ID: 1095963018

View in Genome Browser
Species Human (GRCh38)
Location 12:47847193-47847215
Sequence GAGAAGGACTGGAGGACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095963018_1095963022 8 Left 1095963018 12:47847193-47847215 CCTACTGTCCTCCAGTCCTTCTC 0: 1
1: 0
2: 1
3: 41
4: 404
Right 1095963022 12:47847224-47847246 ATTCAGCCAACTCTGTCTCTAGG 0: 1
1: 0
2: 0
3: 11
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095963018 Original CRISPR GAGAAGGACTGGAGGACAGT AGG (reversed) Intronic
900122186 1:1053534-1053556 GAGACGGGCGGGAGGACAGATGG - Intronic
900643763 1:3699478-3699500 GAGAAGGCCAGGAGGCCAGAGGG + Intronic
901300772 1:8198688-8198710 GAGAAGGGGAGGAGGAAAGTGGG - Intergenic
902824462 1:18963457-18963479 GAGAAGGACAGGAGCACCATCGG + Intergenic
903095221 1:20965714-20965736 GAGAATGACTGGAAGAACGTGGG - Intronic
903468840 1:23570794-23570816 GAGAAAGACTGGAGGGAAGGGGG + Intergenic
904615386 1:31746717-31746739 GAGAAGGGCTGCAGGGAAGTTGG - Intronic
904853803 1:33479684-33479706 GACCAGGACTGCAGGACAGTCGG + Exonic
904893975 1:33800293-33800315 GAGGAGGAGGGGAGGCCAGTAGG + Intronic
905245113 1:36607421-36607443 GAGAAGGCCTGCAAGAAAGTGGG - Intergenic
905266302 1:36756445-36756467 GAGGAGGACAGGAGGAAAGAGGG + Intergenic
905270486 1:36784234-36784256 GAAAGGGGCTGGAGGAGAGTAGG + Intergenic
905446356 1:38030598-38030620 GAGGGGGACTGGAGGAAAGCTGG - Intergenic
905561613 1:38931731-38931753 GAGAGGGACTGGAGAACAGGAGG - Intronic
905608153 1:39323000-39323022 GAGGAGGAGGTGAGGACAGTTGG + Exonic
907316662 1:53576884-53576906 GAGAAGGGCTGGAGGAGAAAAGG - Intronic
907887986 1:58611535-58611557 GAGAAAGACTGGAGGACAAAGGG + Intergenic
907962298 1:59295135-59295157 GTGGAGGTCTGGAGGGCAGTGGG + Intergenic
908695510 1:66836334-66836356 GGGAAGGAAGGGAGGAAAGTAGG + Intronic
909121675 1:71611434-71611456 GAGTTGGACTGGAGTACAGATGG - Intronic
909156404 1:72083308-72083330 GAGAAGGAAGGGAGGAGAGAGGG - Intronic
909347284 1:74605637-74605659 GAGAGAGACTGGAGAACAGCTGG + Intronic
912228793 1:107768028-107768050 GTGGAGGAATGGAGGAAAGTAGG + Intronic
912263304 1:108130554-108130576 GAGAAGGAAGTGAGGACAGTGGG + Intergenic
912557149 1:110524585-110524607 GTGAAGGACTGAAGGAAGGTGGG + Intergenic
914348282 1:146818291-146818313 GAAAAGAACTGGGGGGCAGTGGG - Intergenic
914763948 1:150621808-150621830 GAAAAGGAATGGAAGACAGAGGG + Intronic
915105564 1:153533354-153533376 GAGAGGGACTGGAAGAAAGGGGG + Intergenic
915253090 1:154604430-154604452 GAGAAGAAAAGGGGGACAGTGGG - Intronic
916681979 1:167113240-167113262 GAGAAGGAATGGAGAACAAAGGG + Intronic
919301974 1:195781727-195781749 GACAAGGACTGGAGCACAGCTGG + Intergenic
919885660 1:201932380-201932402 GAGAGGGTCAGGAGGACAGGAGG + Intronic
920868781 1:209775659-209775681 AAGGAGGACTGGAGGACCCTTGG + Exonic
921099150 1:211913105-211913127 GAGAAGGACTTAAGGACAACTGG - Intergenic
921320278 1:213931902-213931924 GAGAGGGACTGGGGGAAACTGGG - Intergenic
923143326 1:231179926-231179948 GAGAAGGGATGGAGGAGAGATGG + Intronic
923484915 1:234419972-234419994 AAGAAGGTAGGGAGGACAGTAGG + Intronic
923559125 1:235025154-235025176 GAGAAGGGCAGGAGGCCTGTGGG + Intergenic
923706537 1:236348809-236348831 GAGAAGGACTGGAGAAAAGGTGG - Intronic
1063499865 10:6543759-6543781 GACAAGGACTGGAGGAAACTGGG + Intronic
1064026061 10:11849743-11849765 GAGAAGGCAAGGAGGACAGCAGG + Intronic
1064877739 10:20014310-20014332 GAGAAGGAAGGAAGGAAAGTGGG - Intronic
1065482984 10:26213352-26213374 AAGAAGGCCTGGAGGGCACTTGG - Intergenic
1065856891 10:29838513-29838535 GAGAAGGACTGTGGGTCACTGGG + Intergenic
1066276123 10:33870549-33870571 AGGAAGAACTGGAGGACAGTTGG + Intergenic
1067210584 10:44257691-44257713 GAGAGGGACTGGAGTAGAGCTGG + Intergenic
1068780782 10:60917251-60917273 GACAAGGAATGGAGGAGAGTTGG - Intronic
1068780857 10:60917796-60917818 GACAAGGAATGGAGGAGGGTTGG - Intronic
1069066090 10:63943177-63943199 GAGAAGGAGTGAAGGATATTTGG + Intergenic
1069644645 10:69984841-69984863 GAGAAGCACTTGAGCACAGGAGG + Intergenic
