCAC 0: 1
1: 0
2: 19
3: 227
4: 1764
Right 1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 273
1095960722_1095960733 -6 Left 1095960722 12:47832862-47832884 CCTCCCCAGCCCAGCTCCACCAG 0: 1
1: 1
2: 12
3: 144
4: 1000
Right 1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 273
1095960717_1095960733 12 Left 1095960717 12:47832844-47832866 CCACATGGCACCCACCCACCTCC 0: 1
1: 0
2: 8
3: 104
4: 2016
Right 1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 273
1095960725_1095960733 -10 Left 1095960725 12:47832866-47832888 CCCAGCCCAGCTCCACCAGAGGA 0: 1
1: 0
2: 1
3: 44
4: 489
Right 1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 273
1095960718_1095960733 2 Left 1095960718 12:47832854-47832876 CCCACCCACCTCCCCAGCCCAGC 0: 2
1: 4
2: 17
3: 228
4: 1652
Right 1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 273
1095960719_1095960733 1 Left 1095960719 12:47832855-47832877 CCACCCACCTCCCCAGCCCAGCT 0: 1
1: 3
2: 24
3: 235
4: 1799
Right 1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG 0: 1
1: 0
2: 4
3: 29
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095960733 Original CRISPR CACCAGAGGAGGGCCCTGCT GGG Intronic
900089807 1:915096-915118 TACCAGGGCACGGCCCTGCTTGG - Intergenic
900292026 1:1927706-1927728 CCCCAGAGGAAGGACCTGCATGG - Exonic
901451772 1:9340266-9340288 CAGCAGAGGAGGGGCCTGGGGGG + Intronic
902632219 1:17711737-17711759 AGCCAGAGAAGGGCCCTGATTGG - Intergenic
902651907 1:17842843-17842865 GCCCAGAGGGGGGCCATGCTAGG + Intergenic
902753753 1:18535946-18535968 CAGCAGAGGAGGCCCCATCTGGG + Intergenic
904405878 1:30287618-30287640 CCCCAGAGAGGGGCCCTGATGGG + Intergenic
904439850 1:30523133-30523155 CACCAGTGCAGGGACGTGCTAGG - Intergenic
905587512 1:39132489-39132511 CATAACAGGATGGCCCTGCTTGG + Intronic
905824552 1:41018382-41018404 CACCTGGGAAGGGCCCAGCTTGG - Intronic
905919399 1:41709445-41709467 CACCCGTGAATGGCCCTGCTTGG - Intronic
907245123 1:53103503-53103525 CACCAGAGGAGGCCCCTCCTCGG - Exonic
909352802 1:74673866-74673888 CAACAGAGCAGGGGCTTGCTTGG - Intergenic
910739250 1:90496770-90496792 CCCCAAAAGAGGTCCCTGCTAGG + Intergenic
912387277 1:109277793-109277815 CACCAGTGCAGGGCGCAGCTGGG + Intergenic
912685197 1:111756334-111756356 CCCCGGAGCAGGGCCCTGCCGGG + Intronic
914755733 1:150560775-150560797 CTCCAGAGCAAGGCCCAGCTGGG + Exonic
914799549 1:150950551-150950573 CACGGTAGGAGGGCTCTGCTGGG - Exonic
916576313 1:166070259-166070281 AACCAGAGGTGGCCCCCGCTTGG + Exonic
918189245 1:182156249-182156271 CACTAGAGGAGGGCCTGGTTTGG + Intergenic
920055011 1:203185144-203185166 CAGGAGAGGAGGGACCAGCTGGG - Intronic
921361319 1:214333305-214333327 TAGCAGAGCAAGGCCCTGCTGGG - Intronic
922617925 1:226974107-226974129 GCCCACAGGAGGGCCCTGTTTGG + Intronic
922787984 1:228292804-228292826 CACCAGAAGAGGGCTCTCCTTGG - Intronic
