ID: 1095973114

View in Genome Browser
Species Human (GRCh38)
Location 12:47918524-47918546
Sequence GTGGTCAAGGTGAACATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095973114 Original CRISPR GTGGTCAAGGTGAACATTAT TGG Intronic
901281961 1:8044446-8044468 GTGATCAAGGTCAACATCAATGG - Intergenic
902158647 1:14511046-14511068 GTGGTCAACTTGTACAGTATTGG - Intergenic
903817973 1:26079003-26079025 GTGGGCAAGGTGAACCTGTTGGG + Intergenic
905394748 1:37659989-37660011 CTGGTCAAGGTGAACATTCTAGG + Intergenic
908554425 1:65243438-65243460 GTGGGCAAGGTGAACCTGTTGGG + Intergenic
910537247 1:88312425-88312447 CTGGTCAGGGGGAACATTGTGGG - Intergenic
911834279 1:102596416-102596438 GTAGTCCAAGTGAAAATTATGGG + Intergenic
913289851 1:117262005-117262027 GTGGGCAAGGTGAACACACTGGG - Intergenic
916918903 1:169440342-169440364 GTGGGCAAGGTGAACCTACTGGG - Intronic
918107225 1:181425446-181425468 GTGGAGGAGGTGAACATAATTGG + Intronic
918452579 1:184673676-184673698 GTGGGCAAGGTGAACCTGTTGGG + Intergenic
921013578 1:211166835-211166857 GGGATCAAGGTAAACATTTTAGG + Intergenic
1063533769 10:6862606-6862628 GTGACCAAGGTCAACATGATTGG - Intergenic
1064769446 10:18709115-18709137 GTAATCAAGGTAAACATCATTGG - Intergenic
1065780822 10:29165087-29165109 GTGGAAAAGGTAAACATTGTAGG + Intergenic
1067244094 10:44521928-44521950 GTGATCAAGGTTAACATCACTGG - Intergenic
1067803873 10:49380067-49380089 CTGGGCAAGGTGGACATGATGGG - Intronic
1069542222 10:69303706-69303728 GTGGGCAAGGTGAACCTGTTGGG - Intronic
1071069944 10:81680327-81680349 GTGGTCAAGGTGAACCCATTGGG - Intergenic
1072052488 10:91719778-91719800 GTGGTAATAGTGAACATTCTTGG - Intergenic
1072795233 10:98349500-98349522 GTGTTCGAGGTGAACATTCAGGG - Intergenic
1074131014 10:110575599-110575621 GTGGTTTAGGAGAAAATTATAGG + Intronic
1075598676 10:123751000-123751022 GTGTTCAGGGTGAACCTTCTAGG + Intronic
1076099668 10:127766025-127766047 GTGGACAAGGTGAACCTGTTGGG - Intergenic
1076379142 10:130013422-130013444 TTGGGCAAGATGAACATTGTTGG + Intergenic
1088225652 11:107616769-107616791 GTGCTCAAGGTAAACAAAATAGG - Intronic
1088332259 11:108666018-108666040 GAGGTCAAAGTGATCATTACAGG - Intronic
1090289782 11:125532498-125532520 GCCGTTAAGGTGAAGATTATTGG - Intergenic
1091220362 11:133926915-133926937 GTGGTCACTGTGAACACTTTAGG - Exonic
1095973114 12:47918524-47918546 GTGGTCAAGGTGAACATTATTGG + Intronic
1096353375 12:50918479-50918501 GTGGGCAAGGTGAACCTACTGGG - Intergenic
1097659905 12:62418179-62418201 GTGGGCAAGGTGAACCTGTTGGG - Intergenic
1098039035 12:66335558-66335580 GTGGTCAAGGAAAACTTTATTGG + Intronic
1106441325 13:29775180-29775202 GTTGTTAACTTGAACATTATTGG + Intronic
