ID: 1095961087

View in Genome Browser
Species Human (GRCh38)
Location 12:47834802-47834824
Sequence GAGGCAGGAGCCTCTTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 344}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095961075_1095961087 18 Left 1095961075 12:47834761-47834783 CCACTCCTCTACCACCTCCAGTC 0: 2
1: 1
2: 0
3: 59
4: 676
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344
1095961070_1095961087 28 Left 1095961070 12:47834751-47834773 CCCTCCCCATCCACTCCTCTACC 0: 1
1: 0
2: 6
3: 123
4: 1262
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344
1095961080_1095961087 -4 Left 1095961080 12:47834783-47834805 CCTTCCTGTGAACACAGCAGAGG 0: 1
1: 0
2: 1
3: 22
4: 294
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344
1095961071_1095961087 27 Left 1095961071 12:47834752-47834774 CCTCCCCATCCACTCCTCTACCA 0: 1
1: 0
2: 1
3: 67
4: 685
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344
1095961073_1095961087 23 Left 1095961073 12:47834756-47834778 CCCATCCACTCCTCTACCACCTC 0: 1
1: 0
2: 3
3: 68
4: 581
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344
1095961076_1095961087 13 Left 1095961076 12:47834766-47834788 CCTCTACCACCTCCAGTCCTTCC 0: 1
1: 1
2: 6
3: 86
4: 667
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344
1095961072_1095961087 24 Left 1095961072 12:47834755-47834777 CCCCATCCACTCCTCTACCACCT 0: 1
1: 0
2: 1
3: 55
4: 489
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344
1095961077_1095961087 7 Left 1095961077 12:47834772-47834794 CCACCTCCAGTCCTTCCTGTGAA 0: 1
1: 0
2: 3
3: 36
4: 322
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344
1095961082_1095961087 -8 Left 1095961082 12:47834787-47834809 CCTGTGAACACAGCAGAGGCAGG 0: 1
1: 0
2: 1
3: 70
4: 469
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344
1095961074_1095961087 22 Left 1095961074 12:47834757-47834779 CCATCCACTCCTCTACCACCTCC 0: 1
1: 0
2: 17
3: 175
4: 1560
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344
1095961079_1095961087 1 Left 1095961079 12:47834778-47834800 CCAGTCCTTCCTGTGAACACAGC 0: 1
1: 0
2: 3
3: 26
4: 271
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344
1095961078_1095961087 4 Left 1095961078 12:47834775-47834797 CCTCCAGTCCTTCCTGTGAACAC 0: 1
1: 0
2: 2
3: 19
4: 236
Right 1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG 0: 1
1: 0
2: 3
3: 38
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095961087 Original CRISPR GAGGCAGGAGCCTCTTGGGG TGG Intergenic
900830348 1:4960935-4960957 GAGGCAGGAGCCACTGTGGCTGG - Intergenic
900950973 1:5858199-5858221 GCGGAAGGAGCCCTTTGGGGTGG + Intergenic
900951407 1:5860042-5860064 GAGGCAGGAGGGTCTGGGGCTGG - Intergenic
901379374 1:8862792-8862814 GAGCCAGGAGCTCCTGGGGGAGG + Intronic
901501893 1:9657637-9657659 GAGGGAGGAGTTTGTTGGGGAGG - Intronic
902380303 1:16049465-16049487 GAGGCAGGAGCCTGGTTGTGGGG + Intronic
903832617 1:26183919-26183941 GGGGAAGGTGCCTGTTGGGGGGG - Intronic
904429560 1:30453265-30453287 GACACAGGGTCCTCTTGGGGAGG + Intergenic
905172012 1:36115101-36115123 GAGGCCGGAGCCCCTGGGTGGGG - Intronic
905944608 1:41891030-41891052 GAGCCCGGAGCCTCTGGGTGAGG - Intronic
906673561 1:47677359-47677381 GAGGCCGGGGCCTCCTGGGAAGG - Intergenic
907076826 1:51586741-51586763 GAGGCTGAGGCCCCTTGGGGTGG + Intronic
907631364 1:56085510-56085532 AAGGCAGGAGAATCTTGTGGAGG + Intergenic
907936826 1:59049048-59049070 GAGGCAGGGGTCTCCTTGGGAGG + Intergenic
911716088 1:101134764-101134786 GTGGCAGGAGCCTGTAGGAGTGG - Intergenic
912550690 1:110483524-110483546 GTGGCAGGGGCCACTTGGGCCGG + Intergenic
913368998 1:118075882-118075904 GAGGCAGAAGACTCTTGAGAAGG - Intronic