924104522 1:240636976-240636998 AACAAGAAGAGGGTCCTGCTGGG - Intergenic
1063543254 10:6955636-6955658 CTCCAGAGGAGAACCCTGCCTGG + Intergenic
1064858621 10:19799412-19799434 TGTCAGAGGAGGGCCCTGGTGGG - Intergenic
1066665650 10:37780595-37780617 CGCCAGAGGATGGACCTGCGTGG - Intronic
1067567592 10:47349927-47349949 CAGCAGAGGATGGCCCTCCAGGG - Exonic
1068923126 10:62506276-62506298 CATTATAGGTGGGCCCTGCTTGG + Intronic
1069690424 10:70348201-70348223 TTCCACAGAAGGGCCCTGCTGGG + Intronic
1070298549 10:75185951-75185973 CATCAGATGAGGACCCTGCCTGG + Intergenic
1070505903 10:77112476-77112498 TACCAAGGGAAGGCCCTGCTGGG + Intronic
1070913228 10:80136145-80136167 CCCCAGAGGAGGGCTCGGCTGGG - Intronic
1071274744 10:84043185-84043207 CACCAGAGGAGGGTGCTGTGTGG - Intergenic
1073432286 10:103494269-103494291 CACCGGGGGAGGGCCCTGCTGGG - Exonic
1074848614 10:117420855-117420877 GACCAGAGGAAGCCCCTCCTTGG - Intergenic
1075484789 10:122813321-122813343 CACCAGTGGAGGGGACTCCTGGG - Intergenic
1076086100 10:127633725-127633747 CCCCAGGGGAGGGACCTGGTGGG - Intergenic
1076624137 10:131811199-131811221 CACCAGCGGAGGGCGTGGCTGGG + Intergenic
1076802327 10:132836335-132836357 CACACGGGGAGGGCCCTGCTGGG - Intronic
1077114960 11:879964-879986 CATCAAAGGAGGGCCATGGTGGG + Intronic
1077377699 11:2212990-2213012 CAGCAGAAGCTGGCCCTGCTGGG + Intergenic
1077524086 11:3053879-3053901 CACAAGATGAGGACCCTGGTGGG - Intronic
1078418769 11:11189385-11189407 CATCAGAGGAGGGGCCTGGTGGG - Intergenic
1081670171 11:44938306-44938328 CATCAGAGGCGGGGGCTGCTTGG + Exonic
1083721641 11:64606552-64606574 CACCAGGAGAGGCACCTGCTTGG - Exonic
1083779143 11:64909223-64909245 CAGGAGAGGAGGGTTCTGCTGGG - Intronic
1084501444 11:69537958-69537980 AACCAGAGGATGGCCATGTTGGG + Intergenic
1085000190 11:73026728-73026750 TGTCAGAGGAGGGACCTGCTAGG + Intronic
1088290118 11:108227032-108227054 CAACAGAGGAAGGCTCTGCGGGG - Intronic
1088625973 11:111731105-111731127 CACAAGGACAGGGCCCTGCTGGG + Intronic
1088795594 11:113264606-113264628 CATCCTAGGAGGGCCCAGCTTGG + Intronic
1091602921 12:1928837-1928859 CAGGAGAGAAGGGCCCTCCTCGG + Intergenic
1094355767 12:29575580-29575602 CTCCAGAGGAGGGATCTGATGGG + Intronic
1095960733 12:47832879-47832901 CACCAGAGGAGGGCCCTGCTGGG + Intronic
1099587267 12:84533932-84533954 CACTGGAGGAGGGGCCTGATGGG + Intergenic
1099914484 12:88874961-88874983 CGCCAGAGGAGGGCTCTAGTGGG - Intergenic
1100245466 12:92752605-92752627 CACCTGAGGATGGCCCTGAAGGG + Intronic
1102473981 12:113176753-113176775 AACCAGAGGAAGGCTCTGCCAGG - Intronic
1103359802 12:120346817-120346839 TACCAGAGGAGCTCCCAGCTGGG - Intronic
1103468990 12:121165065-121165087 TGCCAGAGGAGGGGCCTGGTGGG - Intronic
1105022382 12:132825755-132825777 AACAAGAAGAGGGTCCTGCTGGG + Intronic
1105240232 13:18601220-18601242 GACCAGTGGAGGCCCCTGGTGGG - Intergenic
1105732739 13:23235148-23235170 CACCTGAGGTGGGGCCAGCTTGG + Intronic