1106461420 13:29973611-29973633 GTGGGCAAGGTGAACACGTTGGG + Intergenic
1109258197 13:60109752-60109774 TTGAACAAGGTGAACATGATAGG - Intronic
1110003220 13:70232616-70232638 GGAGTCAAGGTGAGCATTTTGGG + Intergenic
1110404849 13:75138783-75138805 GTGGGCAAGGTGAACGTGTTAGG - Intergenic
1112242910 13:97699928-97699950 GTGATCAAGGTCAACATCAATGG + Intergenic
1112424770 13:99287808-99287830 GTCCTAAAGTTGAACATTATTGG - Intronic
1113241973 13:108348038-108348060 GTGCTCAAGGCCAACATTAAGGG - Intergenic
1114388083 14:22276435-22276457 GAGTTCAAGGTGAACCTTACTGG + Intergenic
1114534157 14:23412478-23412500 GTGCTCTAGGTGAACTTTAGGGG + Intergenic
1120279070 14:82416145-82416167 GTTTTCACGTTGAACATTATTGG + Intergenic
1122396118 14:101433263-101433285 GTGATGAAGGTCAACATTAATGG + Intergenic
1125607116 15:40946036-40946058 GTGATCAAGGTAAGCATTTTAGG - Intergenic
1126335292 15:47580782-47580804 GTTTTCAAAGTGAGCATTATAGG - Intronic
1130386382 15:83415885-83415907 GCGGTCAAGGGGGACATTTTGGG + Intergenic
1130999718 15:88930099-88930121 GTGGGCAAGGTGAACCTCTTGGG + Intergenic
1131959088 15:97769392-97769414 GTGATCAAAGTTAACATCATTGG + Intergenic
1132250124 15:100329749-100329771 GTGGGCAAGGTGAGTATTAGAGG - Intronic
1135410378 16:22229713-22229735 GGGGGAAAGGCGAACATTATTGG + Intronic
1137679798 16:50331028-50331050 GTGCTCAGCTTGAACATTATTGG - Intronic
1138845943 16:60566302-60566324 GTTGTTTATGTGAACATTATAGG - Intergenic
1139534901 16:67565700-67565722 GTTGTAAAGGTTAACTTTATCGG + Intronic
1143228681 17:5331902-5331924 CTGATCAAAGTGAACATTAATGG + Intronic
1143730664 17:8880974-8880996 GTGGACAAGGTGCAGATCATCGG - Exonic
1143837374 17:9702928-9702950 CTGGTCATGGTGAAGGTTATGGG + Intronic
1146641229 17:34542996-34543018 GTGGTCAAAATGGACATTTTGGG + Intergenic
1147297113 17:39492812-39492834 GTGGACAAGTTTGACATTATTGG + Exonic
1149943654 17:60898708-60898730 GTGGCAATGGTGAACAGTATGGG + Intronic
1155669467 18:28351211-28351233 GTGGGCAAGGTGAACTTGTTGGG + Intergenic
1155800843 18:30101758-30101780 TTCGTCAAGGTGAACATTTATGG + Intergenic
1157832243 18:50867127-50867149 GTGATCAAGGTAAATATTCTTGG + Intergenic
1165713888 19:38031622-38031644 GTGATCTAGGTGAACATTACCGG - Intronic
925335240 2:3094194-3094216 GTGGTGAAAGTGGACATTCTTGG + Intergenic
929111996 2:38412699-38412721 GCGGGCAAGGTGAACCTGATGGG + Intergenic
929671553 2:43879823-43879845 GTGATCAAAGTGAACGTTGTTGG - Intergenic
932261543 2:70331565-70331587 TTGATAAATGTGAACATTATGGG + Intergenic
932304528 2:70692533-70692555 CAGATCAAGGTGAACATTCTGGG - Exonic
932863472 2:75317908-75317930 GTGGGCAAGGTGAACCTGTTGGG + Intergenic