913683169 1:121206346-121206368 GAGGGAGTAGACTCTTGGGCTGG + Intronic
914154443 1:145074000-145074022 GAGGGAGTAGACTCTTGGGCTGG - Intronic
916855175 1:168741749-168741771 GGGGCAGGGAGCTCTTGGGGAGG + Intergenic
917323902 1:173812092-173812114 GAGACAGCAGCCTCGTGGTGGGG + Intronic
919748489 1:201022987-201023009 GAGACAGCAGCCTCGTGGGGAGG + Intronic
919807572 1:201389357-201389379 GAGGCAGGCTCCTCTAGGGCTGG + Intronic
920470479 1:206224856-206224878 GAGGGAGTAGACTCTTGGGCTGG + Intronic
921357129 1:214295594-214295616 GAGCCCGCATCCTCTTGGGGAGG - Intronic
922314809 1:224433922-224433944 AAGGCAGGAGCCCATTGGCGTGG + Exonic
1063325145 10:5092375-5092397 GAAGCAGGAGCCTATGGGGGTGG - Intronic
1063923305 10:10952400-10952422 AGGGCTGGAGCCTCTTGAGGTGG + Intergenic
1065115180 10:22477314-22477336 GAGGCAGGGTCCTCTGGTGGAGG - Intergenic
1065722116 10:28636994-28637016 AAGCCATGAGCATCTTGGGGAGG + Intergenic
1065763803 10:29008140-29008162 GAGGCAGGAGCCAGTGGGGGCGG + Intergenic
1067767341 10:49097002-49097024 AGAGCAGGAGCCTCTTAGGGAGG + Intronic
1069885020 10:71618290-71618312 GAGGCAGGAGGCTCAGGGTGGGG + Intronic
1070683093 10:78462767-78462789 GAGGCAGGAGGCTGTTGCAGTGG - Intergenic
1072915276 10:99533821-99533843 GGGGGAAGAGCCTTTTGGGGCGG - Intronic
1072936539 10:99718708-99718730 GAGGAAGCAGAATCTTGGGGTGG - Intronic
1072976352 10:100062303-100062325 GAGACAGAAGTCTCTTGTGGAGG + Intronic
1073074613 10:100815911-100815933 GAGGGAGGAGCATCGTAGGGAGG + Intronic
1073204179 10:101759988-101760010 GAGTCAGGAGCCTCTCTGGGAGG + Intergenic
1073440900 10:103552158-103552180 GAGGCAGGAGGCTCAAGGGGAGG - Intronic
1073473665 10:103739275-103739297 GATCCAGGAGCCTGGTGGGGAGG - Intronic
1073755906 10:106580273-106580295 GAGGCTGGAGCATCTTGGGGAGG - Intronic
1074100704 10:110352875-110352897 GGGGCAGGAGCTTGTGGGGGTGG + Intergenic
1075077448 10:119360609-119360631 GAGGCAGGAGCCTGTGTGAGTGG + Intronic
1075329768 10:121565502-121565524 GAGGCCGGAGTCTCTAGGCGTGG + Exonic
1075754449 10:124800051-124800073 GAGACTGTAGCGTCTTGGGGTGG - Intergenic
1075812065 10:125231568-125231590 CGGGCAGGGGCCTCATGGGGAGG + Intergenic
1076545900 10:131245679-131245701 GTGGCAGGAGCCCCTCGGGAAGG - Intronic
1076705892 10:132301445-132301467 CAGGCAGGACCCTCCTAGGGAGG - Intronic
1076847407 10:133076082-133076104 CAGGCAGGGTCCTCTGGGGGTGG + Intronic
1076859090 10:133131762-133131784 GAGCCAGGAGCCCCTCAGGGTGG - Intergenic
1076867213 10:133173934-133173956 GAGAGGGGAGCCTCATGGGGTGG - Intronic
1077093264 11:788958-788980 GGGGCAGGAGGCTCTTGGTGGGG + Intronic
1077266031 11:1650747-1650769 CAGGCAGGAACCTCTGGGTGTGG - Intergenic
1077384537 11:2262835-2262857 CAGGGAGGGGCCTCCTGGGGGGG - Intergenic
1077485073 11:2834872-2834894 TCTGCAGGAGCCTCGTGGGGAGG - Intronic
1083853127 11:65379260-65379282 GAGGCATAGGCCTCTTGGAGGGG - Intronic
1084170051 11:67396708-67396730 GAGGCAGGAGCTGCCTGGGCTGG + Intronic
1084195666 11:67522672-67522694 GGGGCAGGAGCCCCTTGGTGGGG + Exonic
1084558566 11:69889836-69889858 TGGGGAGGGGCCTCTTGGGGAGG + Intergenic
1085527756 11:77173990-77174012 GAGGCAGGAGACCCTTGAGGAGG - Intronic
1088881581 11:113977168-113977190 GTGCGAGGATCCTCTTGGGGTGG + Intronic
1088971631 11:114779462-114779484 GTGCCAGGAGCCACTTGGAGCGG + Intergenic
1089002864 11:115066915-115066937 GAGCCAGGAGCAGCTTGGTGGGG + Intergenic
1089068363 11:115679381-115679403 GAAGCAGGAGCCTCTGGGAATGG + Intergenic
1089359438 11:117876362-117876384 GAGAGAGGAGCCTCTAGGGGAGG - Intronic
1089614497 11:119687604-119687626 TAGGCAGCAGCCTCTTTGGAAGG + Intronic
1089969792 11:122683516-122683538 GAGGCAGGAGAATCTGGAGGCGG + Intronic
1090273807 11:125405743-125405765 GAAGCAGGAGCCTCTCAGGAGGG - Intronic