1106365967 13:29081222-29081244 CACCAGAGGAGGGAGCATCTAGG + Intronic
1107753364 13:43593381-43593403 CACTGCAGGAGGGCCCTTCTAGG + Intronic
1107753726 13:43597222-43597244 TATCGGAGGAGGGCCCTGGTGGG - Intronic
1108283964 13:48887293-48887315 AGCCAGAGCAGGGCCCTACTGGG + Intergenic
1113448903 13:110391959-110391981 CCCCAGAGGAGACACCTGCTGGG - Intronic
1116172797 14:41424823-41424845 TACCAGAGGAGGGGACAGCTTGG + Intergenic
1117546491 14:56798083-56798105 CAGCAGCCGCGGGCCCTGCTGGG + Intergenic
1119155433 14:72405782-72405804 CACCAAAGAAGGCCCCTGCCAGG - Intronic
1121844305 14:97159600-97159622 CAGCAGAGCAGGGCACTGGTCGG + Intergenic
1122061506 14:99139418-99139440 CACCAGCTGGAGGCCCTGCTGGG - Intergenic
1122120226 14:99549343-99549365 CACCCAAGGAGGTCACTGCTGGG - Intronic
1122310433 14:100791010-100791032 CACCAGATAAAGGCCCTGCCCGG + Intergenic
1122362185 14:101174129-101174151 CAGAAGATGAGGTCCCTGCTCGG - Intergenic
1122874415 14:104656941-104656963 CACCAGAGGTGGGCGCAGCAAGG + Intergenic
1122943481 14:104994067-104994089 CAACAGGAGAGGGCCCTGATCGG + Intronic
1123067637 14:105626561-105626583 CACTAGCGGAGGGCCACGCTGGG - Intergenic
1123071656 14:105645286-105645308 CACTAGCGGAGGGCCACGCTGGG - Intergenic
1123091319 14:105743562-105743584 CACTAGGGGAGGGCCACGCTGGG - Intergenic
1123097089 14:105771902-105771924 CACTAGCGGAGGGCCACGCTGGG - Intergenic
1123491001 15:20782865-20782887 GACCAGTGGAGGCCCCTGGTGGG + Intergenic
1123547503 15:21351956-21351978 GACCAGTGGAGGCCCCTGGTGGG + Intergenic
1124918574 15:34000986-34001008 AACCAGAGGACAGGCCTGCTAGG + Intronic
1125501304 15:40241601-40241623 CACCAGAGGCAAGCCCTTCTGGG + Intronic
1126306629 15:47266105-47266127 CAACAGGGAAGAGCCCTGCTGGG - Intronic
1127427310 15:58868900-58868922 CTCCAGAGGTGGGGCCTGCTGGG + Intronic
1128227745 15:66013983-66014005 GAGCAGAGGAGGGCCATGGTTGG + Intronic
1129186385 15:73909689-73909711 CACCAGAAGAGGGGCCTCCCTGG - Intergenic
1129515232 15:76153291-76153313 CCCCAGAGGAGGGTCCTGAAGGG - Intronic
1129777827 15:78248331-78248353 CACCAGTGGAGACTCCTGCTTGG - Intergenic
1129946506 15:79543272-79543294 CATCAGAGTTGTGCCCTGCTGGG - Intergenic
1130983116 15:88826508-88826530 CCACAGGGCAGGGCCCTGCTGGG - Intronic
1131368236 15:91857455-91857477 CATAAGAGGAGAGGCCTGCTCGG + Intronic
1131848679 15:96514883-96514905 CATCAAGGGAGGGACCTGCTGGG - Intergenic
1132372677 15:101309218-101309240 CTCCAGAGGAGAGCCCAGCCTGG - Intronic
1202955833 15_KI270727v1_random:79186-79208 GACCAGTGGAGGCCCCTGGTGGG + Intergenic
1132673503 16:1112263-1112285 CACCAGCGGAGGCCCCGCCTGGG + Intergenic
1132740323 16:1408750-1408772 CAGCAGCGGGGGGCCCTCCTGGG + Intronic
1132911805 16:2317577-2317599 CACCCCAGGAGGGCCCTCTTGGG - Intronic
1132990545 16:2790543-2790565 CACAAGAGTAGGACCCTGCTGGG - Intergenic