933088069 2:78081437-78081459 GTGGTCAAGGAGAACAACAATGG - Intergenic
934899623 2:98148330-98148352 GTAGTGAAGTTGAACATTTTTGG + Intronic
937414366 2:121702609-121702631 GTGGGCAAGGTGAACCTCTTGGG + Intergenic
938670942 2:133586280-133586302 GGGTTCAGGGTGGACATTATTGG - Intergenic
942914469 2:181286564-181286586 TTGGGCAAGGTGAACGTTATTGG + Intergenic
944027217 2:195184986-195185008 GTGGTCAAGCTAAAAATTAATGG - Intergenic
946952240 2:224889650-224889672 TTGGTCAGGGTCAACTTTATGGG + Intronic
1169324778 20:4666407-4666429 GTGGGCAAGGTGAACCCTATTGG + Intergenic
1172220269 20:33269234-33269256 GTGAGCAAGGTGCTCATTATTGG + Intergenic
1173861672 20:46287874-46287896 GTTGTCCAGGTGAACAATAATGG + Intronic
1176662754 21:9655063-9655085 GTGGTGAAGGAGAAGATTGTTGG - Intergenic
1176951812 21:15056583-15056605 ATTGTCAAAGTGAACAATATGGG - Intronic
1184615766 22:45637257-45637279 ATGGTCAAGGTGAAACTTAGTGG - Intergenic
951574893 3:24103447-24103469 ATGGTCAAGTTGAACATCTTTGG + Intergenic
952801646 3:37298102-37298124 GTGGGCAAGGTGAACCCTTTGGG - Intronic
954400420 3:50316788-50316810 GTGGTGAAGGTGAACAGTTCAGG - Intergenic
955560551 3:60184581-60184603 GTGATCAAGGTTAACATCATCGG - Intronic
955772209 3:62396609-62396631 GTGGTCAAGGATAACATGGTCGG + Intergenic
957600259 3:82324779-82324801 GTGCTCAACTTGAACTTTATTGG - Intergenic
960194037 3:114742994-114743016 GATGTCAAAGTGAACATGATGGG - Intronic
962177568 3:133170241-133170263 GTGGACAATGTGAATATTATGGG - Intronic
963161473 3:142154850-142154872 GTGATCAATGTTAACATCATCGG + Intergenic
964899186 3:161637447-161637469 GTAGGCAAGGTGAACACTTTGGG - Intergenic
968163150 3:196443504-196443526 GTGGGCAAGGTGAACCTGCTGGG - Intergenic
969929143 4:10613285-10613307 GTGGTCAAGGTGAGCCTTGCTGG + Intronic
970821123 4:20215981-20216003 GAGGTCAAGCTGAGCATGATGGG - Intergenic
971322730 4:25618391-25618413 GTGGTCAAGGTGAACCCACTGGG + Intergenic
973581869 4:52351987-52352009 GTGGGCAAGGTGAACCTATTGGG + Intergenic
975743042 4:77449209-77449231 GTGATCAAGGTTAACATCAGTGG - Intergenic
978151111 4:105436157-105436179 GTTCTCAACTTGAACATTATTGG - Intronic
980466705 4:133196118-133196140 GTGGGCAAGGTGAACCTGTTAGG - Intronic
980493903 4:133566738-133566760 GTGATCAAGGTCAACATCAATGG + Intergenic
981838040 4:149078367-149078389 GTGATCAACGTTAACATCATCGG - Intergenic
982008866 4:151087834-151087856 GTGGTCAAGGTGAAAGCCATCGG + Intergenic
983304210 4:165965682-165965704 GTAGGCAATGTGAACGTTATTGG - Intronic
983748853 4:171238031-171238053 GTGGGCAAGGAGAACCTGATGGG - Intergenic
984257270 4:177403880-177403902 GTGGGCAAGGTGAACCTGTTGGG - Intergenic
