ID: 1095976374

View in Genome Browser
Species Human (GRCh38)
Location 12:47943214-47943236
Sequence TCCTTTCCTCCTCAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 5, 3: 21, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095976374_1095976382 27 Left 1095976374 12:47943214-47943236 CCACCCTCCTGAGGAGGAAAGGA 0: 1
1: 0
2: 5
3: 21
4: 271
Right 1095976382 12:47943264-47943286 TCCATGAACTCTGGCCATGAGGG 0: 1
1: 0
2: 1
3: 15
4: 160
1095976374_1095976381 26 Left 1095976374 12:47943214-47943236 CCACCCTCCTGAGGAGGAAAGGA 0: 1
1: 0
2: 5
3: 21
4: 271
Right 1095976381 12:47943263-47943285 TTCCATGAACTCTGGCCATGAGG 0: 1
1: 0
2: 2
3: 13
4: 159
1095976374_1095976380 18 Left 1095976374 12:47943214-47943236 CCACCCTCCTGAGGAGGAAAGGA 0: 1
1: 0
2: 5
3: 21
4: 271
Right 1095976380 12:47943255-47943277 TGAGAAGTTTCCATGAACTCTGG 0: 1
1: 0
2: 0
3: 19
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095976374 Original CRISPR TCCTTTCCTCCTCAGGAGGG TGG (reversed) Intergenic
900933383 1:5750683-5750705 TCCTTCCTTCCTGTGGAGGGAGG + Intergenic
901380934 1:8873696-8873718 TCCTTTCTTCCTGAGGGGGAGGG + Intronic
901521964 1:9792062-9792084 TCATTTGCTACTCAGGAGGCTGG + Intronic
901736370 1:11314797-11314819 GACTTTCCTCTTCAGAAGGGAGG + Intergenic
902606920 1:17573957-17573979 TCCTTTCCTCTTCACCAGGGAGG - Intronic
903335237 1:22620180-22620202 TCCTTTGCTTCTCAGCAGGAGGG - Intergenic
903814017 1:26051427-26051449 TCCTTTCCTGAGCAGGAGGATGG - Exonic
904008074 1:27374159-27374181 CCCTTTCCTCCTCAGCAGAATGG + Intronic
904496282 1:30888631-30888653 GCCTCTCCTCCTGAGGAGGCGGG + Intronic
904768550 1:32868851-32868873 TCCTTCCCTCCTAAGGACAGTGG + Intronic
905286841 1:36886195-36886217 TCCTTCCCTCCACATGAGGCCGG - Intronic
906480126 1:46194218-46194240 TCCTTCCCAGCTCAGCAGGGGGG - Intronic
906722355 1:48018168-48018190 TTCTTTCCTCCTGAGGAGCTAGG - Intergenic
907507112 1:54927523-54927545 CCATTTCCTCCTCTGGAAGGTGG + Intergenic
908234675 1:62137895-62137917 TAGTCTCCTCCTCAGGTGGGGGG + Intronic
908419859 1:63949326-63949348 ACCTTTCCTTCTCTGGGGGGTGG - Intronic
910841997 1:91569960-91569982 GCCTTTCCCCGTGAGGAGGGTGG + Intergenic
911907830 1:103592189-103592211 TCCTTTACTCCTTAAGAGGGAGG + Intergenic
912130496 1:106594243-106594265 TCTCTTGCTCCTCGGGAGGGTGG + Intergenic
912439248 1:109686259-109686281 CCCTGTCCTGCTGAGGAGGGAGG - Intronic
912442561 1:109710701-109710723 CCCTGTCCTGCTGAGGAGGGAGG - Intergenic
915108415 1:153548302-153548324 TCCCCTCCTCCTCCGGGGGGAGG - Intronic
916207554 1:162330273-162330295 TCCTTGCCTGCTTAGAAGGGAGG - Intronic