1133119498 16:3597397-3597419 CACGAGAGGAGGGACCAGCCTGG + Exonic
1133216133 16:4293600-4293622 TACAAGAGGAGGGTCCCGCTGGG + Intergenic
1136711188 16:32238528-32238550 CACAAGAGGAGGGCCCTCCGTGG + Intergenic
1136756719 16:32690879-32690901 CACAAGAGGAGGGCCCTCCGTGG - Intergenic
1136811391 16:33179496-33179518 CACAAGAGGAGGGCCCTCCGTGG + Intergenic
1136817867 16:33289576-33289598 CACAAGAGGAGGGCCCTCCGTGG + Intronic
1136824431 16:33346105-33346127 CACAAGAGGAGGGCCCTCCGTGG + Intergenic
1136829497 16:33444876-33444898 CACAAGAGGAGGGCCCTCCGTGG + Intergenic
1137389401 16:48068873-48068895 CCCCTGAGAAGGGCACTGCTTGG + Intergenic
1137392567 16:48093445-48093467 AGCCAGAGGAGGCCTCTGCTGGG - Intronic
1140876040 16:79153363-79153385 CAGCAGAGGAGGGCTCTGCTTGG - Intronic
1142105468 16:88300054-88300076 AACGGGAGAAGGGCCCTGCTCGG + Intergenic
1142217173 16:88835551-88835573 CAGCAGAGGAGGGCTGTGGTGGG - Intronic
1142412053 16:89921868-89921890 CAGCAGAGGCGGGCCCTGCCAGG - Intronic
1202989969 16_KI270728v1_random:2465-2487 CACAAGAGGAGGGCCCTCCGTGG + Intergenic
1203058868 16_KI270728v1_random:951231-951253 CACAAGAGGAGGGCCCTCCGTGG - Intergenic
1142968777 17:3597290-3597312 CAGGAAAGGAGGGCGCTGCTCGG + Intergenic
1145864116 17:28229105-28229127 CTGCAGAGGAGGTCCCTGCTTGG + Intergenic
1146937789 17:36823502-36823524 CACCAGGGTAGGGCCAGGCTGGG - Intergenic
1147148277 17:38498609-38498631 CGGCAGGGGAGGGCCCCGCTGGG - Intronic
1148333572 17:46826435-46826457 CATAAGAGGTGGGTCCTGCTGGG - Intronic
1150415900 17:64988646-64988668 CAGCAGAGCAGGGCCATGCGTGG + Intergenic
1151827116 17:76529753-76529775 CACCAGAGGAGGGCACTGGCAGG - Intronic
1152051777 17:77984682-77984704 GTCCACAGGAGGGCCCTACTGGG - Intergenic
1152615741 17:81337025-81337047 GTCCAGAGCAGGGCCCAGCTGGG - Intergenic
1152722596 17:81930176-81930198 CACCCTGGGAGGGCCCTGCCTGG - Intergenic
1152884229 17:82839924-82839946 TACCAGAGGTGGGCAGTGCTGGG + Exonic
1154448598 18:14457554-14457576 GACCAGTGGAGGCCCCTGGTGGG + Intergenic
1155187406 18:23399307-23399329 GGCCAGAGACGGGCCCTGCTGGG - Intronic
1155400406 18:25432763-25432785 CATCAGGGGAGGGACCTGGTGGG + Intergenic
1155583223 18:27335887-27335909 CACTGGAGGAGGGGCCTGGTGGG - Intergenic
1156450538 18:37263964-37263986 CACCAGAGGAGGGGGATTCTTGG + Intronic
1157532491 18:48432961-48432983 CACCAGACGTGGAACCTGCTGGG + Intergenic
1158552177 18:58445616-58445638 CAGCAGAGGAGGCTGCTGCTCGG - Intergenic
1160085532 18:75773799-75773821 GCCCACATGAGGGCCCTGCTGGG - Intergenic
1160299533 18:77667615-77667637 CACCCAAGGAGGGTCCTGCCAGG - Intergenic
1160334770 18:78029121-78029143 CTCTAGAGCAGGGCCCTGCTAGG - Intergenic
1160536050 18:79592949-79592971 CACCCAGGGAGGGACCTGCTGGG - Intergenic
1161010096 19:1955744-1955766 CACCGGAGGAGGCTGCTGCTCGG + Intronic
1161316811 19:3621081-3621103 CCCAACAGGAGGGCCTTGCTCGG + Intronic