985412582 4:189701115-189701137 GTGGTGAAGGAGAAGATTGTTGG + Intergenic
986987993 5:13520885-13520907 GTGATCAAGGTTAACATCACCGG - Intergenic
988515940 5:31904768-31904790 GTAGTGATGGTGAATATTATTGG + Intronic
991332568 5:65508066-65508088 GTGGTCAAGGTTAATATCACAGG - Intergenic
991936046 5:71801296-71801318 ATGGTCAAGCTGAAGATTAATGG + Intergenic
992164476 5:74035753-74035775 AAGGTCAAGGGGAACATTAATGG + Intergenic
996976652 5:129441985-129442007 GTGTTCAAGGTGAAGATTAAGGG + Intergenic
1000831839 5:166111419-166111441 GTGGGCAAGGTGAACCTGTTGGG + Intergenic
1005090168 6:22047955-22047977 GTGGTCAGGGTAAAAATTGTAGG + Intergenic
1005203716 6:23376981-23377003 GTTCTCATGTTGAACATTATGGG + Intergenic
1009578707 6:65502904-65502926 GTGATCAAGGTTAACATTAATGG - Intronic
1010931863 6:81813467-81813489 TTGGTCAAGTTGAACTTTAAAGG + Intergenic
1011680435 6:89778068-89778090 GTGGGCAAGGTGAACCTGTTGGG + Intronic
1013222984 6:108096286-108096308 GTTCTCAAGTTGATCATTATTGG - Intronic
1017182094 6:151563717-151563739 GTGATCCAGGTCAACACTATTGG - Intronic
1018697667 6:166403050-166403072 GTTGCCAAGGAGAACATTAGTGG - Intergenic
1021134640 7:16950455-16950477 GTACTCAATGTTAACATTATTGG + Intergenic
1021255390 7:18386246-18386268 GTGCCCAGGGTGCACATTATGGG - Intronic
1021707970 7:23386764-23386786 GTGATCAAGGTTAACATCAGTGG + Intronic
1022856358 7:34318784-34318806 GAGGTCAGGTTGGACATTATAGG - Intergenic
1023753559 7:43394714-43394736 GTGGGCAAGGTGAACCCTTTGGG - Intronic
1023753968 7:43398647-43398669 GTGGGCAAGGTGAACACATTGGG - Intronic
1024210083 7:47195773-47195795 GTGGTCAAAATGAAGATTACAGG - Intergenic
1024404228 7:48959861-48959883 GTGTTCAAAGTGAACTTAATAGG + Intergenic
1026670621 7:72387500-72387522 GTGATCAAGGTCAACATCAACGG + Intronic
1029786402 7:102795943-102795965 GTGGGCAAGGTGAACCTGTTGGG - Intronic
1030644093 7:112039865-112039887 GAGGTCTAGGTGAAAGTTATAGG - Intronic
1032833872 7:135655443-135655465 GTGGTCAAGCTTAATATAATTGG - Intergenic
1033274393 7:139960160-139960182 GTGCTCAAGGTTAAGACTATGGG - Intronic
1033278215 7:139988477-139988499 CTGGTCAAGGTGAACACAAAGGG - Intronic
1034120414 7:148621669-148621691 GTGGGCAAGGTGAACCTGTTGGG - Intergenic
1034726638 7:153342205-153342227 ATGGCCAAGGTGAAGATTGTGGG + Intergenic
1037377739 8:18250194-18250216 GTGGAAAAGGTGCACAGTATTGG + Intergenic
1038914181 8:32001841-32001863 GTGATCAAGGTCAACATCAATGG - Intronic
1040909750 8:52505839-52505861 GTGATGAAGGTTAACATTACTGG + Intergenic
1040977414 8:53209360-53209382 GTGGTCAAGGTCACCATCAAGGG - Intergenic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1043735462 8:83736392-83736414 GTAGTCAAGGTCAAATTTATTGG + Intergenic