1090723025 11:129494164-129494186 GGGTCAGGACCCTCTTGAGGAGG - Intergenic
1091063345 11:132485539-132485561 GTGGCAGGAGCCACATGGTGGGG - Intronic
1091288406 11:134422419-134422441 GAGGCAGGAGCACAGTGGGGCGG + Intergenic
1092218920 12:6700164-6700186 GGGGCAGGAGCCTCGGGGTGCGG + Exonic
1092228582 12:6764630-6764652 GAGGAAAGAGCCTGATGGGGAGG + Intronic
1092295139 12:7191150-7191172 GAGGCAGGACCCACTGGAGGGGG - Intronic
1094041137 12:26122698-26122720 CAAGCAGGAGCCTCCCGGGGAGG - Exonic
1094840642 12:34341393-34341415 GTGGCAGGGGCGTCATGGGGTGG - Intergenic
1095824452 12:46516735-46516757 TAAGAAGGAGCTTCTTGGGGAGG - Intergenic
1095961087 12:47834802-47834824 GAGGCAGGAGCCTCTTGGGGTGG + Intergenic
1096520240 12:52180867-52180889 GAGGAAGGAGCCCCTGGGGCAGG + Intronic
1096984299 12:55745902-55745924 AGGGCAGGGGCCTCTTGGTGTGG - Intronic
1097070250 12:56349341-56349363 TAAACAGAAGCCTCTTGGGGTGG - Intronic
1097167179 12:57092125-57092147 GGGGTAGGGGCCTGTTGGGGAGG - Intronic
1097264134 12:57736261-57736283 TAGGCAGGAGACTCTTGGTTCGG - Intronic
1099860702 12:88222385-88222407 TAGGAAGCAGCCTCCTGGGGTGG - Intergenic
1100515030 12:95319347-95319369 CAGGCATGAGCCACTGGGGGTGG - Intergenic
1103618893 12:122173766-122173788 GAGAGAGGAGCCTCTTTGGAGGG + Intronic
1103977870 12:124715432-124715454 GAGGCAGAAGCCTCTTTTGCAGG + Intergenic
1104106717 12:125667438-125667460 GAGGCAGGAGCCTTTTGTTCAGG + Intergenic
1104585109 12:130042296-130042318 CGGGCAGGAGCCTGTTGGGAAGG - Intergenic
1107975377 13:45683402-45683424 AAGGCAGGAGCCACTTGTGGAGG - Intergenic
1112905207 13:104409410-104409432 GAGGCAGGAGACACTGGGTGTGG + Intergenic
1114554933 14:23556406-23556428 GAGCCAGTAGCCTCCTGGGGTGG + Exonic
1115706029 14:35998885-35998907 AAGGCAGGAGCCAATTGGTGAGG + Intergenic
1116285031 14:42959952-42959974 CAGGCATGAGCCACTTGGTGTGG - Intergenic
1117086114 14:52203106-52203128 GAAGCACGAGCCTCTTGCTGGGG - Intergenic
1118381672 14:65222619-65222641 CAGCCAGGGGCCTCTGGGGGAGG + Intergenic
1119485615 14:74984820-74984842 GGGGCAGGGGCTCCTTGGGGAGG + Intergenic
1119894516 14:78208608-78208630 GAGGCTGGAGCCTCTGGAGTGGG + Intergenic
1121456424 14:94041650-94041672 GAGGCAGGGGCCTGGTGTGGAGG - Intronic
1122925245 14:104896365-104896387 CAGACAGCAGGCTCTTGGGGCGG - Exonic
1124216653 15:27812989-27813011 GGTGCAGGAGCCTCCTGGGGAGG - Intronic
1124482534 15:30090327-30090349 CGGGCAGCAGCCTCTTGGGAGGG + Intronic
1124499258 15:30212319-30212341 GAGGCTGGCTCATCTTGGGGCGG - Intergenic
1124521040 15:30406882-30406904 CGGGCAGCAGCCTCTTGGGAGGG - Intronic
1124537622 15:30559338-30559360 CGGGCAGCAGCCTCTTGGGAGGG + Intronic
1124544077 15:30611393-30611415 CGGGCAGCAGCCTCTTGGGAGGG + Intronic
1124564041 15:30798828-30798850 CAGGCAGCAGCCTCTGGGGAGGG + Intergenic
1124744321 15:32326351-32326373 GAGGCTGGCTCATCTTGGGGCGG + Intergenic
1124754539 15:32395894-32395916 CGGGCAGCAGCCTCTTGGGAGGG - Intronic
1124761034 15:32448249-32448271 CGGGCAGCAGCCTCTTGGGAGGG - Intronic
1124777600 15:32600814-32600836 CGGGCAGCAGCCTCTTGGGAGGG + Intronic
1127766911 15:62195295-62195317 GAGGCAGGGGCATCTTGGAAAGG + Intergenic
1128624549 15:69186211-69186233 GAGGCAGGACCCTCTCTGGAGGG + Intronic
1129060499 15:72856908-72856930 AAGGCAGGAGCCCCTGGTGGAGG - Intergenic
1129191473 15:73940213-73940235 CAGGCAGGGGCCTCTTGTTGCGG - Intronic
1129394256 15:75235625-75235647 GAGGCTGGCGCCTCGTGGGATGG + Intergenic
1129518861 15:76173119-76173141 GAGGCAGCGGCATCTTGGGGCGG + Intronic
1129606474 15:77027696-77027718 GAAGCAGCAGGCTCTGGGGGAGG + Intronic
1130062093 15:80577560-80577582 GAGGCTGGCAGCTCTTGGGGAGG + Intronic
1130099650 15:80882965-80882987 GCAGCAGGAGCTTCCTGGGGAGG + Intronic