1161588271 19:5117271-5117293 CAGCAGGGGAGGGCCATGGTCGG + Intronic
1162112109 19:8404863-8404885 CACCGGAGGAGGGCCCAGTGGGG + Intronic
1162716455 19:12637490-12637512 TACCAGGAGAGGGACCTGCTGGG - Intronic
1162719609 19:12654490-12654512 CAGCAGAGGAGGGCTTTGATGGG - Intronic
1162937489 19:13988507-13988529 CACCAGTGGATGGCTCTGCTTGG - Intronic
1164992022 19:32691764-32691786 CACTCGAGGCGGTCCCTGCTCGG + Intergenic
1165609024 19:37134241-37134263 GGCCAGGGCAGGGCCCTGCTAGG - Intronic
1166668741 19:44697466-44697488 CACCAGAGGAGGGGCCAGGGAGG + Intergenic
1167116837 19:47493332-47493354 CACCAGAGGACTCCCCTGGTGGG + Intronic
1167237838 19:48325801-48325823 TTCCAGTGGAGGGCTCTGCTGGG - Intronic
1167438963 19:49497233-49497255 AACAAGAAGAGGGTCCTGCTGGG + Exonic
1168536423 19:57174101-57174123 CACCTGAGGTGGGCCCGGCGTGG - Intergenic
925618316 2:5765611-5765633 AAACAGCGGAGGGCCCTGATAGG - Intergenic
926151006 2:10425512-10425534 CTGCACAGTAGGGCCCTGCTGGG - Intronic
929532790 2:42763068-42763090 CACCAGAGCCGGGCCTTGCTGGG - Exonic
929602027 2:43210495-43210517 CACCAAAGGAGAGCCCAGCCAGG - Intergenic
930737611 2:54795412-54795434 CGCCAGAGGAGGGGCCTGGTGGG - Intronic
932571855 2:72942415-72942437 GACCAGAGGAGGGCCAGGCAGGG + Exonic
932759243 2:74428721-74428743 CCCCAGAGGAGAACCCTGCCTGG - Exonic
933788918 2:85868041-85868063 CACAAGAGAAGGGCCAAGCTGGG + Intronic
935343999 2:102087547-102087569 CATCAGGGGAGGGACCTGGTGGG + Intronic
935737855 2:106120486-106120508 CCCCAGAGGTGGGCCTTCCTCGG + Intronic
937345878 2:121124986-121125008 CACCAGAGGAGGACCCTGCATGG + Intergenic
937867906 2:126767727-126767749 CACAAGAGGAGGCACCTCCTGGG + Intergenic
945893090 2:215451053-215451075 CACAAGAGCAGTGACCTGCTAGG + Intergenic
946045571 2:216818159-216818181 CTCCAGAGGGGGGCAATGCTTGG + Intergenic
947711585 2:232319494-232319516 CACCCCAGGAGGGCCCTGTGTGG - Intronic
1170033834 20:11969696-11969718 CACCAGAGGCCAGCCTTGCTGGG + Intergenic
1171385482 20:24766953-24766975 GCCCAGAGGAGGCCCCTCCTGGG - Intergenic
1171491163 20:25518341-25518363 CACCTGAGGAGGGGATTGCTGGG + Intronic
1172567341 20:35940892-35940914 TACCAGAAGAAGCCCCTGCTCGG + Exonic
1173001647 20:39109747-39109769 CAGCTGAGGAGGGGGCTGCTGGG - Intergenic
1173110670 20:40185172-40185194 CCCCAGAGGAGGGGTCTGGTGGG - Intergenic
1173581753 20:44151942-44151964 AACCAGAGGTGGCCCCTGCAGGG + Intronic
1174042404 20:47709241-47709263 CACAAGAGGAGGGGCAAGCTGGG + Intronic
1175778816 20:61669331-61669353 CACCAGATGGTGGACCTGCTAGG - Intronic
1175938315 20:62525367-62525389 CACCTGAGCAGGGACCCGCTGGG - Intergenic
1176062121 20:63177002-63177024 CTCCTGCGGATGGCCCTGCTGGG - Intergenic
1176142029 20:63549048-63549070 CACCAGAGAGGTGCCCTGCTGGG + Intronic
1179006233 21:37517797-37517819 CTGCAGAGAAGGGCACTGCTGGG + Intergenic
1180077331 21:45469349-45469371 TACCACAGGAGAACCCTGCTGGG - Intronic