916569027 1:166008856-166008878 CCCATTCCTCCTCAGCAGGTGGG - Intergenic
917259146 1:173148393-173148415 TCCATTCCTCCTCACTAGGTTGG - Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
917603642 1:176602982-176603004 GACTTTCCTCCTCAGGTGAGTGG + Intronic
922044250 1:221928276-221928298 TCCTCTCCTCCGCAGAAGGAAGG - Intergenic
922574975 1:226655357-226655379 CCATTTCCTCCCCAGGAGGCAGG - Intronic
923104123 1:230841333-230841355 TGCTGTCCTCCCGAGGAGGGAGG - Intronic
923207684 1:231774621-231774643 TCCTTTCTTCCACCGTAGGGAGG + Intronic
924182167 1:241449815-241449837 TACTTTTGTCCTCAGGATGGAGG - Intergenic
924538911 1:244962644-244962666 TGCTTTTCTCCCCCGGAGGGAGG - Intergenic
1063718433 10:8553698-8553720 TCCATTCCTTCTCACCAGGGTGG - Intergenic
1065831447 10:29618139-29618161 TCCTGTCCTCTTGAGGAGGGAGG + Intronic
1066494885 10:35933039-35933061 TCCTCTCGTGCCCAGGAGGGAGG + Intergenic
1069490527 10:68856829-68856851 TGCTGTCCTCCCCAGGTGGGAGG - Intronic
1069848956 10:71392732-71392754 TCATATCCACCCCAGGAGGGAGG + Intergenic
1071387432 10:85136117-85136139 TCCCTTCCTCCAAAGGAGAGGGG + Intergenic
1071437781 10:85662834-85662856 TCCCTTCATCCTGAGGAGAGTGG - Intronic
1073575813 10:104622319-104622341 TCCTTACAGCCTCAAGAGGGTGG - Intergenic
1074007784 10:109445809-109445831 TACTTTCTTGCTGAGGAGGGAGG + Intergenic
1075428735 10:122363326-122363348 TACTTTCCTCCTCTGTAGGTGGG - Intergenic
1075680397 10:124327046-124327068 TCCTTGCCTCCTAAGGAATGAGG + Intergenic
1075713967 10:124545251-124545273 TCCTTTCCTCGTCTGGAAAGTGG + Intronic
1076269227 10:129136313-129136335 TCCTTTCTTCCTCTGCAGAGGGG + Intergenic
1076417804 10:130304033-130304055 TCATTTCCTCCTGATCAGGGTGG + Intergenic
1076886101 10:133263180-133263202 TCCTTGCTTCCTCTGGATGGGGG + Exonic
1077374668 11:2199923-2199945 TCCTATCCAGCTCAGGAAGGGGG - Intergenic
1077809711 11:5624930-5624952 GCAGTTCCTCCTCAGGAGGGAGG + Intronic
1077865410 11:6217776-6217798 TCCTGTCCTCCTCAGGCAGTAGG + Exonic
1080684272 11:34502520-34502542 TGCTCTCCTCCACAGGTGGGAGG - Intronic
1080956271 11:37099550-37099572 TCCTATCCTCCTCAGCAGAGAGG - Intergenic
1083504314 11:63141403-63141425 TCCTTTACTCCGATGGAGGGGGG - Intronic
1083637517 11:64128545-64128567 TCCTGTCTACCTCAGGCGGGCGG - Intronic
1084719372 11:70894522-70894544 ACCTTACCTTCTCAGAAGGGAGG + Intronic
1085392310 11:76188801-76188823 TCCTTCCCTCCTCTGCACGGCGG - Intronic
1086167316 11:83794665-83794687 TCATTTAATCCTCAGGAGGGTGG + Intronic
1087104156 11:94393979-94394001 TTCTTTCCTCTTCTGGAGGTGGG - Intronic