1130312123 15:82765019-82765041 GAGGGAGGAGCCTAATGGGGAGG - Intronic
1130362011 15:83197936-83197958 GAGGCAGGAGAACCTGGGGGCGG + Intronic
1130783352 15:87069035-87069057 GCTGCAGGAGGCTTTTGGGGAGG + Intergenic
1130971698 15:88738867-88738889 GAGCCAGGGGCCGCTTGGAGGGG + Intergenic
1131891726 15:96979246-96979268 CAGGTAGGAGCCTATTGGGTGGG - Intergenic
1132119832 15:99167205-99167227 GAGGCAGCAGCCACTTGAAGGGG - Intronic
1132258679 15:100401665-100401687 GAGGCCTGAGCCTCTGGGGAGGG - Exonic
1132367280 15:101266788-101266810 AAGGCATGAGCCTCTGGGGATGG - Intergenic
1132737779 16:1395603-1395625 GAGGCAGGAGGTTCCTGGGGCGG - Intronic
1132932872 16:2467827-2467849 GAGGCGGGCGCCGCTGGGGGAGG - Intergenic
1134090120 16:11387059-11387081 GAGGCAGGGGGCTCTCAGGGAGG + Intronic
1134514556 16:14876293-14876315 GAGACAGGAGCTTCTTGGTTGGG - Intronic
1134702233 16:16274946-16274968 GAGACAGGAGCTTCTTGGTTGGG - Intronic
1134969597 16:18519704-18519726 GAGACAGGAGCTTCTTGGTTGGG + Intronic
1136235288 16:28910158-28910180 GAGGCAGGAGCCCCTTGCAGGGG + Intronic
1137637515 16:49999679-49999701 GAGGCAGGAGCATCGGGTGGGGG + Intergenic
1137807292 16:51319435-51319457 TAGGCTGGAGCCTCTTGAGCTGG - Intergenic
1138086175 16:54135687-54135709 GTGGGAGGAGCCCCTTGTGGGGG - Intergenic
1138278514 16:55754503-55754525 GATTCAGGGGCTTCTTGGGGAGG - Intergenic
1138290040 16:55839118-55839140 GATTCAGGGGCTTCTTGGGGAGG + Intergenic
1138450747 16:57092491-57092513 GAGGCGGGAGCTTCCTGGAGGGG - Intergenic
1139901159 16:70329707-70329729 GGGAGAGGAGCGTCTTGGGGAGG - Intronic
1139906005 16:70366500-70366522 GGGGGAGGAGCATCTTGGGGAGG - Intronic
1141166910 16:81667016-81667038 AAGCCATGAGCCTGTTGGGGTGG + Intronic
1141643414 16:85354741-85354763 GCAGCAGGAGCCTCTGGGGCTGG + Intergenic
1141708741 16:85685126-85685148 GAGGCAGCAGGCTGTTGGGTAGG + Intronic
1142179859 16:88663131-88663153 GAGGCAGAGGCCTCTGGGGTGGG - Intronic
1142388832 16:89784760-89784782 TCTGCAGGAGGCTCTTGGGGAGG + Intronic
1142492860 17:289880-289902 GAGGCAGGAGCCCATTCTGGAGG - Intronic
1143191997 17:5046684-5046706 GAGGAAGAAGCCCCTTGGGCAGG - Intronic
1143679773 17:8467643-8467665 GTGGCAGGAGCCTCTGGGACGGG + Exonic
1143958395 17:10693735-10693757 GAGGCTGGAACCTCTTGTTGTGG + Intronic
1144334479 17:14256512-14256534 GGGGCAGGAGCCTGTTTGGTGGG - Intergenic
1144789109 17:17847699-17847721 GGGGCAGGAGCCTCCATGGGGGG + Exonic
1144950905 17:18992888-18992910 GAGGCAGGAGCTGTGTGGGGAGG - Intronic
1145193253 17:20866528-20866550 GAGGTAGGAGCCTGGTAGGGTGG - Exonic
1145752973 17:27368406-27368428 GAAGGAGGAGCCTATGGGGGAGG - Intergenic
1145784661 17:27586162-27586184 GATGCAGAAGCCCCTTTGGGAGG + Intronic
1145835444 17:27951166-27951188 GAGCCCGGAGCTCCTTGGGGAGG + Intergenic
1145985379 17:29042673-29042695 GAGGCAGGGGCCAATTGGGAGGG - Intronic
1146415991 17:32633695-32633717 GAGGAAGGAGCCTTCTGGGATGG - Intronic
1146648826 17:34593669-34593691 GAGGCAGCAGCTTCTAGGGCCGG + Intronic
1147568477 17:41552284-41552306 GGGGCAGGAGCCTCTGAGGTGGG + Intergenic
1147675911 17:42205461-42205483 GAGGCTGGAGCCTCTTGAGCAGG - Intronic
1148461246 17:47840222-47840244 GACGAAGGAGCCAGTTGGGGAGG - Exonic
1148477240 17:47936873-47936895 GAGTCTGGAGCTTCGTGGGGAGG - Intergenic
1149356607 17:55845754-55845776 GAGCCAGGGGCCTCACGGGGGGG - Intergenic
1149567692 17:57651652-57651674 CAGGCAGGAGGCACTTGGGACGG - Intronic
1149568315 17:57654643-57654665 GCTGCAGGAGCATCCTGGGGAGG - Intronic
1149991268 17:61384863-61384885 GAGGGAGGAACCTGGTGGGGAGG + Intronic
1150284225 17:63946345-63946367 CAGGAAGGGGCCGCTTGGGGGGG + Intronic
1151168772 17:72227809-72227831 GAGCCAGGAGCCTCTCGTAGTGG - Intergenic
1151554913 17:74841893-74841915 TAGGCAGGTCCCTCTTGGGGAGG - Intergenic