1070393444 10:75990817-75990839 GATCAGGGCTGGAGGACTGTGGG + Intronic
1070793761 10:79205038-79205060 CAGATGGACTGGTGGACAGATGG + Intronic
1071233108 10:83612015-83612037 AAGGAGCACTGGAGGACAATTGG - Intergenic
1071520194 10:86326629-86326651 GAGAAGCAATGGAGTACTGTTGG + Intronic
1071888764 10:89979709-89979731 GAAAAGCACTGGAGAACATTAGG + Intergenic
1071907165 10:90187096-90187118 GAGAATGAGGGGAAGACAGTGGG + Intergenic
1072442417 10:95468750-95468772 GAGAAGGACTGAAGGAAATAAGG + Intronic
1074953768 10:118367345-118367367 GAGAAGGACAGAAGGAGAGAAGG + Intergenic
1075744241 10:124715505-124715527 GAGAAGGACAGGGTGGCAGTGGG - Intronic
1075930561 10:126291792-126291814 GAGAAGGACTGGGGGTCATCTGG + Intronic
1076040852 10:127247330-127247352 AAGAAGGACAGGAGGAATGTGGG - Intronic
1076157896 10:128217323-128217345 TAGGAAGACGGGAGGACAGTTGG + Intergenic
1076183259 10:128427184-128427206 GAGAAGGACTGGAATGCAGGAGG - Intergenic
1077108444 11:851784-851806 CAGAATGACTGAAGGGCAGTGGG + Intronic
1078498189 11:11841690-11841712 GAGAAGGCAGGGAGGACAGTGGG + Intronic
1078744620 11:14099869-14099891 GAGAAGGAGTGAGGGACAGAGGG + Intronic
1080600718 11:33818884-33818906 AAGTAGGCCTGGAGGACGGTGGG - Intergenic
1081517092 11:43843631-43843653 GAGAAGAACTGGAGAGGAGTTGG - Intronic
1081525516 11:43925056-43925078 GAGAGGGAAAGGAGGACAGCTGG + Intergenic
1082008290 11:47433371-47433393 GAGGAGGAGTGGAGGCCAGGAGG - Intergenic
1082285117 11:50309805-50309827 GAGAATCACTGGAGCACAGGGGG - Intergenic
1083675636 11:64323278-64323300 GAGGATGCCTGGAGGTCAGTGGG + Intergenic
1083894912 11:65615038-65615060 GGGGAAGACTGGAGGACAGACGG + Intronic
1084322207 11:68379768-68379790 GAGGAGGAGAGGAGGACAGCAGG - Intronic
1084376836 11:68783452-68783474 GAGCAGACCAGGAGGACAGTGGG - Intronic
1085307923 11:75498703-75498725 GAGAAGCAGTGGAGCACAGTGGG + Intronic
1086144532 11:83537224-83537246 GAGAGGGAGAGGAAGACAGTTGG - Intronic
1088160681 11:106866259-106866281 AAGAAGGAAGGGAGGACAGGAGG + Intronic
1089014710 11:115156581-115156603 GAGAAGGAGGGGAAGACAGAAGG - Intergenic
1089730143 11:120514073-120514095 GAGATGGAAGGGAGGACAGGGGG + Intronic
1089936884 11:122373771-122373793 GAGAAGGACATGAAGACATTGGG - Intergenic
1090134325 11:124181209-124181231 GAGATGCATTGTAGGACAGTGGG - Intergenic
1090461933 11:126898924-126898946 AAGGAGGTTTGGAGGACAGTTGG - Intronic
1090875602 11:130786219-130786241 GAGAAGGTTTGAAGGGCAGTGGG - Intergenic
1091701106 12:2663575-2663597 GAGAAGGGCAGGAGGATGGTAGG + Intronic
1091712602 12:2752650-2752672 AAGAAGGGCTGCAGGAGAGTCGG + Intergenic
1092022927 12:5217082-5217104 GGGAAGAACTGGAGGGCAGTGGG - Intergenic
1092131988 12:6119209-6119231 GTGCGGGACTGGAGGAGAGTAGG - Intronic
1092254523 12:6919033-6919055 GAGATGGTCTGGATGACTGTTGG + Intronic
1092609201 12:10153940-10153962 GAGAGGGGCTGGAGGGCAGGAGG + Intergenic
1095576521 12:43746553-43746575 GAGAAGGAAAGGAGCAGAGTTGG - Intronic
1095963018 12:47847193-47847215 GAGAAGGACTGGAGGACAGTAGG - Intronic
1096564709 12:52469017-52469039 GAGAAGGGCCTGAGGACTGTGGG + Exonic
1097958741 12:65512279-65512301 GAGAGGGAGGGGAGGACAGAAGG - Intergenic
1098229171 12:68355119-68355141 GAGAAGCACTGCAGTACAGTAGG - Intergenic
1098912253 12:76221254-76221276 GGGATGGACTGGAGGGCAGGAGG + Intergenic
1099207234 12:79742721-79742743 GAGCAGGAGTGGAGGAGAATGGG - Intergenic
1100470478 12:94888400-94888422 GAGAAGGGGTGGAGGTAAGTGGG - Intergenic
1100524001 12:95403144-95403166 AAGAGGGACTAGAGGATAGTGGG - Intergenic
1101132633 12:101705151-101705173 GAGGATCACTTGAGGACAGTAGG - Intronic
1101132708 12:101705813-101705835 GAGGATCACTTGAGGACAGTAGG - Intronic
1102540995 12:113619193-113619215 GAGAAGGCTGGGAGGACACTAGG - Intergenic
1102809191 12:115809308-115809330 GAGAAGGACATGAGAACAGGAGG - Intergenic
1104559177 12:129828705-129828727 GAGAAGGAAGGGAGGAAAGGAGG + Intronic
1105285032 13:18996487-18996509 AAGAAGGACAGGAAGACAGGAGG + Intergenic
1105334219 13:19449863-19449885 GATAAGGAATGGAAGAAAGTAGG - Intronic