1043817770 8:84824205-84824227 GTTCTCAAATTGAACATTATTGG - Intronic
1045341948 8:101262976-101262998 GTGGTCAAGTTGAATCTCATTGG + Intergenic
1047109166 8:121769383-121769405 TTGGTCAACATGAACTTTATCGG + Intergenic
1047160567 8:122373954-122373976 GTCTTCAAGGTGAACTTAATTGG - Intergenic
1047264454 8:123292917-123292939 TTGGTCAGGGAGAACATGATTGG - Intergenic
1047467355 8:125130292-125130314 GTGATCAAGGTTGACATTACTGG - Intronic
1048748169 8:137639092-137639114 GTGGGTAATATGAACATTATTGG + Intergenic
1050910541 9:11063867-11063889 TTCATCAAAGTGAACATTATTGG - Intergenic
1051048236 9:12900837-12900859 ATGATCAAAGTGAACATTGTTGG - Intergenic
1053166145 9:35845571-35845593 GGGGTCCAGGTGAAGATGATGGG + Intronic
1055067054 9:72129673-72129695 GTGAGCAAAGTGAACATCATCGG - Intronic
1055415614 9:76079457-76079479 GTTCTCAACTTGAACATTATTGG + Intronic
1056641740 9:88377340-88377362 GCAGTCAAGGTAAACATTTTAGG + Intergenic
1057740175 9:97704354-97704376 GTGGTCACTTTGAACATCATTGG + Intergenic
1058092155 9:100816583-100816605 GTTGTCCAGGTGAAGAGTATAGG - Intergenic
1058485362 9:105438784-105438806 GTGGTCAAAGTGGAGATAATAGG - Intronic
1059157339 9:112001698-112001720 GTGCTCATGGTGAACAGGATGGG - Intergenic
1059285142 9:113165963-113165985 GAGGTCAAGGTGAGCATTCTGGG - Exonic
1059364558 9:113776091-113776113 GTGGGAAAGGTGAACGATATGGG - Intergenic
1059999526 9:119945526-119945548 GTGGTCAATGGGAAAGTTATTGG - Intergenic
1060427485 9:123518763-123518785 GTGGTCTAGGTGATCATCACAGG + Intronic
1062478721 9:136741911-136741933 GTGGTAAAGGTGAACAAAGTGGG - Exonic
1203670009 Un_KI270755v1:1867-1889 GTGGTGAAGGAGAAGATTGTTGG - Intergenic
1186033978 X:5400344-5400366 GTGGGCAAGGTGAACCTGATGGG + Intergenic
1187917801 X:24171633-24171655 GCGGTAAAGGTGAAAATTATTGG + Intronic
1188138553 X:26520557-26520579 GTGGGCAAGGTGAACTCTTTGGG - Intergenic
1188495999 X:30783541-30783563 GTGGGCAAGGTGAACACATTGGG + Intergenic
1189159665 X:38799150-38799172 GTGGTCAAGAAGAAAAATATAGG + Intergenic
1189271264 X:39753696-39753718 GTGATCAATGTTAACATTACCGG + Intergenic
1189644911 X:43117691-43117713 GTGATCAAGGTCAACATCAATGG - Intergenic
1190912861 X:54788490-54788512 GTGGTCATGGAGGACATCATTGG - Exonic
1192615282 X:72614548-72614570 GTGGTAAAGGAGAATATTCTAGG + Intronic
1194620237 X:96162110-96162132 GTGGGCAAGGTGAACCCTTTGGG - Intergenic
1196532924 X:116810612-116810634 GTAGCCAAGGTAAACATTTTTGG + Intergenic
1198200958 X:134418217-134418239 GTGGTCCAGGTGAGAATTATTGG + Intronic
1199235698 X:145489679-145489701 CTGGTGAAGCTGAACATGATCGG - Intergenic
1201313885 Y:12623718-12623740 GTGCTCAGCTTGAACATTATTGG - Intergenic