1088901408 11:114120495-114120517 TTCTTTCCTCTTCAGGAAAGAGG - Intronic
1089004104 11:115076417-115076439 GCCTTTCCTTCTTAGGAGTGAGG - Intergenic
1089191941 11:116659904-116659926 CCCTTCCTTCCTCAGGAGGCAGG - Intergenic
1091131218 11:133148677-133148699 TCCCCTCCTCCCCTGGAGGGCGG - Intronic
1091205864 11:133820629-133820651 TCCTTTCCTTCTAAGGGGGATGG + Intergenic
1094555888 12:31499357-31499379 TCCTTTCCTCCTAAGAAAGTAGG + Intronic
1095976374 12:47943214-47943236 TCCTTTCCTCCTCAGGAGGGTGG - Intergenic
1096496117 12:52040395-52040417 ACCCTTCCTCCTCAGCAGTGGGG + Intronic
1096536648 12:52279236-52279258 TCCTTGTCTTCTCCGGAGGGAGG - Intronic
1097743021 12:63267654-63267676 TCTTTTCCTCTTCAGGGGGATGG + Intergenic
1098460232 12:70725041-70725063 CCCTTTCTTTCTCAGGAAGGTGG - Intronic
1101004081 12:100384727-100384749 CCCTTCCCTCCTCAGGGTGGAGG - Intronic
1101657885 12:106739876-106739898 TCCTTTCCTCCTTGGGAGCATGG + Intronic
1102064615 12:109963653-109963675 TCAGTTCTTCATCAGGAGGGAGG + Intronic
1102396882 12:112593651-112593673 TCCCTTCCTTCACAGGAAGGTGG - Intronic
1102548126 12:113671320-113671342 TCCTTTCCACTTCAGGATGTGGG - Intergenic
1103440846 12:120961781-120961803 TCGTTGACTCCTCAGCAGGGAGG + Intergenic
1106186679 13:27415832-27415854 TCCTCTCCTCCTGAAGAGGATGG - Intergenic
1106956369 13:34942795-34942817 TTCCCTTCTCCTCAGGAGGGGGG + Exonic
1107240769 13:38231404-38231426 TCCATTCCTCCTCACTAGGGAGG + Intergenic
1108721647 13:53138696-53138718 ACCGTTCCTTCTCAAGAGGGAGG - Intergenic
1110181747 13:72625854-72625876 TGCTTGCCTTCTCAGCAGGGAGG + Intergenic
1110725137 13:78814240-78814262 TCATTTCCTCATCGGTAGGGTGG + Intergenic
1110821832 13:79925950-79925972 TCCATTCCTCCTCACCAGGCAGG - Intergenic
1111166085 13:84458804-84458826 TCCATTCATCATCAGGAAGGAGG + Intergenic
1112076175 13:95915817-95915839 TCCATTCCTCCTCACTGGGGAGG + Intronic
1112276162 13:98022078-98022100 CCCTTTCCCCTTCAGGTGGGCGG - Exonic
1115362064 14:32514936-32514958 ACCTTTCCTCCTCAGCTTGGTGG + Intronic
1117503096 14:56374034-56374056 TCCATTCCTCCTCACAAGGCAGG - Intergenic
1117629136 14:57671338-57671360 TCCTTTCCACTTGAGGAGAGGGG + Intronic
1117685884 14:58252854-58252876 TCCTTTCCTTTTCAGGTGGCAGG - Intronic
1117978763 14:61321894-61321916 TCCTTTCCACCTCGGGAGGGAGG + Exonic
1118383906 14:65239539-65239561 TATCCTCCTCCTCAGGAGGGAGG + Intergenic
1119187481 14:72652950-72652972 TCCTTTCCTCAGGAGGAGGATGG + Intronic
1120854442 14:89200670-89200692 TCCTTTTCGCCTCAGCAGCGAGG + Intronic
1121692765 14:95889651-95889673 TAAGTTCCTCCTCACGAGGGAGG - Intergenic