1105472729 13:20706669-20706691 GAGCAGGGCTGGAGGACACATGG + Intronic
1105990583 13:25616226-25616248 AAGAAGGACTGGAAGATTGTTGG - Intronic
1107237047 13:38184025-38184047 GGAAAGTACTGGAGGACATTAGG + Intergenic
1108732696 13:53251341-53251363 TGGAAGGACTGCAGGACAGCAGG + Intergenic
1109388268 13:61661841-61661863 TAAAAGTACTGGAGGACACTAGG + Intergenic
1109734591 13:66466189-66466211 GAGAAGGAGGGGAGGAGAGGAGG - Intronic
1110872773 13:80471820-80471842 AAGAAGGAATGGAGAGCAGTGGG - Intergenic
1111086367 13:83380527-83380549 GAGAAGGAAGGAAGGACAGAAGG - Intergenic
1111086384 13:83380581-83380603 GAGAAGGAAGGAAGGACAGAAGG - Intergenic
1112101211 13:96191378-96191400 TACAAGGACTGTAGCACAGTAGG - Intronic
1112264786 13:97913413-97913435 GAAATGGACTGGAGAACAGTGGG + Intergenic
1112446753 13:99471535-99471557 GAGAAGGAAGGAAGGAGAGTAGG + Intergenic
1113345377 13:109472556-109472578 GCGAGGGACCGGAAGACAGTGGG + Intergenic
1114963860 14:27931736-27931758 AAGAAAGACTGGAGGAAAGAAGG - Intergenic
1118753497 14:68822657-68822679 GAGAGGGACTGGAGCACGGCTGG - Intergenic
1118884955 14:69858935-69858957 GAGATGGACTGGAGAATAGCAGG + Intronic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1122206979 14:100152550-100152572 GAGAAGGATGGGAGGAGAGAGGG - Intronic
1124395894 15:29301030-29301052 GAGAAGGACTGAAATACAGGTGG + Intronic
1125383472 15:39112376-39112398 AATAAGTACTGGAGGACTGTAGG - Intergenic
1127334717 15:57972261-57972283 GAGAAGGTCTGGAGAAGAGGAGG - Intronic
1127365335 15:58284263-58284285 GAGAAGGACAGGAGGTCCTTGGG + Intronic
1130227033 15:82066811-82066833 GAGAAGGACTGAAGGACACAAGG + Intergenic
1130848870 15:87774080-87774102 GAGAAGTACTGAAGTAGAGTAGG + Intergenic
1131024778 15:89130982-89131004 GAGATGGAGTGAAGGACAGAAGG - Intronic
1131054640 15:89368276-89368298 GAGGAGGACTGGGGGAAAGCTGG - Intergenic
1131609678 15:93947817-93947839 GAGAAGGTTTGGAGGAAGGTGGG - Intergenic
1131890747 15:96969286-96969308 GAAAAGTACTGGAGTAGAGTGGG + Intergenic
1132669592 16:1097134-1097156 GAGGAGGAAAGGAGGACAGGAGG + Intergenic
1133580850 16:7143285-7143307 GAGGAGGGCTGGAAAACAGTTGG - Intronic
1133850665 16:9500373-9500395 GAGGAGCACTGGAGGCCAGTAGG - Intergenic
1133923106 16:10172312-10172334 GAGAAGGCCTTAAGGCCAGTGGG + Intronic
1133932748 16:10245386-10245408 GAGAAGGAGTTTAGGATAGTAGG + Intergenic
1134037562 16:11042402-11042424 GAGAGGGACAGGAGGACAGGAGG + Intronic
1135623286 16:23974444-23974466 GGGAAGGGCTGGAGAACAGGAGG + Intronic
1135715117 16:24757621-24757643 GAGAGGGGCTTGAGGACAGCAGG - Intronic
1137971893 16:52993923-52993945 AAAAAGGGCTGGGGGACAGTGGG - Intergenic
1138330003 16:56205868-56205890 GAGAGGGATTGGAGGACATGAGG + Intronic
1138743798 16:59339930-59339952 GAAAAGCCCTGGAGGACATTAGG + Intergenic
1139346472 16:66306977-66306999 GAAAAGGCATGGAGGGCAGTGGG - Intergenic
1139614429 16:68080336-68080358 GAGGCTGGCTGGAGGACAGTAGG + Intergenic
1139961040 16:70717348-70717370 GAGGAGGACTTGAGGACAGGAGG + Intronic
1139985755 16:70897254-70897276 GAAAAGAACTGGGGGGCAGTGGG + Intronic
1141043222 16:80690303-80690325 GAGAAGGACTGGAGCAGTGAGGG + Intronic
1141173924 16:81707103-81707125 AAGAAGGAGGGGAGGAGAGTGGG - Intronic
1141364071 16:83426131-83426153 GAGAAGGAATGGATGAAAGAGGG - Intronic
1141756241 16:85992969-85992991 AAGAAGGACAGAAGGACAGAAGG - Intergenic
1143165398 17:4894942-4894964 GAGAAAGACAGGAGGAGAGGAGG - Intronic
1143580620 17:7823695-7823717 GAGAGGGGATGGAGGACAATGGG - Intronic
1143662659 17:8336318-8336340 GAGAAGGAGGGGAGAACACTGGG - Intergenic
1144788437 17:17844491-17844513 TAGAAAGACAGGAGGACAGACGG + Intronic
1146001415 17:29132835-29132857 GGGAGGGACTGGTGGACAGAGGG + Intronic
1146159692 17:30553251-30553273 CCCAAGGACTTGAGGACAGTGGG - Intergenic
1146657746 17:34645028-34645050 GAGCAGGGCTGGAGCACAGAGGG + Intergenic
1146919578 17:36701549-36701571 GAGGAGGAAGGGAGGAGAGTAGG - Intergenic
1148119163 17:45197602-45197624 GAGATGGGGTGGAGGAGAGTAGG + Intergenic
1148713207 17:49696870-49696892 TATAAGGCCTGGAGGACAGCAGG - Intergenic