1182608732 22:31528500-31528522 CACTAGAGGTGGGTACTGCTGGG - Intronic
1182663863 22:31943864-31943886 CACCAGAGGAGGGGACTGGGTGG - Intronic
1182879815 22:33723801-33723823 AACCTGAGAAGGGCCCGGCTGGG + Intronic
1182942563 22:34291328-34291350 CCTCAGAGGAGCCCCCTGCTTGG - Intergenic
1183094586 22:35544420-35544442 CCCTAGGGGAGGGCCCTCCTTGG + Intronic
1183362013 22:37387723-37387745 CATCAGGGGAGGCCACTGCTTGG - Intronic
1183588457 22:38766635-38766657 CACCAGAGGACAGCCCTGCGGGG - Intronic
1184034991 22:41914023-41914045 ACCCAGAGAAGGGGCCTGCTGGG + Intronic
1184114447 22:42414233-42414255 CACCAGAGGGGAGCCCTGGAGGG - Intronic
1184665447 22:45986674-45986696 CACCAGAGGTGGGCCCTGGATGG + Intergenic
1184765343 22:46569308-46569330 ACCCACAGGAGGGCCCTGCCGGG + Intergenic
1184767053 22:46577438-46577460 CGCCCGCGCAGGGCCCTGCTCGG - Intronic
1184887167 22:47353557-47353579 CACCAGTGGATTCCCCTGCTGGG + Intergenic
1184921445 22:47608467-47608489 CAGCAGAGGGGAGCCCTCCTTGG + Intergenic
1185054318 22:48570078-48570100 CAGCATGGGAGGGCCCTGCCAGG - Intronic
1185220174 22:49625204-49625226 CACCAGAGGAAGTGCCTTCTGGG + Intronic
1185364686 22:50432075-50432097 CACCAGAGGAGGGTGCGGTTCGG - Intronic
950097409 3:10338076-10338098 CACCAGAGCTGGGCCCTGGGGGG + Intronic
950576961 3:13837798-13837820 CACCTGGGCAGGGCCTTGCTGGG - Intronic
954388182 3:50255277-50255299 CAGCAGAGGCAGGCCCTGCAGGG + Intronic
954453807 3:50586169-50586191 CACCTCAGGAGGGCCCTGGGGGG - Intergenic
954907340 3:54074037-54074059 CACCAGATGTGGTCCCTGCCAGG - Intergenic
955928094 3:64027710-64027732 AAAAGGAGGAGGGCCCTGCTTGG - Intergenic
956203936 3:66736755-66736777 CAGAAGAGGAGGGCCCCACTGGG - Intergenic
956699580 3:71947418-71947440 CTCCAGTGGAGGGCTCTGCCAGG + Intergenic
957495898 3:80991057-80991079 TATCAGAGGAGGGTCCTGGTGGG - Intergenic
960231077 3:115228337-115228359 TATCAGAGGAGGGGCCTGGTAGG + Intergenic
961357517 3:126348467-126348489 GGCCAGAGCAGGGCTCTGCTAGG + Intronic
961388840 3:126540140-126540162 CACCAGAGCCAGGGCCTGCTTGG - Intronic
962250328 3:133832294-133832316 GACCAGTGGAGGGTGCTGCTGGG + Intronic
963042603 3:141080593-141080615 CACCAGGGCAGGGCTCTGCTTGG + Intronic
963101469 3:141610171-141610193 CACCAGAGAATGGCCCTGAGCGG - Intronic
963416604 3:145002799-145002821 TATCAGAGGAGGGGCCTGGTGGG - Intergenic
964957367 3:162377759-162377781 CATCAGAGGAATTCCCTGCTGGG - Intergenic
968490852 4:889870-889892 CACCAGCTGAGGGCCCTCCAGGG + Intronic
968576528 4:1368882-1368904 CAGCAGAGGAGGGCGCTGTGGGG - Intronic
969587476 4:8102806-8102828 CACCTGAGGACGGCCATGATTGG + Intronic
969924596 4:10574448-10574470 TGGCAGAGGAGGGCCCTGATTGG - Intronic
970426490 4:15950697-15950719 CTCCAGAGCAGGGCCTGGCTTGG - Intergenic
972720655 4:41693797-41693819 AACCAGAAGAGGGCACTGTTAGG + Intronic
972740857 4:41884809-41884831 CCCCAGAAGAGTGCCCAGCTTGG + Intergenic