1122182993 14:99969465-99969487 TCCATTCCTCCTCTGGCAGGTGG - Intergenic
1122387911 14:101361549-101361571 TGTTTTCCTCCTCTGTAGGGTGG + Intergenic
1122818588 14:104327992-104328014 TGCCATCCTCCTCTGGAGGGAGG + Intergenic
1122846080 14:104499949-104499971 GCCTTTCCTCCCCAGGTGGCAGG - Intronic
1123040045 14:105486724-105486746 TCCTGCCCTCCCCAGGACGGAGG - Intergenic
1125514431 15:40309719-40309741 CCCTTTCCTCCTCAGGCTGAGGG - Intergenic
1126268789 15:46787877-46787899 TCCTTTCCCCCTAAGGAGGAAGG - Intergenic
1126858122 15:52858745-52858767 TCCTTTCCTCCTCACCAGATAGG - Intergenic
1127323060 15:57866239-57866261 TCCTTTCCTCCTGAGGCCAGTGG + Intergenic
1128450691 15:67804444-67804466 TCCTGCCCTCCTCAGCTGGGAGG - Intronic
1128566251 15:68702079-68702101 TCATGTCCTCCTCAGGGGGTTGG + Intronic
1129999546 15:80034908-80034930 TGCTTTCCTGCTCAGGTGGGAGG - Intergenic
1130101612 15:80898861-80898883 ACCTTTCCTCCACAGGGAGGTGG + Intronic
1130987462 15:88854189-88854211 CCCTTTCTTCCTCAGAAGGATGG + Intronic
1130996640 15:88907868-88907890 CCCTGGCTTCCTCAGGAGGGTGG + Intronic
1131444417 15:92485336-92485358 TCTATTCCTCCTCATTAGGGAGG - Intronic
1132055288 15:98647609-98647631 ACATTTCCTCCCCCGGAGGGAGG + Intergenic
1132104931 15:99056642-99056664 TCCTGTGCTCCTCAGGGGGCAGG + Intergenic
1135188725 16:20336939-20336961 CCCTTTCCTCATGAGGAGAGGGG - Intronic
1136239606 16:28936153-28936175 TCTTTTCCTCCTCAGGACCAGGG - Exonic
1137600824 16:49755051-49755073 TCCCCTCCTGCTGAGGAGGGAGG - Intronic
1137920125 16:52478765-52478787 TGCTTTCCTCCTTAGAAGTGAGG - Intronic
1138384404 16:56626333-56626355 TCCTTTCCCACTCAGGACAGAGG - Intronic
1138386061 16:56636306-56636328 TCCTTTCCCACTCAGGACAGAGG - Intergenic
1138392883 16:56683029-56683051 TCCTTTCCCACTCAGGGGAGAGG - Intronic
1138962334 16:62042055-62042077 TCTTTCCATCCTCAGGGGGGTGG + Intergenic
1141445617 16:84055922-84055944 TCCCTCCCTCCCCAGGAGGCGGG - Intronic
1142727364 17:1825853-1825875 TCCTGTCTTCCTTAGGATGGTGG - Intronic
1145979300 17:29002431-29002453 TCCTGGCCTCCTCAGCAGGGTGG - Intronic
1146527822 17:33581831-33581853 TCCTTTGCTACTCTGGAGCGGGG + Intronic
1147521685 17:41179363-41179385 TCCTTGACTCCTCAGGGGTGGGG - Intergenic
1150833048 17:68540951-68540973 TCTTCTCCCCCTCAGGTGGGAGG - Exonic
1152633900 17:81422789-81422811 CCTTTTCCTCCTCGGGATGGTGG - Intronic
1154340936 18:13501536-13501558 TCTTTCCCTCCTCCGGAGGTTGG + Intronic
1155372415 18:25115771-25115793 TCCTGTCTTCCTCAGGGGAGTGG + Intronic
1155389808 18:25323063-25323085 TCATTTCCTCCCAAAGAGGGAGG + Intronic