1151699374 17:75734830-75734852 GAGGAAGGTGCCTCTGGGGAAGG + Intronic
1152110217 17:78353559-78353581 GAGGATAGGGCCTCTTGGGGTGG + Intergenic
1152284095 17:79402564-79402586 AAAGCAGGAGCCACATGGGGTGG + Intronic
1152569738 17:81116434-81116456 GAGGCAGGAGGGGCCTGGGGAGG - Exonic
1154175685 18:12086430-12086452 GTGGCAGGAGCCTTGTAGGGAGG + Intergenic
1154495132 18:14950462-14950484 CAGGCAGGAGTCTCCTGGAGAGG + Intergenic
1155910224 18:31497829-31497851 GAGGAGGGAGCCTCCTGGCGGGG - Intergenic
1156615833 18:38783291-38783313 CAGGCAGAAGCCTCTTGAAGAGG - Intergenic
1157242970 18:46028342-46028364 GAAGCGGCAGCCTTTTGGGGCGG - Intronic
1157448898 18:47770854-47770876 GAGGCTGGAGCCTCCGGAGGTGG + Intergenic
1159933861 18:74344321-74344343 GAGGCTGGAAACTATTGGGGAGG + Intronic
1161031392 19:2059429-2059451 GAGGCAGGCGTCCCTGGGGGAGG + Intergenic
1161062735 19:2223191-2223213 CAGACAGGAGCCTCCTGGGGCGG + Intronic
1162081451 19:8220259-8220281 GAGACAGGAGCCTCGGGGAGGGG - Intronic
1162125925 19:8499480-8499502 GCGGCGGGGGCTTCTTGGGGAGG + Exonic
1162125936 19:8499516-8499538 GCGGCGGGGGCTTCTTGGGGAGG + Exonic
1162125947 19:8499552-8499574 GCGGCGGGGGCTTCTTGGGGAGG + Exonic
1162503756 19:11069871-11069893 GGGGCAGGAAGCACTTGGGGCGG + Intergenic
1163090289 19:15014707-15014729 GAGGCAGGAGACTCAGTGGGGGG + Intronic
1163188504 19:15658412-15658434 GGGGGAGGAGCCTCCTGGGTAGG + Intronic
1163396384 19:17065367-17065389 GAGGCAGGACCCTCTCTGGCAGG - Intronic
1163450276 19:17373168-17373190 CAGGCAGGACCCTATTGGGAGGG + Intronic
1163576172 19:18112041-18112063 CAGACAGGGACCTCTTGGGGAGG + Intronic
1163608763 19:18290510-18290532 CAGGCAGCTGCCTCTTGGGCAGG + Intergenic
1163730480 19:18946551-18946573 GAGGAGAGAGCTTCTTGGGGAGG - Intergenic
1163737936 19:18992919-18992941 GAGGCAGGCTCCTCCTGGGGTGG - Exonic
1166048093 19:40241647-40241669 GAGGCTGGGGCCTGTTGGGGAGG - Intronic
1166930670 19:46299284-46299306 GGGGCAGGGGCCTCTTGGGTGGG + Intronic
1167120476 19:47513786-47513808 GAGGCTGGAGACTCCTGGGTGGG - Intronic
1167260364 19:48454576-48454598 GAGGCACGTACCTGTTGGGGCGG - Exonic
1167622541 19:50567767-50567789 GAGGCAGAAGCCGGTGGGGGAGG - Intronic
1168292494 19:55363261-55363283 GGGGGAGGAGCCTCTGGTGGAGG + Intergenic
925126545 2:1461244-1461266 GAGGAAGGAGCCTCTGGGGGCGG - Intronic
926753621 2:16219169-16219191 GACCCAAGATCCTCTTGGGGTGG + Intergenic
927112558 2:19874374-19874396 GAGACAAGAGCATCTTTGGGGGG + Intergenic
928022689 2:27716223-27716245 GGGGCAGGAGGCTGTAGGGGAGG - Intergenic
929513601 2:42585749-42585771 GAGGCATGAGCCACTTTGCGTGG + Intronic
931140073 2:59448021-59448043 GAGCCACAAGCCTCTTAGGGAGG - Intergenic
932432796 2:71685715-71685737 GAGGCAGGAGGCGTTTGGCGGGG + Intronic
933778355 2:85785400-85785422 GAGGCGGGAGCATCTTGATGTGG - Intronic
933837071 2:86254739-86254761 GAGGCTGGAGCCTTTTGTGTAGG + Exonic
934491957 2:94767624-94767646 CAGGCAGAAGCCTCTTGCAGAGG + Intergenic
934662140 2:96148715-96148737 CTGGCAGGAGCCTGTGGGGGTGG - Intergenic
935216750 2:100980954-100980976 CAGGGTGCAGCCTCTTGGGGTGG + Intronic
936370566 2:111898847-111898869 GAAGCAGGGGCCTCTGGGGAGGG + Intronic
937086299 2:119174188-119174210 GAGCCAGGAGCATCCTTGGGAGG + Intergenic
937208249 2:120250843-120250865 GTGGCAGGACCCTTTTGGCGGGG - Intronic
937212999 2:120289661-120289683 GAGGCAGGTGCCTGTGGAGGAGG + Exonic
937812373 2:126213164-126213186 GAGGCAGAAGCCCCCTGGGAAGG + Intergenic
937858660 2:126691270-126691292 GGGGCAGCAGTCTCATGGGGTGG - Intronic
937859161 2:126694855-126694877 GGGGCAGCAGTCTCATGGGGTGG - Intronic
937896708 2:126981613-126981635 GAGACAGGAGGCACTTGGAGGGG - Intergenic
937903437 2:127039985-127040007 GAGGCAGGCCCCCCTTGGGCTGG + Intergenic