976536524 4:86223710-86223732 CACCAGAGGAGGGAGCATCTGGG - Intronic
976956700 4:90910225-90910247 TATCAGGGGAGGGCCCTGGTGGG - Intronic
977785495 4:101029110-101029132 CAACAGATAAGGGCTCTGCTGGG - Intronic
980229981 4:130036784-130036806 CAGCAGAGGAGGGGAGTGCTGGG + Intergenic
985119681 4:186627559-186627581 CCCCAGAGCTGGGGCCTGCTGGG - Intronic
985274019 4:188219928-188219950 CCACAGAGGAGGGTGCTGCTGGG - Intergenic
985748234 5:1659870-1659892 AACCAGAAGGGGGCCCTCCTCGG - Intergenic
985883297 5:2657103-2657125 CACCATAGGAGGGACCGCCTGGG - Intergenic
990180081 5:53151129-53151151 CCACAGAGGAGGGACCTGGTGGG + Intergenic
992381693 5:76243789-76243811 CACCCAAGGAGGGCCCGGCCAGG - Intronic
995053085 5:107728790-107728812 TACCACAGCAGGGCCCTACTGGG + Intergenic
996798689 5:127378660-127378682 CCCCAGAGTAGGGACCTGCATGG - Intronic
998372459 5:141670614-141670636 CACCAGGGGAGGGGTCTGCAAGG + Exonic
999428287 5:151505684-151505706 CAGCATAAGAGGGCCCAGCTCGG + Exonic
999721528 5:154402284-154402306 CACCAGGGCAGGGCCAAGCTTGG - Intronic
1000768470 5:165320234-165320256 CAGCATAGGAGGGACCTGGTTGG - Intergenic
1001244905 5:170098741-170098763 CTCCAAAGGCGGGGCCTGCTGGG + Intergenic
1001367919 5:171162753-171162775 CATCAGTGGAGGCCCCTACTGGG + Intronic
1001774585 5:174319733-174319755 GACCTGAAGAGGGCCCGGCTGGG - Intergenic
1002461734 5:179377257-179377279 CACCAGAGCGGTGCCCTGCGGGG - Intergenic
1003058284 6:2842013-2842035 CCCCTGAGGAGGGCGCTGCCCGG - Intergenic
1005811240 6:29518034-29518056 CATCAGAGTGGGGCCCTGCCTGG - Intergenic
1006417877 6:33915565-33915587 CTTCAAAGGAAGGCCCTGCTTGG + Intergenic
1007999154 6:46340409-46340431 CACCAGAGCTGGGCCCTGATTGG - Intronic
1008399662 6:51049986-51050008 CACCACAAGTGGCCCCTGCTGGG + Intergenic
1014317968 6:119890977-119890999 CACCACAGAGAGGCCCTGCTAGG + Intergenic
1015773698 6:136792898-136792920 CCCCCAAGGAGGGCGCTGCTAGG + Intergenic
1017250044 6:152270700-152270722 AGCCAGATGAGGGCCCTGGTGGG + Intronic
1017695684 6:157013310-157013332 CAACAGAGGAGGCCACTCCTGGG - Intronic
1018093285 6:160363442-160363464 CACAAGAGCGGGGCCCTCCTGGG + Intronic
1018657665 6:166055018-166055040 AACCAGGGAAGGGTCCTGCTAGG - Intergenic
1019174013 6:170150606-170150628 CACCTGGGGCGGGCACTGCTGGG + Intergenic
1019210999 6:170404805-170404827 CAGCAGAGGAGGGCGCTGGCAGG - Exonic
1019269501 7:139192-139214 ACCCAGAGGAGGGGCCTGCCTGG + Intergenic
1020558005 7:9693566-9693588 CACCAGAGGATGGCCATTCTAGG - Intergenic
1022470749 7:30680697-30680719 CACCAGCTGAGGGCTCTGGTGGG - Intronic
1026164818 7:67900481-67900503 CCCCAGAAGAGTGACCTGCTTGG + Intergenic
1031690594 7:124782816-124782838 TATCAGAGGAGGGGCCTGGTGGG + Intronic
1031918617 7:127585423-127585445 CACCAGAGGTGCGCACTGCCAGG + Exonic
1034520570 7:151616214-151616236 CACCAGAGAGAGGCTCTGCTTGG + Intronic
1034541630 7:151762204-151762226 GACGAGAGGAAGGCCCTGCATGG + Intronic
