ID: 1095968648

View in Genome Browser
Species Human (GRCh38)
Location 12:47885993-47886015
Sequence CCTAATCGACCCCAGGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095968640_1095968648 10 Left 1095968640 12:47885960-47885982 CCAATGAGCAGGAAGGGCACAAA 0: 1
1: 0
2: 2
3: 10
4: 197
Right 1095968648 12:47885993-47886015 CCTAATCGACCCCAGGAGAGGGG 0: 1
1: 0
2: 0
3: 4
4: 81
1095968637_1095968648 19 Left 1095968637 12:47885951-47885973 CCTCAGATGCCAATGAGCAGGAA 0: 1
1: 0
2: 1
3: 21
4: 210
Right 1095968648 12:47885993-47886015 CCTAATCGACCCCAGGAGAGGGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095968648 Original CRISPR CCTAATCGACCCCAGGAGAG GGG Intronic
901665938 1:10826149-10826171 TCTGGTGGACCCCAGGAGAGGGG - Intergenic
902699610 1:18162857-18162879 CATCATTGTCCCCAGGAGAGCGG - Intronic
904941199 1:34165826-34165848 CCTACCCCATCCCAGGAGAGGGG + Intronic
916590818 1:166188489-166188511 CCTAAAAGAACCCAAGAGAGAGG - Intergenic
917587678 1:176444376-176444398 CCTAAGCAACCCTAGGAGAAGGG - Intergenic
917752009 1:178062131-178062153 CCAAAGCAACCCCAGAAGAGAGG - Intergenic
918382412 1:183969362-183969384 CCTAATTGACCTCAGGAAGGAGG - Exonic
922744484 1:228036577-228036599 CCTTTTGGACCCCAGAAGAGAGG - Intronic
1063004268 10:1953047-1953069 CCTGAGTGACCTCAGGAGAGGGG + Intergenic
1064448036 10:15413972-15413994 CATATTCGACCACAGGAGTGAGG - Intergenic
1067676360 10:48381973-48381995 CATAATGGAGCCCAGGACAGAGG + Intronic
1069634845 10:69918843-69918865 CCTATTCTTCCCCAGGTGAGGGG - Intronic
1073304519 10:102492483-102492505 CACACTCCACCCCAGGAGAGTGG - Intronic
1075547434 10:123365639-123365661 CATAGTAGTCCCCAGGAGAGCGG + Intergenic
1077386314 11:2271074-2271096 CCTCCTCGGCCCCAGGAGGGTGG - Intergenic
1079227024 11:18615413-18615435 CCAAATCCATGCCAGGAGAGAGG - Exonic
1080432780 11:32214117-32214139 CCTGAGAGAGCCCAGGAGAGGGG + Intergenic
1082014159 11:47471816-47471838 CCCAAACCACCCCAAGAGAGAGG - Intronic
1088195558 11:107269998-107270020 CAGAATGGACCTCAGGAGAGGGG - Intergenic
1092949817 12:13491113-13491135 GCTAAGGGACCCCAGAAGAGTGG - Intergenic
1094101712 12:26771416-26771438 CCTAATAGTCCCTAGGTGAGTGG - Intronic
1095968648 12:47885993-47886015 CCTAATCGACCCCAGGAGAGGGG + Intronic
1096993080 12:55820863-55820885 CCTACTGGACCAAAGGAGAGGGG - Exonic
1102655615 12:114480284-114480306 TCAAATCGAAACCAGGAGAGAGG + Intergenic
1102781166 12:115566126-115566148 ACAAATCGACCCCTGTAGAGGGG + Intergenic
1108693246 13:52879108-52879130 CATAATTGAGCCCAAGAGAGGGG + Intergenic
1111786876 13:92799124-92799146 CCTCATTTACCACAGGAGAGGGG - Intronic
1111935064 13:94549496-94549518 CCTAACCACCCCCAGGAGCGAGG - Intergenic
1112976120 13:105320250-105320272 ACAAATCGACCCCAGGAAATTGG - Intergenic
1113530122 13:111018325-111018347 CCTAATCTGTCCCAGCAGAGAGG - Intergenic
1114345148 14:21786986-21787008 CCTAAACAAATCCAGGAGAGTGG + Intergenic
1115572609 14:34681050-34681072 CCAAGTCCAGCCCAGGAGAGGGG - Intergenic
1117215507 14:53547555-53547577 CCTCATCTACCCCAGGCAAGGGG - Intergenic
1117738091 14:58787923-58787945 CCAAAGAGACCCCAGCAGAGAGG - Intergenic
1118708216 14:68499420-68499442 CCTCACCCACCCCAGGTGAGAGG + Intronic
1119415605 14:74467429-74467451 CCTTTTCAGCCCCAGGAGAGGGG + Intergenic
1121089544 14:91171560-91171582 CATAATAGCACCCAGGAGAGGGG - Intronic
1125548684 15:40528155-40528177 CCGAATCTTCCCCATGAGAGCGG - Intergenic