938064147 2:128272031-128272053 AAGGCAGGAGCCTGGTGGTGAGG + Intronic
938226637 2:129622397-129622419 CAGGCAGGAGCCTCTGGGCCTGG - Intergenic
943341831 2:186691571-186691593 GAGGCAGGAGCCATTGGGGGAGG - Intergenic
944636814 2:201682592-201682614 GAGGAAGGAGCTGCTTGGGACGG + Intronic
945187239 2:207151517-207151539 AAGGCAGGCGCATCTTGGGTAGG + Intronic
947450738 2:230206245-230206267 GAGGCAGGAGCCAGTTGTGTGGG - Intronic
947850720 2:233285536-233285558 GGGGCAGGAGCCTCCTGTGCTGG + Intronic
948825620 2:240572321-240572343 AAGGCAGGAGGCTCTGGGAGGGG - Intronic
1169072805 20:2743400-2743422 AAGGCAGGAGCCTTTAGGGGCGG + Intronic
1169689990 20:8319831-8319853 AAAGGAGAAGCCTCTTGGGGTGG + Intronic
1171209300 20:23304656-23304678 GAGGCAGGATGCTGTTGGGGAGG - Intergenic
1171209358 20:23304855-23304877 GAGGCAGGATGCTGGTGGGGAGG - Intergenic
1171938947 20:31305441-31305463 TAGGCAGAATCCTCTTGGGGTGG - Intronic
1172135039 20:32681160-32681182 AAGCCAGGAGGCTCCTGGGGTGG - Intergenic
1172288605 20:33758822-33758844 GAGGCAGGTGGCTCCTGGGCAGG + Intronic
1172393363 20:34581721-34581743 GAGTCAGGAGTCTCTAGGGTAGG - Intronic
1173164787 20:40680094-40680116 GAAGCAGCAGCCTCTAGGCGAGG - Intergenic
1173247344 20:41345729-41345751 GCTGCAGGAGCTTCTTGTGGAGG + Intronic
1173392397 20:42646793-42646815 GAGGGAGGAACCTGTTGAGGAGG - Intronic
1174121548 20:48269483-48269505 GAGCCAGGAGCCTGTTTAGGCGG + Intergenic
1174126848 20:48312672-48312694 GACACAGGTGACTCTTGGGGAGG - Intergenic
1174338891 20:49883786-49883808 GAGGCAGCAGCTTCATGGGCTGG - Intronic
1174567717 20:51478788-51478810 TTGGCAGGAGCCTAGTGGGGTGG - Intronic
1174830676 20:53809306-53809328 AAGGCAGCAGCCTCTGGAGGAGG - Intergenic
1175185738 20:57178671-57178693 GAGGGAGGAGGCTCGTGGAGGGG - Intronic
1175694271 20:61089738-61089760 GAGGCAGGAGGCTTGGGGGGCGG - Intergenic
1175862780 20:62159129-62159151 GAGGCAGGAGCAGTGTGGGGAGG + Intronic
1175978161 20:62723935-62723957 GAGGCAGCAGCCTCTGGGGCAGG + Intronic
1178084129 21:29095345-29095367 GAGGCAGGAGCCTTTTGTGTGGG + Intronic
1179988760 21:44934942-44934964 CAGGCAGGAGCCCATGGGGGAGG + Exonic
1180642505 22:17310547-17310569 TAAGCAGGAGCCGCTGGGGGCGG - Intergenic
1181169859 22:21001988-21002010 CAGGCCAGAGCCCCTTGGGGAGG - Exonic
1181358422 22:22316496-22316518 AAGGCAGAAGCCTGTTGTGGGGG - Intergenic
1181505607 22:23354368-23354390 GATTCAGGGGCTTCTTGGGGAGG - Intergenic
1181655520 22:24294658-24294680 GAGGCATGAGCCACTGGGGCCGG + Intronic
1181709400 22:24672276-24672298 GAGGCATGAGCCACTGGGGCCGG + Intergenic
1181952635 22:26565399-26565421 GAGGGAGGAGCCTTTAGGAGAGG - Intronic
1183014402 22:34974014-34974036 GAGGCAGGAGCTTAATGGGAAGG - Intergenic
1183675217 22:39295287-39295309 GTGGGAGGAGCGTGTTGGGGAGG - Intergenic
1184643905 22:45885894-45885916 GAGGGAGGAGCCTGGTGGCGAGG + Intergenic
1184791223 22:46701318-46701340 GGGGCAGCAGCCTCTGGAGGAGG + Intronic
1184806096 22:46795922-46795944 GAAGCAGGAGCCTCTGAAGGAGG + Intronic
1185255525 22:49828673-49828695 GAGGCAGGAGGCTATTGGTCCGG + Intergenic
950200359 3:11037949-11037971 GAGGCGGCAGCAGCTTGGGGTGG - Exonic
952285402 3:31963576-31963598 AAGCCAGGCGCCTCTTTGGGTGG - Intronic
954649659 3:52153484-52153506 GAGGGAGGAGCAGCTGGGGGAGG + Intronic
960163290 3:114373605-114373627 GAGGAAAGAGCCTCTTGAAGTGG - Intronic
960903761 3:122577617-122577639 GAGGCACAAGCCTGTTGGGTGGG + Exonic
962807697 3:138938886-138938908 GCGGCAGAAGCCTTTCGGGGGGG + Intergenic
964276355 3:155012528-155012550 GAGGCAGGAGACTCTTTGGGAGG - Intergenic
965375358 3:167916222-167916244 GGGGCAGGAACTTCTTGGGCTGG + Intergenic
966412974 3:179662276-179662298 GAGGGAGGGGCCTCTTGGAGTGG + Intronic
967500746 3:190194711-190194733 CCGGGAGGAGCCTCTTGGTGTGG - Intergenic