1034907350 7:154962026-154962048 CACCAAAGGCGGCCCCTGTTGGG - Intronic
1035449238 7:158964969-158964991 CACCTGAAGGGGGTCCTGCTGGG + Intergenic
1036064994 8:5369971-5369993 CAATGGAGGAGGGGCCTGCTGGG + Intergenic
1036757530 8:11481142-11481164 CACCAGGGGTGGGCCCTACCAGG + Intergenic
1038483371 8:27917051-27917073 CAGCAGAGTTGGGCCCTGTTCGG - Intronic
1040059745 8:43093792-43093814 AACCAGAGAAGGGCCCGGCGAGG + Intronic
1040803611 8:51370291-51370313 GACCAGAGCAGTGCCCTGCAAGG - Intronic
1046476233 8:114747907-114747929 CACCAAAGGAAGGCCCCGATTGG + Intergenic
1048130585 8:131693085-131693107 CATCAGAGGTGGGGCCTGGTTGG - Intergenic
1048223907 8:132566719-132566741 GGCCAGAGAAGGGCCGTGCTGGG - Intergenic
1048981891 8:139706797-139706819 ACCCAGAGGAGGGCTCTGATTGG - Intergenic
1049166158 8:141127858-141127880 GACCAGGGAAGGGCCCTGCCAGG + Intronic
1049603278 8:143517914-143517936 CCCCAGAGGACAGACCTGCTCGG + Intronic
1052479563 9:29006303-29006325 GGCCAGAGAAGGGCTCTGCTTGG + Intergenic
1053169010 9:35865088-35865110 CACCTCAGCAGGGCCCTCCTGGG - Intergenic
1054564561 9:66746299-66746321 CATCCGAGGAGGGACCTGGTGGG - Intergenic
1056447392 9:86679020-86679042 CAACAGAGGTGGGCTCTGCATGG - Intergenic
1057145909 9:92759541-92759563 CAGCAGAGCAGAGCCCAGCTTGG + Intronic
1057302625 9:93895623-93895645 CACCTGAGAAGGGCCCTGAGAGG + Intergenic
1057967012 9:99514000-99514022 GCCCAGAGGACAGCCCTGCTTGG - Intergenic
1058895809 9:109399771-109399793 CACCTGCAGTGGGCCCTGCTGGG + Intronic
1059285387 9:113167826-113167848 CAGGAGAGGAGGGCACTGATAGG - Intronic
1061761662 9:132855902-132855924 ATCCAGAGGAGGGCCCTGACTGG + Intronic
1062095534 9:134701363-134701385 CACAGGAGGAGTGCCCTGGTGGG - Intronic
1062106142 9:134756077-134756099 CACCACAGGAGAGCCCTGCAAGG - Intronic
1062638008 9:137501563-137501585 CACCAGAGGAGGGCCTGGACTGG - Intronic
1062721240 9:138045316-138045338 CCCCATAAAAGGGCCCTGCTGGG - Intronic
1186733419 X:12434700-12434722 CACCAGGAGTGGGCCCTGATTGG - Intronic
1187503915 X:19863626-19863648 CTCCAGAGCAGAGCCCTCCTGGG + Intronic
1188007084 X:25022870-25022892 GCCCTGAGGAGGGCCCTGCCCGG - Intergenic
1190466396 X:50728388-50728410 GACCCCAGGAGGGCTCTGCTTGG - Intronic
1193777032 X:85656246-85656268 TATCAGAGGAGGGGCCTGGTGGG + Intergenic
1193887939 X:87006459-87006481 CCTCAGAGGTGGGGCCTGCTTGG - Intergenic
1194898386 X:99473981-99474003 CATCAGAGGAGGGGCCTGGTGGG + Intergenic
1195059173 X:101177403-101177425 CACCAGTGGTGGGCTTTGCTGGG + Intergenic
1199533283 X:148873241-148873263 CACCAGTACAGGGCCCTGATAGG + Intronic
1200115759 X:153769071-153769093 CACCAGGTGAGGGCCATCCTGGG + Exonic
1202240561 Y:22763138-22763160 CACCAGGAGAGGTCCCTGCAAGG + Intergenic
1202393547 Y:24396891-24396913 CACCAGGAGAGGTCCCTGCAAGG + Intergenic
1202477238 Y:25273209-25273231 CACCAGGAGAGGTCCCTGCAAGG - Intergenic