1133465119 16:6020547-6020569 CCACCTCGACCCCAGGGGAGGGG + Intronic
1134022272 16:10929498-10929520 CCTGTTTGAACCCAGGAGAGTGG - Exonic
1137759750 16:50930830-50930852 CCCAAGAGTCCCCAGGAGAGAGG - Intergenic
1138059523 16:53875289-53875311 CCTAATCTAATCCAGAAGAGTGG + Intronic
1142259779 16:89037285-89037307 CCTCAGCCACCCCAGGACAGTGG - Intergenic
1142495080 17:301915-301937 CCTCATGGCCCCCAGGAGATGGG - Intronic
1146616485 17:34360876-34360898 CCAAATTGAAACCAGGAGAGGGG - Intronic
1147322357 17:39653834-39653856 GCTAACCAACCCCAGGGGAGAGG - Intronic
1153585467 18:6615893-6615915 CCAAAACAACCCCATGAGAGAGG - Intergenic
1161887436 19:7007680-7007702 CCAAATCCACCCAAGGGGAGGGG + Intergenic
1161887773 19:7010224-7010246 CCAAATCCACCCAAGGGGAGGGG - Intergenic
928374728 2:30765121-30765143 CCTAATGTTCCCCAGGAGAGAGG + Intronic
931510150 2:62982542-62982564 CCTACTAGACCCTAGAAGAGTGG - Intronic
932372831 2:71207189-71207211 CCCAATCTAGTCCAGGAGAGAGG + Intronic
1169374867 20:5058333-5058355 CCTAGTCCAGCCCTGGAGAGAGG - Intergenic
1172793483 20:37521710-37521732 CGGACTCGACCCCAGGAGGGAGG + Intronic
1174853603 20:54021355-54021377 CTTAATAGACTCCAGGACAGTGG - Intronic
1185083185 22:48721006-48721028 CCTTAGCGCCCTCAGGAGAGGGG - Intronic
953568615 3:44053968-44053990 CCAGCTCGCCCCCAGGAGAGGGG + Intergenic
956467800 3:69536253-69536275 CCTGATGGTCCCCAGGAGAGCGG - Intronic
961272572 3:125700074-125700096 CCTAATATACCCAGGGAGAGAGG - Intergenic
962613686 3:137103419-137103441 CAAAATGGACACCAGGAGAGTGG - Intergenic
963313979 3:143739060-143739082 ACCACTCAACCCCAGGAGAGGGG - Intronic
969703854 4:8781656-8781678 CCAACTGAACCCCAGGAGAGGGG + Intergenic
976358652 4:84151037-84151059 CATATACGACCCAAGGAGAGAGG + Intergenic
981074906 4:140581045-140581067 CTTTGTCAACCCCAGGAGAGGGG + Intergenic
981739234 4:147985072-147985094 CCTAATCTCATCCAGGAGAGTGG + Intronic
984735958 4:183108382-183108404 CCTACTGGATCCCAGTAGAGGGG + Intronic
985745115 5:1642466-1642488 CCTAACCCTCCACAGGAGAGTGG - Intergenic
992236509 5:74715042-74715064 ACTGATGGACTCCAGGAGAGAGG + Intronic
998747295 5:145275262-145275284 CCTCATGGACCACAGGAGATGGG + Intergenic
999615734 5:153421135-153421157 CCTACACCACCCCATGAGAGAGG + Intergenic
1000056517 5:157611756-157611778 CTGAATCAACCCCAGTAGAGTGG - Intergenic
1001080754 5:168665559-168665581 CCTGCTCCTCCCCAGGAGAGGGG - Intronic
1001429599 5:171648647-171648669 CCTAGGCGGCCCCAGGAGAGAGG + Intergenic
1002911622 6:1495197-1495219 CCTAATGGAGCCCACCAGAGTGG - Intergenic
1008017736 6:46540962-46540984 TTTAAACCACCCCAGGAGAGGGG + Intergenic
1014163369 6:118195894-118195916 CTTTAACGACCCCAGGAGTGCGG - Intronic
1014875183 6:126649856-126649878 CCCATTCTTCCCCAGGAGAGAGG - Intergenic
1017502007 6:155034225-155034247 ACCAATGGACCCCAGAAGAGAGG - Intronic
1031043657 7:116863375-116863397 CCAAATCGACCCCCGGGGGGGGG - Intronic
1040695123 8:49987145-49987167 CATACTGGACCCCAGGAGGGGGG + Intronic
1040802185 8:51355020-51355042 ACTAACAGACCCAAGGAGAGTGG + Intronic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1055817088 9:80219521-80219543 CCTCATCTACCCCAGGTGTGAGG + Intergenic
1057160686 9:92886260-92886282 CCTAACCTTCCCCAGGAAAGGGG + Intergenic
1061280447 9:129595127-129595149 CCTAATGGTCCCCAGGAGACCGG + Intergenic
1190373567 X:49766368-49766390 CATAATAGACCACAGGAGACTGG + Intergenic