1148894646 17:50832775-50832797 GAGGAGGCCCGGTGGACAGTGGG + Intergenic
1150303179 17:64063167-64063189 GAGCAGGGCAGGAGGTCAGTCGG - Intronic
1153189366 18:2520765-2520787 TAGAAAGATTGGAAGACAGTTGG - Intergenic
1153811851 18:8759000-8759022 CAGAAGGACAAGAGGACAGCAGG + Intronic
1155814462 18:30287619-30287641 GAAAAGTATTGGAGGACAGTAGG - Intergenic
1155861254 18:30903141-30903163 GAAAAGTACTGGTGGACATTAGG - Intergenic
1156121433 18:33847169-33847191 GAGAGGGACTGAAGTACAGTTGG - Intergenic
1156683914 18:39621542-39621564 GAGAGGGAATGGAGGGCAGTTGG - Intergenic
1157476854 18:48029215-48029237 GAGAAGGACTGGAGGGCTGGTGG + Exonic
1157702316 18:49769731-49769753 GAGAAGGAGTGGAGAACTGGGGG - Intergenic
1159130399 18:64274906-64274928 GAAAAGTACTTGAGGACAATAGG + Intergenic
1159283111 18:66312291-66312313 AAGAAGGAATGGAGGAAAGAAGG + Intergenic
1159873252 18:73782533-73782555 GAGAAGAACCGAAGGACAATGGG - Intergenic
1159934598 18:74352944-74352966 GAGCATGTTTGGAGGACAGTGGG + Intronic
1160694692 19:477856-477878 GAGCAGGACGAGAGGACAGGGGG - Intergenic
1161431205 19:4233377-4233399 CCGCAGGACTGGAGGACAGGTGG - Intronic
1161446149 19:4320391-4320413 GAGGAGGACTTGAGGCCTGTGGG + Intronic
1161468630 19:4445598-4445620 GAGAAGGTCAGGAGGGCAGAGGG + Exonic
1161846850 19:6716589-6716611 GAGAAGGATGGGAGGAGAGAAGG - Intronic
1163061275 19:14763932-14763954 GAGGAGGACAGGAGGAGAGGAGG - Intronic
1164681747 19:30138907-30138929 GAGACCGATTGGAGCACAGTAGG - Intergenic
1165714741 19:38037065-38037087 GAGAAGGCCTGGCACACAGTAGG - Intronic
1166276248 19:41756323-41756345 GAGCAGGACCTGAGGCCAGTGGG + Intronic
1166420452 19:42632329-42632351 GAGCAGGACCTGAGGGCAGTGGG - Intronic
1166423334 19:42654897-42654919 GAGCAGGACCTGAGGGCAGTGGG + Intronic
1166596880 19:44058245-44058267 GGGATGGACTGCAGGACAGTTGG - Intronic
1167087984 19:47323777-47323799 GAGAAGGCCAGGAGGCCAGGAGG - Intergenic
1167435137 19:49474743-49474765 GAGATGGACGGGAGAACAGATGG + Intronic
1167861396 19:52286923-52286945 GAGAAGCACTTGAGCCCAGTAGG - Intronic
1167958804 19:53089891-53089913 GAGAAGGAATGGAGGGAAGAAGG - Intronic
1168402791 19:56095588-56095610 GAGAAGGTCCTGATGACAGTGGG - Intronic
924995799 2:359311-359333 GATAAGGAGTGCAGGGCAGTGGG - Intergenic
925032176 2:659448-659470 GAGAAAGGCTGGAAGACAGCAGG - Intergenic
925078512 2:1040391-1040413 GAGAAAGACAGGAGGAAAGAGGG - Intronic
925146822 2:1587732-1587754 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925146883 2:1587941-1587963 CAGAGGGACTGGGGGACAGAGGG - Intergenic
925789200 2:7466387-7466409 GAGGAGGAGTAGAGGAGAGTAGG - Intergenic
925943358 2:8839739-8839761 GAGGAAGACGGGAGGACAGAGGG - Intergenic
926108331 2:10166338-10166360 GAGCAGGGCTGGTGGACAGCAGG - Intronic
926433645 2:12816458-12816480 GAGAAGGTCTTGAGGAATGTGGG - Intergenic
927877193 2:26665752-26665774 GAGAAGGAATGAAGGAAGGTAGG - Intergenic
927943438 2:27120033-27120055 GAGGAGGACAGGATGAGAGTGGG - Intergenic
928785875 2:34885487-34885509 TAGAGGGAATGGAGGAAAGTGGG - Intergenic
928909903 2:36409135-36409157 AACAAGAACTGGAGGAAAGTAGG - Intronic
929787762 2:45004448-45004470 GAGAAGGACAGGAGTACAGATGG + Intergenic
929789694 2:45013764-45013786 GTGAAGGCCTGGAGGGCAGAGGG - Intergenic
929930464 2:46251652-46251674 GAGTAGGAAAGGAGGCCAGTTGG + Intergenic
930080519 2:47443487-47443509 GAGAAGGGCTGCAGCAAAGTGGG + Intronic
930303767 2:49651522-49651544 GAGAAGGAGTTGACAACAGTTGG + Intergenic
931243095 2:60469820-60469842 GAGACAGACTGGAGGATAGATGG + Intronic
931465651 2:62484405-62484427 GAGAAAGACAGCAAGACAGTAGG - Intergenic
931816564 2:65909085-65909107 CAGAAAGACTTGAGGACAGCAGG + Intergenic
932083504 2:68737129-68737151 CTGAAGGACTGGACTACAGTAGG + Intronic
932347470 2:71005045-71005067 GAGAAGCACAGGAGAACACTGGG + Intergenic
932485672 2:72082892-72082914 GAGGAGCCCTGGAGTACAGTAGG - Intergenic
932575994 2:72962782-72962804 GGGAAGGACTGGAAGACAGGTGG - Intronic
933299261 2:80524117-80524139 GAGAGGGACTGTGGCACAGTGGG + Intronic