967827982 3:193894203-193894225 GAGGGAGGGGCCCTTTGGGGAGG - Intergenic
968659876 4:1794516-1794538 GAGGCTGCTGCCTCTTCGGGCGG - Intronic
968841850 4:3013046-3013068 GAGGCAGGAGAATCTTGAGACGG + Intronic
969460694 4:7327251-7327273 GAGTCAGGAGGCTTTGGGGGAGG + Intronic
969519229 4:7666124-7666146 GAGGCAGGAGACTCAGGGGGAGG + Intronic
969636234 4:8370773-8370795 CATGGAGGAGCTTCTTGGGGAGG - Intronic
971343124 4:25788830-25788852 GAGGCTGGAAGCTCTTGGGAGGG + Intronic
971684922 4:29751873-29751895 GAGGCTGGAGGCTCATTGGGTGG + Intergenic
973975632 4:56259736-56259758 GAGGCAGGAGCCACAGGGGTCGG - Intronic
982276317 4:153640038-153640060 TGGGAGGGAGCCTCTTGGGGAGG + Intergenic
984799400 4:183699752-183699774 GAGGAAGGAGCCACATGAGGAGG - Intronic
985125017 4:186684466-186684488 GAGGCAGGTGCATCCCGGGGAGG - Intronic
985128706 4:186720826-186720848 GAGGCAGGACTGTGTTGGGGAGG + Intronic
985634893 5:1031074-1031096 GTGGCAGGAGGCGCTTGGGGGGG + Intronic
986134238 5:4959337-4959359 GAGGCAGGAGCCTCCAAGGGTGG - Intergenic
988437537 5:31193827-31193849 GAGGCAGGAGCAGCCTGGGCGGG + Exonic
988501844 5:31790192-31790214 GAGGCAGGAGACTCAGGAGGTGG - Intronic
991539697 5:67713418-67713440 GAGGCAGCAGACTGTTGGTGTGG + Intergenic
991970169 5:72133221-72133243 GAGGCAGGAGGATCCTGGAGAGG - Intronic
992105729 5:73448052-73448074 GGGGCAGGAGCCGGTGGGGGCGG - Exonic
997258077 5:132444403-132444425 GAGGAAGGAGGTGCTTGGGGAGG - Intronic
997653081 5:135536277-135536299 GAGGCACGCTCCTCTTGGGGCGG + Intergenic
997897876 5:137736045-137736067 GAGGCAGGAGCCCCAGGGGCGGG - Exonic
998483840 5:142485033-142485055 GAGGCAGGAAGCTCTGGGAGGGG - Intergenic
999916796 5:156271411-156271433 GAGGCAGGAGCTTCTTATGCTGG + Intronic
1001136376 5:169106034-169106056 CATGCTGGAGCCTGTTGGGGGGG + Intronic
1001769183 5:174279948-174279970 GAGGCAGCAGCTTCCTGGGCAGG + Intergenic
1002922841 6:1585437-1585459 AAGCCAGGAGCTTCTGGGGGAGG - Intergenic
1005189940 6:23209904-23209926 GAGGCAGAAGCCTCTTTAGGTGG - Intergenic
1005987749 6:30884742-30884764 GAGGCCTGGGGCTCTTGGGGTGG + Intronic
1006215045 6:32434324-32434346 GACACAGGGGCCTGTTGGGGGGG + Intergenic
1006415926 6:33903920-33903942 GAGGCAGGAGCCATTTGTGGGGG + Intergenic
1006510441 6:34518433-34518455 GAGACAGGAGCTTGTTGGGAAGG - Intronic
1007237435 6:40401001-40401023 GATGTGGGAGCCTCTGGGGGAGG - Intronic
1010189862 6:73184044-73184066 GAGGGAAGAGCCTGTTGGGATGG - Intronic
1010525823 6:76899212-76899234 GAGGCAGAAGCCTCTTGCTATGG + Intergenic
1011261272 6:85472240-85472262 GAAGCAGGAGCCTCTTCAAGGGG - Intronic
1011442984 6:87407725-87407747 GAGGGAGGAGCCAGTTGGAGAGG - Intergenic
1011571115 6:88736988-88737010 GAGGCAGGAGTCTATGGAGGTGG + Intronic
1015089258 6:129334839-129334861 GAGGCTGGAGCCTCATGAGTGGG - Intronic
1017756293 6:157532067-157532089 GGGGAAGGAGCCGCTGGGGGAGG + Intronic
1018937482 6:168283301-168283323 GAGGGTGGAGCCTCATGGGCAGG - Intergenic
1020188204 7:5974588-5974610 AAAGCAGGAGCCTCCTGGGCAGG + Intronic
1020294713 7:6750180-6750202 AAAGCAGGAGCCTCCTGGGCAGG - Intergenic
1020361339 7:7329844-7329866 GTGGCAGGAGGCTTTTGGGTTGG - Intergenic
1020706122 7:11546108-11546130 CAGGCAGGAGCATGCTGGGGAGG - Intronic
1021106750 7:16646389-16646411 GAAGCATGTGCCTCCTGGGGCGG + Intronic
1021599018 7:22345208-22345230 GAGTCAGGAGCCCCTTAGGCTGG - Intronic
1021876366 7:25053334-25053356 GAGGCAGGAGGCTGTTAGGGAGG + Intergenic
1024373942 7:48617469-48617491 GAGGCAGGAGGCTGGTGAGGAGG + Intronic
1024946301 7:54810825-54810847 GAGCCAGGGGCCTCTAGGAGGGG - Intergenic
1024992035 7:55242450-55242472 GGGGCAGGAGGAACTTGGGGAGG - Intronic
1026797654 7:73376763-73376785 GAGGTAGGAGCCACGTGAGGAGG + Intergenic
