ID: 1095965031

View in Genome Browser
Species Human (GRCh38)
Location 12:47861392-47861414
Sequence GGATTGGGCCTGTGTGAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095965031_1095965034 -6 Left 1095965031 12:47861392-47861414 CCAGTTTCACACAGGCCCAATCC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1095965034 12:47861409-47861431 CAATCCATGAGCCTTCTGCAAGG 0: 1
1: 0
2: 0
3: 10
4: 113
1095965031_1095965037 9 Left 1095965031 12:47861392-47861414 CCAGTTTCACACAGGCCCAATCC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1095965037 12:47861424-47861446 CTGCAAGGCAACATTGCTTGAGG 0: 1
1: 0
2: 1
3: 13
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095965031 Original CRISPR GGATTGGGCCTGTGTGAAAC TGG (reversed) Intronic
900647973 1:3717624-3717646 GGCTTGGCCCTGTGGAAAACGGG - Intronic
900813521 1:4826102-4826124 GGGTGGGGCCTGTGTGGACCTGG - Intergenic
902244143 1:15108350-15108372 GGCGTGGGCCTGTGTGCAATGGG + Intronic
902261196 1:15226199-15226221 GAAAAGGGCCTGTGTTAAACTGG - Intergenic
905345409 1:37307870-37307892 GGATGGGCCCCGTGTGACACGGG + Intergenic
907641057 1:56190824-56190846 GGAATTAGCCTGTGGGAAACAGG + Intergenic
910132135 1:83920669-83920691 GGATGTGGGCTGTGTTAAACTGG - Intronic
910216055 1:84845948-84845970 GGATTGTGGCTGTGTGGAATTGG - Intronic
911550484 1:99273269-99273291 GGTTTCTGCCTGTGTAAAACTGG + Intronic
911852153 1:102833694-102833716 GGATTGGGGCTGCGTCAAAGTGG + Intergenic
912053184 1:105558475-105558497 GGATTTGGCCTGTGGAAAAAAGG - Intergenic
914401023 1:147319984-147320006 GGATTGGGCCTGGGGGAAGTGGG - Intergenic
916288897 1:163141805-163141827 GGATTGGGACTGGGTAAAAGGGG - Intronic
917201369 1:172519524-172519546 CTTTTGGGCCTGTGAGAAACAGG + Intergenic
922532009 1:226351864-226351886 GGATCAGGTCTGTGGGAAACAGG + Intergenic
922803501 1:228374443-228374465 GGCTGGGGGCTGTGTGAAATCGG + Intronic
1062978615 10:1703331-1703353 GGATGGGGCCTGTGGGGACCTGG + Intronic
1067828402 10:49596048-49596070 GGATGGGGCCCGTGAGAAACGGG + Intergenic
1072722836 10:97791501-97791523 GGATTGGGTGTGGCTGAAACTGG - Intergenic
1073206602 10:101772761-101772783 GCACTGAGCCTGTGTGAAGCGGG - Intronic
1074001338 10:109376504-109376526 GGATTGTGACTGTGTTAGACAGG - Intergenic
1076829647 10:132987888-132987910 GGATGGGGCTTGTGTGCAGCGGG - Intergenic
1077404046 11:2374881-2374903 GGCTTGTGTCTGTGTGATACTGG - Intergenic
1077410603 11:2402230-2402252 GGAGTGTACATGTGTGAAACAGG - Intronic
1081549486 11:44098282-44098304 GGATTGGTTCTGTGTGTTACAGG + Intronic
1082852844 11:57780813-57780835 GAATTGGGACTGTGTAAATCTGG + Intronic
1083160438 11:60850964-60850986 GGATTGTGCCTGTATGCAACAGG - Exonic
1088846549 11:113673175-113673197 GGATTGGGCCTGTTTGATAAAGG - Intergenic
1093943665 12:25083409-25083431 GACTTGTGCCTGTGAGAAACAGG - Exonic
1095965031 12:47861392-47861414 GGATTGGGCCTGTGTGAAACTGG - Intronic
1097113629 12:56681170-56681192 GGATTGGGGCTGTCTGAAATAGG - Intronic
1098392552 12:69984897-69984919 GAAGTGGGCCTGGCTGAAACTGG + Intergenic
1099381984 12:81966058-81966080 TGAGTGGGTCTGTGTGTAACAGG + Intergenic
1100618610 12:96250369-96250391 GGAATCCGCCTGGGTGAAACCGG - Intronic
1102454320 12:113062517-113062539 GGATTTGGCCTGTGTGCTGCAGG + Intronic
1102985112 12:117271646-117271668 GCACTGGGCCTGTGTCACACAGG - Intronic
1103519058 12:121525654-121525676 GGGTTGGGGCCGTGGGAAACTGG - Intronic