934851102 2:97701774-97701796 GAGAAGATCAGGAGGTCAGTGGG - Intergenic
934971237 2:98766194-98766216 GATGAGGAAGGGAGGACAGTGGG + Intergenic
936233610 2:110725086-110725108 GAGAAGGAAGGAAGGACAGAGGG + Intergenic
938043447 2:128095498-128095520 GAGCAGGACAGGAGGAGAGTGGG - Intronic
939535143 2:143418316-143418338 GAGAAGAACTTGAGGACAACAGG - Intronic
940237568 2:151527343-151527365 GAGAAGGAGAGGAGGATGGTTGG - Intronic
940819860 2:158340936-158340958 GGGAAGCACTGAAGGTCAGTAGG + Intronic
941884600 2:170515117-170515139 AAGAAGGAGTGGTGGACAGAAGG - Intronic
942594153 2:177576358-177576380 AAGAAGGATTGGGGTACAGTTGG - Intergenic
943355720 2:186852761-186852783 GAAAAGTACTGGAGGACTTTAGG - Intergenic
946409915 2:219510754-219510776 AAGGAGTACTGGCGGACAGTGGG + Intergenic
946717819 2:222571798-222571820 GAGGAGGACTTAAGGACACTAGG + Exonic
946790957 2:223300032-223300054 GGGACAGACTGGAGGACAGAAGG - Intergenic
946891325 2:224280321-224280343 GAGATGGACTGGAGAGGAGTTGG - Intergenic
947910756 2:233799338-233799360 GAGAGGGAATGGAGGAGAATGGG + Intronic
948663841 2:239522567-239522589 GAGACGTAATGGAGGACATTAGG - Intergenic
1170073938 20:12398515-12398537 GAGAGGGAGAGGAGGATAGTAGG + Intergenic
1170739443 20:19042075-19042097 GAGGAGCACTGGAGGAAATTGGG + Intergenic
1172051886 20:32124090-32124112 GAGAATCACTTGAGGACAGATGG - Intronic
1173014958 20:39216436-39216458 GAACAGGAATGGATGACAGTAGG - Intergenic
1173441048 20:43076682-43076704 GATAAGGACCAGAGGACAGTGGG - Intronic
1173723949 20:45283915-45283937 GAGAGAGGGTGGAGGACAGTTGG - Intergenic
1175286550 20:57840590-57840612 GGGAAGGACTTGATGACAGAGGG + Intergenic
1176195681 20:63835551-63835573 GCGCAGGCCCGGAGGACAGTTGG - Intergenic
1178221064 21:30660774-30660796 ACTAAGGACTGGAGGAAAGTGGG + Intergenic
1178794324 21:35729937-35729959 GCTGAGGACTGGAGTACAGTAGG - Intronic
1179193788 21:39145666-39145688 GAGAAGGAAAGGAGGGCAGTAGG + Intergenic
1179288086 21:39995270-39995292 GAGAAGGACTGGAGTCCAAGTGG + Intergenic
1181970170 22:26683957-26683979 AAGAAGTACGGCAGGACAGTGGG + Intergenic
1181999741 22:26910721-26910743 GACAAGGACAGCAGGAAAGTGGG - Intergenic
1182434211 22:30319986-30320008 GAGGAGCACTGGGTGACAGTCGG + Intronic
1182780425 22:32863173-32863195 GAAAAGGACTGGAGCAGGGTGGG - Intronic
1183043750 22:35203295-35203317 CAGAAGGACTGCTGGGCAGTTGG - Intergenic
1183064038 22:35351541-35351563 GAGAAGGAATGAAGGACGGCGGG - Intergenic
1183174306 22:36211662-36211684 CAGATGAACTGGAGGACCGTTGG - Intergenic
1183398987 22:37589984-37590006 GGGAAGGGCTGGAGGACTCTAGG - Intergenic
1183525349 22:38319342-38319364 GGTAAGGACTGGAGGACACAGGG - Intronic
1184630604 22:45775174-45775196 GAGAAGGAGGGGATGGCAGTGGG + Intronic
949562348 3:5214358-5214380 GAAAAGCACTGAAGCACAGTCGG - Intronic
949702311 3:6773486-6773508 GAGAAGGACTGAAGATGAGTAGG + Intronic
949807305 3:7969876-7969898 GGGAAGGACTGGAGCAGCGTAGG - Intergenic
950213757 3:11143045-11143067 GCAAAGAGCTGGAGGACAGTGGG + Intronic
952210450 3:31224539-31224561 GAGAAGGCTGGGAGCACAGTTGG + Intergenic
953916399 3:46923515-46923537 GAGAAGGAATGGGGGGCAGAGGG + Intronic
954315889 3:49801613-49801635 GGGAAAGACTGGAGAAGAGTGGG - Intergenic
956361438 3:68452141-68452163 GAGAAGGCCTGAAGGACATGCGG + Intronic
956392293 3:68786179-68786201 GAAAAGTACTGGAGGACACCAGG + Intronic
959769450 3:110074892-110074914 GTGAAGGAATGCAGGGCAGTAGG + Intergenic
960848043 3:122022413-122022435 GAGAACTTCTGGAGGAAAGTGGG - Intergenic
960909718 3:122637212-122637234 GAGAAGGACAAGAGGACAGTGGG - Intronic
960966005 3:123105175-123105197 GAGAAGGTCTGGAGTTCAGTAGG - Intronic
960988223 3:123294224-123294246 CAGAAGGAATGGCGGACACTGGG + Intronic
962007704 3:131363915-131363937 GAGCAGGCATGGAGGACTGTGGG - Intergenic
962079086 3:132117822-132117844 GGGAGGGGCTGGTGGACAGTGGG + Intronic
962618846 3:137156395-137156417 GAGCAAGACTGGAAGACAGGGGG + Intergenic
962731203 3:138285156-138285178 GAGAATCACTGAAGGACACTAGG - Intronic
964026989 3:152086412-152086434 GAGAAGGAGAGGAGGAGAATGGG - Intergenic
