ID: 1095975621

View in Genome Browser
Species Human (GRCh38)
Location 12:47939126-47939148
Sequence ACAACATGATGTGGCCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095975621_1095975625 5 Left 1095975621 12:47939126-47939148 CCTCCAGGGCCACATCATGTTGT 0: 1
1: 1
2: 0
3: 9
4: 160
Right 1095975625 12:47939154-47939176 GCTCAAGCACTGAGCACTTGAGG 0: 1
1: 0
2: 0
3: 11
4: 126
1095975621_1095975628 11 Left 1095975621 12:47939126-47939148 CCTCCAGGGCCACATCATGTTGT 0: 1
1: 1
2: 0
3: 9
4: 160
Right 1095975628 12:47939160-47939182 GCACTGAGCACTTGAGGGCAGGG 0: 1
1: 0
2: 1
3: 23
4: 425
1095975621_1095975627 10 Left 1095975621 12:47939126-47939148 CCTCCAGGGCCACATCATGTTGT 0: 1
1: 1
2: 0
3: 9
4: 160
Right 1095975627 12:47939159-47939181 AGCACTGAGCACTTGAGGGCAGG 0: 1
1: 0
2: 0
3: 31
4: 387
1095975621_1095975626 6 Left 1095975621 12:47939126-47939148 CCTCCAGGGCCACATCATGTTGT 0: 1
1: 1
2: 0
3: 9
4: 160
Right 1095975626 12:47939155-47939177 CTCAAGCACTGAGCACTTGAGGG 0: 1
1: 0
2: 1
3: 16
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095975621 Original CRISPR ACAACATGATGTGGCCCTGG AGG (reversed) Intronic