1106132528 13:26952091-26952113 GGATGGGGCCTCTGGGTAACTGG - Intergenic
1107078044 13:36345301-36345323 TTATTGGACCTGTTTGAAACAGG - Intronic
1121187138 14:91983795-91983817 GTATTTGGCCTGTGTTCAACAGG + Intronic
1122361632 14:101170513-101170535 GGTTTGTTCCTGTGTGAAAATGG + Intergenic
1122595246 14:102885859-102885881 CGATAGGGGCTGTGTGAACCAGG + Intronic
1122969508 14:105146805-105146827 GGCTTGCGCCTGTGTGCCACTGG - Intronic
1124418519 15:29494659-29494681 GGGCTGGGCCTGTGGGAAATGGG - Intronic
1126439466 15:48672088-48672110 TGATAGGGTCTGTGTCAAACAGG + Intergenic
1126689315 15:51275559-51275581 GGCTTAGGCATGTGTGAAATGGG + Intronic
1127042098 15:54988468-54988490 GGGTTGGGCTTCTGTGACACTGG + Intergenic
1127123740 15:55792556-55792578 TGATTGGGCCTGTGTGAGCCTGG - Intergenic
1129604898 15:77020047-77020069 GGAGTGGGTCTGTGTGATGCAGG + Intronic
1130159590 15:81385421-81385443 GGTATGGGACTGTGTGAAGCCGG + Intergenic
1130159610 15:81385539-81385561 GGTGTGGGACTGTGTGAAGCCGG + Intergenic
1130159636 15:81385697-81385719 GGTGTGGGACTGTGTGAACCCGG + Intergenic
1132135175 15:99329598-99329620 GCATTGGGCATGTGTGGAAAAGG + Intronic
1133438265 16:5798894-5798916 GAATTGGGCCTGTCTGACGCAGG - Intergenic
1134903885 16:17962783-17962805 GAATTGATTCTGTGTGAAACAGG - Intergenic
1137637640 16:50000873-50000895 AGTTTGGGCATGTGTGAACCTGG - Intergenic
1145102538 17:20088869-20088891 GGATTGTGCTTGTGCAAAACAGG + Intronic
1147919522 17:43907344-43907366 GGAACGGGCCTGGGTGAAAGGGG + Intronic
1148638350 17:49166269-49166291 AGATTGTGGCTGGGTGAAACTGG - Intronic
1150478703 17:65492919-65492941 GAATTGCCCCTGTGTGGAACTGG - Intergenic
1164070372 19:21762768-21762790 GAATAGGGCCTGGGTAAAACAGG + Intronic
1167113553 19:47475688-47475710 GGAATGGGCCTCTGTGACAGGGG + Intronic
1167279772 19:48560081-48560103 GGGTTGAGCGTCTGTGAAACGGG + Intronic
925683572 2:6448419-6448441 GGAGGGGGCATGGGTGAAACAGG + Intergenic
930014228 2:46959463-46959485 GGACAGGGCCTGTGTGTCACAGG + Intronic
932111808 2:69008742-69008764 TGATTGGGCCTGTGTTGAATGGG + Intergenic
938733070 2:134161316-134161338 GGGTTGGGCCTGGGAGCAACGGG + Intronic
941314300 2:163973290-163973312 GGAAGGGGCCTGTGTGAATGTGG + Intergenic
943222561 2:185128868-185128890 GAATTGGGGCTCTGTGAAATAGG + Intergenic
943725484 2:191247129-191247151 GGTTTGTGCCTGTGGGACACTGG + Intronic
948879530 2:240849693-240849715 GCATTGAGGCTGTGTGAAAAAGG + Intergenic
949074028 2:242043957-242043979 GGAGTGGGCCCGTAGGAAACTGG + Intergenic
1170716951 20:18840104-18840126 GGAGTCTGCCTTTGTGAAACAGG - Intergenic
1171498074 20:25571357-25571379 GGAGTGGGCCTGTGTGAGCCTGG + Intronic
1172206652 20:33167303-33167325 GCATTGGGCCTGTGTCAACCCGG - Intronic
1172300836 20:33848965-33848987 GGATTTGCCCTGTGTGACATGGG + Intronic
1173027250 20:39319976-39319998 GGGTTGGGGCTGTGTGTTACCGG - Intergenic
1173495381 20:43514379-43514401 GGACTGGGCCTGTGGGAGCCTGG + Intronic
1173737467 20:45372385-45372407 GGGTTGGGCCTGAGTGAGACTGG - Intronic
1173884287 20:46443750-46443772 AGATAAGGCCTGTGTGAAACCGG + Intergenic
1176304735 21:5117509-5117531 GTGTTGGGCCTGTGTGATGCTGG - Intronic
1179777553 21:43676138-43676160 GCTTTGGGGCTGTGTGAGACAGG + Intronic
1179852319 21:44144521-44144543 GTGTTGGGCCTGTGTGATGCTGG + Intronic
1183674628 22:39292452-39292474 GGATTTGGCCTGTGTGACTTGGG - Intergenic
949380887 3:3444465-3444487 GGAATGGGCCTATGAGAAACTGG - Intergenic