964512473 3:157467793-157467815 GAAAAGGACTGAAGGCTAGTAGG - Intronic
965195812 3:165592576-165592598 GAGGAGGACAGGAGGACGGGAGG - Intergenic
965796817 3:172448617-172448639 GAGAGAGACTGGTGGTCAGTGGG + Intergenic
966896700 3:184450323-184450345 TAGCAGGAGTGGAGGACCGTGGG + Intronic
967000605 3:185330559-185330581 GAGAAGGAGTGGAGGGCTGGGGG + Intronic
967478499 3:189947703-189947725 GAGAAGGATTGGAGGAAAAAAGG - Intergenic
967850135 3:194076167-194076189 GAGAAGGAGTGGAGGAAAACAGG - Intergenic
968056966 3:195699139-195699161 GAGAAGGACTGGAAGAATCTTGG + Intergenic
968074609 3:195809626-195809648 GAGAAGGAGTGAAGGACTGTTGG - Intronic
969092661 4:4706843-4706865 GAGAAGGCTTGAGGGACAGTGGG + Intergenic
969297371 4:6277910-6277932 GAGAAGGACTGCAGAGGAGTGGG - Intronic
969610617 4:8225830-8225852 GAGGAGGCCTGGAAGCCAGTGGG + Intronic
969614430 4:8244149-8244171 GAGCAGGGCTGGAGACCAGTGGG - Intergenic
970396917 4:15677673-15677695 GGGAAGGTATGGAGGACAGAGGG - Intronic
970546285 4:17133601-17133623 GAGAAGCACAGGAGCACAGCTGG - Intergenic
970607251 4:17692225-17692247 CAGAAGGAAGGGAGGACAGCAGG + Intronic
972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG + Intronic
973793338 4:54398038-54398060 GAGACAGCCTGGAGAACAGTAGG + Intergenic
974259076 4:59501657-59501679 GAAAAGTACTGAAGGACATTAGG + Intergenic
975664959 4:76726419-76726441 GAGAAGGACTAGAGGACTGAGGG - Intronic
976901028 4:90176368-90176390 GAGAAGGCCTGGAGAAGAGGAGG + Intronic
977825649 4:101528585-101528607 GAAAAGTACTGGAGGATATTGGG + Intronic
978236119 4:106462955-106462977 GAGAAGGAGTGGAGGAGTGGGGG + Intergenic
980802085 4:137765214-137765236 AGGAAGGACTGGAGGGCAGGTGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985117286 4:186604851-186604873 GAGGAGGAGTGGGGGACAGGAGG + Intronic
985777547 5:1852626-1852648 TAGAAGGACGGGAGGGCAGCAGG - Intergenic
986092386 5:4523165-4523187 GAGCAAGACTGGAGGAAGGTGGG + Intergenic
986234217 5:5892663-5892685 GAGAAGGACTGCTGGGGAGTCGG + Intergenic
986626465 5:9727675-9727697 GACAAGGAGTGCAGGACAGCTGG + Intergenic
986859147 5:11905181-11905203 GAGATGCACTGGAAGACTGTGGG - Intergenic
986871306 5:12049860-12049882 GAGAAGGACTGGTGGGGGGTTGG + Intergenic
986982048 5:13459204-13459226 GAAAAGTACTAGAGGACATTAGG + Intergenic
988547840 5:32174482-32174504 GAGCAGGACTGCAGGACCGCGGG - Intergenic
990289875 5:54339234-54339256 GAGAATCACTGGAGCCCAGTGGG - Intergenic
990504029 5:56427189-56427211 TTGGAGGACTAGAGGACAGTTGG - Intergenic
991949500 5:71933766-71933788 TAGTAGTCCTGGAGGACAGTTGG + Intergenic
992219562 5:74558286-74558308 AAGAAGGAAAGGAGGAGAGTGGG + Intergenic
992776012 5:80089993-80090015 GAGAAGGAAGGGAGGCCTGTGGG - Intergenic
993956988 5:94246393-94246415 GAGAAGGAGTGGAGGAGACCTGG - Intronic
995840894 5:116442256-116442278 GAGAGGGACTGCAGGCCAGCTGG - Intergenic
995864405 5:116676091-116676113 GAGAAGACCTGGTGGAAAGTGGG + Intergenic
995966276 5:117911301-117911323 GAAAAGTACTGGAGGACACCGGG - Intergenic
998201779 5:140130571-140130593 GAGAAGGACTCAAGCACAGGAGG + Intergenic
998860763 5:146441418-146441440 GAGAAGGAAAGGAAGAGAGTGGG + Intergenic
1001710903 5:173777231-173777253 AAGCAGGAGTGGAGGACAGAGGG + Intergenic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1002337342 5:178489112-178489134 GAGATGGCATGGAGGTCAGTGGG + Intronic
1003194293 6:3901472-3901494 AGGGAGGACTTGAGGACAGTGGG + Intergenic
1003362318 6:5439826-5439848 GAGAAGGAAGGGAGGGCAGGAGG - Intronic
1003499087 6:6689568-6689590 AAGACAGACAGGAGGACAGTTGG - Intergenic
1004168886 6:13280376-13280398 GAGAGAGACTGGAGAACAGAGGG + Intronic
1004383150 6:15149563-15149585 GAGAAGGACAGAGGGACAGGAGG + Intergenic
1006151187 6:31991124-31991146 GAGAGGGACAGGAGGACAAGTGG - Intronic
1006157488 6:32023862-32023884 GAGAGGGACAGGAGGACAAGTGG - Intronic
1006452739 6:34114554-34114576 GAGAGGGGCTGGAGGAAATTGGG - Intronic
1006764994 6:36497282-36497304 GAGAAGGTCTGGACTACAGCAGG + Intronic
1006891434 6:37432801-37432823 ACGAAGGACGGGAGGACAGAAGG - Intergenic