1026986738 7:74559590-74559612 GAGGCAGGGGTGTCATGGGGAGG - Intronic
1029665660 7:101993459-101993481 TATGCAGGATCCTCTGGGGGTGG + Intronic
1030686045 7:112488062-112488084 GAGGGAGGAGTCTTTGGGGGAGG - Intronic
1031468719 7:122144406-122144428 GAGACAGAAGGATCTTGGGGAGG - Intergenic
1032466311 7:132147803-132147825 AAGGCAGGAGACTCTTGGAGAGG - Intronic
1033995483 7:147340949-147340971 GAGGGAGGAGCATCTAGCGGTGG - Intronic
1034343961 7:150374473-150374495 GATGAAGGAGCCTCTGGGAGGGG + Intronic
1035021550 7:155803777-155803799 GAGGGAGGCGCGTCTCGGGGAGG + Intronic
1035176603 7:157056352-157056374 AATGTAGGGGCCTCTTGGGGAGG + Intergenic
1035393147 7:158518599-158518621 GAGGAAGGACCCACTTGAGGAGG + Intronic
1035741109 8:1929521-1929543 GAGGCAGGAGGCCGGTGGGGAGG - Intronic
1035781716 8:2233142-2233164 GAGGCAGGTGCCGCTGGGGCAGG + Intergenic
1035810379 8:2486222-2486244 GAGGCAGGTGCCGCTGGGGCAGG - Intergenic
1035880129 8:3237368-3237390 GAGGCAGGAGACTCAGGAGGTGG + Intronic
1036202455 8:6780625-6780647 TAGGGAGGAGCCCGTTGGGGAGG + Intergenic
1037761519 8:21744924-21744946 GAGGATGGAGCCTCTGGGAGTGG - Intronic
1039455473 8:37703122-37703144 GAGGCAGGAGGCTCTCTGGCAGG - Intergenic
1040325727 8:46340602-46340624 GTGGGAGAAGCCTCTTTGGGAGG - Intergenic
1040338053 8:46426203-46426225 GTGGGAGAAGCCTCTTTGGGAGG - Intergenic
1041772822 8:61490569-61490591 GAGGCAGGAGAATCCAGGGGCGG + Intronic
1043526651 8:81104907-81104929 GAGGCTGGAGCCACTTTTGGAGG - Intronic
1043533121 8:81172002-81172024 CAGGCATGAGCCTTTGGGGGTGG + Intergenic
1047228184 8:122974044-122974066 GAGGCGGGAGCCTCTTCTGCTGG - Exonic
1047416282 8:124667157-124667179 AAGGCATGACCCTCATGGGGAGG + Intronic
1047617073 8:126571465-126571487 CAGGAAGGAGCTTCTTGGTGAGG + Intergenic
1047782718 8:128123151-128123173 GGGGCAGAAGCCTCTGTGGGAGG - Intergenic
1048439244 8:134447804-134447826 GAGCCAGGTGCCTCTTCAGGAGG - Intergenic
1048975857 8:139672745-139672767 GAGACAGGAGCCGCATGGGAAGG + Intronic
1049198517 8:141328512-141328534 GAGGCAGGGGCTGCTGGGGGTGG + Intergenic
1049220191 8:141425517-141425539 CAGGCAGCAGGCTCCTGGGGAGG + Intronic
1049283695 8:141763258-141763280 CAGGCAGGAGCCAGGTGGGGAGG + Intergenic
1049775472 8:144401895-144401917 GAGGTAGGGGCTTCCTGGGGAGG - Intronic
1051695160 9:19760526-19760548 CACACAGGAGCCTGTTGGGGGGG - Intronic
1051879688 9:21827167-21827189 AAGACAGGAGCCTCCTGGGCTGG + Intronic
1054977995 9:71171031-71171053 GAGACAGGAGCACCTGGGGGGGG - Intronic
1057139672 9:92718868-92718890 GAGCCAGCAGCCCCTTGGGTAGG + Exonic
1057212297 9:93206736-93206758 GAGGCTGTGCCCTCTTGGGGAGG + Intronic
1060913143 9:127366799-127366821 GAGGCAGGAGCCGCTGAGTGAGG - Intronic
1061052973 9:128206908-128206930 AAGGCAGGAGACTGGTGGGGAGG + Intronic
1061283116 9:129608714-129608736 CAGGCAGGAGCCTGGTGGGAGGG - Intergenic
1061869831 9:133514821-133514843 GAGGGAGGAGCCTCGGGGAGGGG - Intronic
1061917059 9:133760778-133760800 GAGGGAGGAGCCTCTGAGGACGG + Intergenic
1062490051 9:136800544-136800566 GGGGCGGGAGCGTCCTGGGGCGG + Exonic
1062578216 9:137218303-137218325 GATGCAGGGGCCTCTCGGCGGGG - Intergenic
1062733286 9:138120938-138120960 GAGGCAGGAGCCTGTGGGACAGG - Intronic
1188537661 X:31215335-31215357 GACTCAGATGCCTCTTGGGGTGG + Intronic
1189297185 X:39927133-39927155 GAGGAAGCAGCCTGTAGGGGTGG - Intergenic
1190946222 X:55096485-55096507 GAGGTAGGATCATCTGGGGGAGG - Intronic
1193724805 X:85026022-85026044 GAGGCAGGAGCCTACTGCAGAGG - Intronic
1194833207 X:98650723-98650745 AAGGCAGAAACTTCTTGGGGTGG - Intergenic
1200060965 X:153483581-153483603 GAGGCAGGGGGCTCCAGGGGAGG + Intronic
1202371951 Y:24204973-24204995 GTGGCAGGAGCTTCTTGAGATGG - Intergenic
1202498834 Y:25465143-25465165 GTGGCAGGAGCTTCTTGAGATGG + Intergenic