952747434 3:36794508-36794530 GGAGTGGGACTGTATAAAACTGG - Intergenic
958864490 3:99485280-99485302 GGATTGGCCGTGTGTGGAATGGG + Intergenic
959978853 3:112492312-112492334 GGACAGGGCCTATGTGTAACAGG - Intronic
961122791 3:124387154-124387176 GGATTGGGTGTGTGGGAGACAGG + Intronic
970465257 4:16316057-16316079 TGATTGGGCCTGGGAGAAAGAGG + Intergenic
971181961 4:24337166-24337188 TGATTTGTCCTTTGTGAAACAGG + Intergenic
981585687 4:146299871-146299893 GGGTTGGGCCTTTGTGAAGCAGG + Intronic
985524390 5:394734-394756 CGATTGGGCCTGTGTGGGGCCGG + Intronic
985589318 5:756516-756538 GGATTTGCCCTGTGTCCAACAGG - Intronic
985604047 5:849236-849258 GGATTTGCCCTGTGTCCAACAGG - Intronic
988786270 5:34568199-34568221 GGATTGGGCATGTTTCAACCTGG - Intergenic
990309379 5:54523560-54523582 CGATTTGGGCTGTGTGAAGCAGG + Intronic
992767680 5:80016118-80016140 GGTTTGGGAATGTGTGACACAGG - Intronic
995348105 5:111143949-111143971 GGATTGGGCCTGATTCAAGCAGG + Intergenic
995537148 5:113148153-113148175 GAACTGAGCCTGTGGGAAACTGG - Intronic
995896793 5:117022481-117022503 GGATTGGGACTGGGTGAGAGAGG + Intergenic
996131476 5:119786820-119786842 GGACTGGGAGTGTGTGACACTGG + Intergenic
997761774 5:136455657-136455679 GAATTGGGCCTTTGTGATTCTGG - Intergenic
1000599132 5:163251124-163251146 GGGTGGGGCCTGTGACAAACTGG + Intergenic
1001296444 5:170502467-170502489 GCATTGAGCCTGTGTGAATGTGG + Intronic
1001438241 5:171717931-171717953 GGATTGGGACTGTGGGACCCTGG - Intergenic
1001702013 5:173713524-173713546 GGATAGGGACTGTGGCAAACTGG + Intergenic
1004790604 6:19022072-19022094 GCAGTGGGCCACTGTGAAACAGG - Intergenic
1010985475 6:82418946-82418968 GGATTGGGCCTGTTTTAATAAGG + Intergenic
1012678720 6:102152122-102152144 GGGTTTTGCCTGTGAGAAACAGG - Intergenic
1015317475 6:131832640-131832662 TGACTGGACCTGTGTGAATCAGG + Intronic
1023284378 7:38604097-38604119 TGATTGTGCCTGTCTGAAATGGG + Intronic
1025172420 7:56771651-56771673 TGATTGGGTCTGTGTGCTACTGG + Intergenic
1028543735 7:91974932-91974954 GGCTTGGGCCTGGGTGACAGAGG - Intronic
1030229886 7:107196730-107196752 GGATTGAGCCTGGGAGATACAGG - Intronic
1033134423 7:138773146-138773168 GAGTTGGTCCTGTGTGAAACTGG - Intronic
1045294568 8:100862118-100862140 GGATTTGACCTGTGTGAGGCTGG + Intergenic
1045325500 8:101114726-101114748 GGATTGGGCCTGTGTGTATGAGG + Intergenic
1048551278 8:135435920-135435942 GCATTTGGCCTGAGTGGAACAGG + Intergenic
1050869712 9:10551531-10551553 GAATTGTGCCTTTGTAAAACAGG + Intronic
1053291800 9:36884999-36885021 GGACTGTGCCTGCGTAAAACTGG - Intronic
1057040950 9:91847064-91847086 GGATTGGGCCGGGGGGAAATGGG + Intronic
1058773816 9:108264693-108264715 GGTTTTGGCCTGTGTCAAAGTGG + Intergenic
1061056287 9:128224594-128224616 GGATTGGACATGGGTGAGACGGG + Intronic
1061814032 9:133182478-133182500 GGACAGGTTCTGTGTGAAACTGG + Intergenic
1062611798 9:137378823-137378845 GGCTAGGGCCTGTGTGACAAGGG + Intronic
1062732588 9:138118305-138118327 GGATGGGGGGTGTGTGAGACTGG + Intronic
1062732640 9:138118479-138118501 GGATGGGGGGTGTGTGAGACTGG + Intronic
1187350651 X:18513302-18513324 GGATGGGCCCAGTGTGAAAGTGG + Intronic
1193892554 X:87068387-87068409 GCATAGGGCCTATGTGCAACAGG + Intergenic
1194634998 X:96335017-96335039 GCTTTGGTGCTGTGTGAAACTGG - Intergenic
1194809012 X:98367398-98367420 GGCTTGGGCCTGTGAGAAGTAGG + Intergenic
1199665933 X:150096443-150096465 TGATTGGCACTGTCTGAAACTGG - Intergenic