1007185608 6:39969194-39969216 GAGAAGCTCTGGAGGCCAGAAGG + Intergenic
1007277860 6:40688922-40688944 GAGAAGGCTTGGAGGGAAGTAGG - Intergenic
1008624074 6:53300721-53300743 CAGACGGAGTGGAGGACAGAAGG - Intronic
1009682995 6:66923045-66923067 GAAAAGTACTGAAGGACATTTGG - Intergenic
1010085350 6:71910868-71910890 GAGAAGAACTTGGGGAGAGTTGG + Intronic
1010535532 6:77024875-77024897 GAGAAGTAATGGATGACAATAGG - Intergenic
1011811513 6:91137425-91137447 GCCAAGGGCTGGCGGACAGTAGG + Intergenic
1011977671 6:93325518-93325540 GGGAAGGAGTGGAGTATAGTTGG - Intronic
1012107867 6:95188515-95188537 GAGATAGACTGGAGGACATTTGG - Intergenic
1012204669 6:96445715-96445737 GAGGATGACTGGAGGCCAGGAGG - Intergenic
1012986186 6:105878555-105878577 GAAAAGGAATACAGGACAGTGGG + Intergenic
1013508760 6:110825845-110825867 GAGTAGGACTGGGAGGCAGTGGG + Intronic
1013927097 6:115486492-115486514 GAAAAGTACTGGAGGAAACTGGG + Intergenic
1014884635 6:126764784-126764806 GAGAAGGAGGGGAGAACAGATGG + Intergenic
1015160877 6:130151095-130151117 GACAGGCACTGGAGGAAAGTGGG - Intronic
1016236847 6:141878303-141878325 GAAAAGTGCTGGAGGACATTAGG + Intergenic
1018177082 6:161186506-161186528 GAGATGGAAGGGAGGACAGGCGG - Intronic
1018667945 6:166156532-166156554 GAGGAGGTCTGGGGGACATTTGG - Intergenic
1018850070 6:167580984-167581006 GAGATGGACAGGACGACAGAGGG + Intergenic
1018872105 6:167791108-167791130 GAGAAGGAGGGGAGGACAGGTGG + Intronic
1018884054 6:167917455-167917477 CAGAAGGACTAGAGGAGAGGAGG + Intronic
1019007495 6:168812532-168812554 AACAAGGACTGGAGAACAGGAGG - Intergenic
1019050420 6:169178967-169178989 GAGAGGTCCTGGAGCACAGTGGG + Intergenic
1019730651 7:2627621-2627643 GAGAAGGGAGGGAGGACAGAAGG + Intergenic
1020698562 7:11447810-11447832 GAGAGGGACTGGAAGATACTAGG + Intronic
1020832601 7:13110304-13110326 GAGAAGCACTGGAGGGAGGTTGG - Intergenic
1021610495 7:22453065-22453087 GAGAAAGACTGCAGGGGAGTTGG - Intronic
1022765862 7:33410609-33410631 AAGAAGGACAGCAGGAAAGTTGG - Intronic
1023609301 7:41957467-41957489 GAGAAGGACTGGAGGTGGTTGGG - Intergenic
1023815971 7:43950298-43950320 GACAAGGATGGGAGGGCAGTTGG + Intronic
1023849490 7:44142126-44142148 CAGAAGGCCTGGTGCACAGTGGG + Intergenic
1023918015 7:44605088-44605110 GAGAAGGACAGGAGGAGAAGGGG + Intergenic
1024258447 7:47556949-47556971 GGCAGGGACTGGAGGACAGAGGG - Intronic
1024599338 7:50965834-50965856 GAGAAGGACTGGATGCCGGGTGG - Intergenic
1025945085 7:66099191-66099213 TAGAAGGAGTGGAGGAGAGGAGG + Intronic
1026323093 7:69284448-69284470 GGGAAGGAATGGGGGACAGGAGG - Intergenic
1026978344 7:74512466-74512488 GGGAAGAACTGCAGGACAGGCGG - Intronic
1028746364 7:94331425-94331447 GAGAAGAACTGGAGCACGGAAGG + Intergenic
1029388613 7:100259820-100259842 GAGAACGACTGGGGGTCAGACGG + Intronic
1030147610 7:106372257-106372279 AAGACGGACTGAAGAACAGTGGG + Intergenic
1030496889 7:110311695-110311717 GTGAGGGAGAGGAGGACAGTAGG - Intergenic
1030497189 7:110314912-110314934 GAAAAGCACTGGAGGACATAGGG - Intergenic
1031548183 7:123076393-123076415 GAAAACTACTGGAGGACATTAGG - Intergenic
1035096337 7:156359150-156359172 GAGAATGACTGTAGGAGACTGGG + Intergenic
1035278784 7:157764539-157764561 GAGACAGAATGTAGGACAGTGGG + Intronic
1035767028 8:2114351-2114373 GAGAAAGACTGGAAGGCTGTTGG - Intronic
1036200590 8:6768097-6768119 GAGAGGGAGTTGAGCACAGTGGG + Intergenic
1036517310 8:9456318-9456340 GGGAGGCACTGGAGGACAGAAGG + Intergenic
1037660168 8:20919529-20919551 GAGTAAGACTGGGGGACTGTTGG - Intergenic
1037673352 8:21034310-21034332 GAGTGGGACTGGGAGACAGTAGG + Intergenic
1038144465 8:24882173-24882195 TAAAAGGACTGGAGGGCACTGGG - Intergenic
1038607078 8:29017658-29017680 GGGAAAGACTGCAGGACAATAGG + Intronic
1040488310 8:47895624-47895646 GGGAAGGGCTGGAGGGCAGTGGG - Intronic
1041148122 8:54900948-54900970 TAGAAGGAATGAAGGAAAGTAGG + Intergenic
1041943135 8:63410359-63410381 AAGAAAGAGTGGAGGACAGAAGG - Intergenic
1042207672 8:66345398-66345420 GAGAAAGACAGGATGACAGAAGG + Intergenic
1042871972 8:73407794-73407816 GTGAAGGCCTGCAGGAAAGTCGG - Intergenic
1043161929 8:76856226-76856248 GAGAAGGACTGGAGGAAGGCCGG - Exonic
1043338641 8:79208975-79208997 GAAAAGTACTGAAGGACATTAGG - Intergenic
1045026204 8:98089337-98089359 GAGAGGGACTGGAGGAATCTGGG + Exonic
1045161698 8:99554818-99554840 GAAAAGGAATGAATGACAGTGGG - Intronic
1045458043 8:102401353-102401375 GGCAGGGACTCGAGGACAGTTGG - Intronic
1045528946 8:102965907-102965929 GAGGAGACCTGGAGGACAGGTGG + Intronic
1045657096 8:104398667-104398689 GACAATGCCTGGAGGGCAGTTGG - Intronic
1046205696 8:110993295-110993317 GAAAAATACTGGAGGACATTAGG - Intergenic
1046319190 8:112548225-112548247 GAGAAGAAATGGAGGAAAGCCGG - Intronic
1047733989 8:127749976-127749998 GAGAAGGAAGGAAGGAAAGTAGG - Intergenic
1048037812 8:130693734-130693756 GGGAGGGACTGAAGGACAATGGG + Intergenic
1048085177 8:131169582-131169604 GAGAAAGACAGAAGGAAAGTTGG + Intergenic
1048350494 8:133612008-133612030 GGGAGGGACTGCAGTACAGTGGG - Intergenic
1048822592 8:138393718-138393740 GTGAAGGAGCAGAGGACAGTGGG - Intronic
1049190467 8:141284768-141284790 AAGAAGGACTGAAGGGCAGGAGG + Intronic
1049495189 8:142926916-142926938 GAGAGGGACTGGAGCACAGAAGG - Intergenic
1050976687 9:11947844-11947866 GAAAAGTACTGGAGGATGGTAGG - Intergenic
1051212742 9:14762244-14762266 GGGAAGGAAAGGAGGACAGTGGG + Intronic
1053203298 9:36166891-36166913 GAAAAGGACTGGAGAGTAGTGGG - Intergenic
1054895948 9:70311318-70311340 GAGAGTGACTGGAGAACAGATGG + Intronic
1055353841 9:75417433-75417455 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353914 9:75417971-75417993 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353921 9:75418013-75418035 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353928 9:75418055-75418077 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353935 9:75418097-75418119 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353960 9:75418223-75418245 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353967 9:75418265-75418287 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353974 9:75418307-75418329 CACTAGGACTGGAGGACTGTGGG + Intergenic
1055353981 9:75418349-75418371 CACTAGGACTGGAGGACTGTGGG + Intergenic
1056492880 9:87125295-87125317 GAGAAGGTCTAGAGGAGGGTTGG - Intergenic
1056900619 9:90596090-90596112 CAGAAGGAGTTGAGCACAGTTGG + Intergenic
1058056208 9:100451778-100451800 GAGAAAAACTGGAGCACAGCTGG - Intronic
1058253961 9:102737496-102737518 GAAAAGTACTGGAGGACTTTAGG - Intergenic
1058610423 9:106769962-106769984 GAGAGGGACTACAGGACAGCAGG + Intergenic
1059702374 9:116787595-116787617 GAAAAGTACTGGAGGACATTAGG - Intronic
1059884355 9:118728640-118728662 GAAAGGGACTGGTGGACAGTGGG + Intergenic
1060557516 9:124516341-124516363 GAGCAGGCCTACAGGACAGTTGG + Intergenic
1061403428 9:130381019-130381041 GGGCAGGACTGGGGGGCAGTTGG - Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1185726516 X:2426327-2426349 GAGAAGGAAGGGAGGACAAGTGG - Intronic
1185837630 X:3360180-3360202 GAGAAAGATTGGAAGACACTAGG - Intergenic
1186953326 X:14652716-14652738 GAGAGAGACTGGGGGACAGCTGG - Intronic
1187309275 X:18125565-18125587 GTGAAGGGTTGGAGGACATTGGG - Intergenic
1187500216 X:19833159-19833181 GGGAAGGAGAGGAGGACCGTGGG - Intronic
1188004847 X:25010207-25010229 GAGGAGGGCTGGGGGCCAGTGGG - Intronic
1188269967 X:28127245-28127267 GAACAGTACTGGAGGACAATAGG - Intergenic
1188365395 X:29309281-29309303 GAAAAGCACTGGAAGACACTAGG + Intronic
1189402548 X:40685199-40685221 GAGAAGTACAGGAGAAAAGTTGG - Intronic
1189899975 X:45696462-45696484 TAGAAGGTATGGAGGACAGAGGG - Intergenic
1190249342 X:48710154-48710176 TAGAAGGAGTGGAGCAAAGTGGG + Intergenic
1192126456 X:68504998-68505020 GAGAAGCATTGTAGTACAGTAGG - Intronic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1197986210 X:132268988-132269010 GAGAAGCAAGGGAGGAAAGTGGG - Intergenic
1198806857 X:140502217-140502239 GTCAGGGACTGGAGGAAAGTGGG + Intergenic
1201238196 Y:11931555-11931577 GAGAAAGATTGGAGGACACTAGG + Intergenic