1155572762 18:27213396-27213418 TCCTTTCCTGGCCAGAAGGGAGG - Intergenic
1156932030 18:42656974-42656996 ACCTTTCCTTCTCATGAAGGTGG + Intergenic
1158674593 18:59506727-59506749 TCCTCTCCACCCCAGGAGGCTGG - Intronic
1163983460 19:20923419-20923441 CCCTTTCCCCCTCGGGATGGCGG - Intronic
1164415369 19:28042811-28042833 GCCTTTACCCCTCAGGAGAGAGG + Intergenic
1166146847 19:40843970-40843992 GCCTCTCCTCCTCAGGAAAGCGG - Exonic
1166151008 19:40875867-40875889 GCCTCTCCTCCTCAGGAAAGCGG - Exonic
1166155502 19:40908646-40908668 GCCTCTCCTCCTCAGGAAGGCGG - Intergenic
1166179312 19:41095745-41095767 GCCTCTCCTCCTCAGGAAAGCGG + Exonic
1166911867 19:46164537-46164559 TCCTATCCTCATCAGGAAGCAGG - Intergenic
1167720987 19:51180169-51180191 TCCTTTCTCCCTCAGGACAGAGG + Intergenic
925810792 2:7698387-7698409 TCCTTTCCTAGGCAGGAGGTTGG + Intergenic
926153850 2:10439730-10439752 TCCTGTCCCCCTCATGAGGCTGG + Intergenic
929468827 2:42170113-42170135 TCATTCCCTCTTCAGGAAGGGGG + Intronic
929947877 2:46383961-46383983 GCCTTTCCTCCTTGGGATGGGGG + Intronic
930023494 2:47015420-47015442 TGCTGCCCTCCTCAGGAAGGAGG - Intronic
930731569 2:54733160-54733182 TCCTTTCATCCCCGGGAGGTAGG - Intronic
931743684 2:65272928-65272950 TCCTTTTTTCCTCTGGTGGGTGG - Intergenic
932232458 2:70094124-70094146 TCCTGTCCTCTTCTGGATGGAGG + Intergenic
932881841 2:75508911-75508933 TCTTTTCCTCCTCTGAGGGGAGG + Intronic
933796844 2:85926824-85926846 TGCTTTCCTCCCAAGGAGGATGG + Intergenic
934849887 2:97691408-97691430 TCCCCTCCTCCTCAGGAGTGTGG + Intergenic
934892508 2:98083049-98083071 TTCTTCACTCCTCAAGAGGGGGG + Intergenic
939026163 2:137015883-137015905 CCCTTTCCTCGAGAGGAGGGAGG + Intronic
941357851 2:164514778-164514800 TGCTTGCCTCCTCAGTTGGGAGG + Intronic
942332557 2:174842629-174842651 TCCTTTCCTCCCGAGGACGTGGG - Intronic
942846676 2:180434844-180434866 TGCTGTTCTCCACAGGAGGGAGG - Intergenic
944231731 2:197401759-197401781 TCATTTCCTCATCAGGAGACTGG + Exonic
944439401 2:199727129-199727151 TCCATTCCTCCTCACCAGTGGGG - Intergenic
945265701 2:207889320-207889342 TCCTCTCCTCCTCACTAAGGTGG - Intronic
946869941 2:224076070-224076092 TCCTGTCCTCATCAGGAGGGAGG + Intergenic
947843651 2:233226372-233226394 GCCTCTCCTCCTTAGGAAGGTGG + Intronic
948752553 2:240140970-240140992 TCAGCTCCTCCTCACGAGGGAGG - Intronic
1169355942 20:4905345-4905367 TCCTTCTGTCATCAGGAGGGGGG - Intronic
1170856260 20:20058507-20058529 TGCTTTCCTCCTTAGGTGGAGGG - Intronic
1170860873 20:20102363-20102385 TCCCTCACTCCTCAGGTGGGAGG + Intronic
1172886125 20:38232022-38232044 CCCTTTCCTCCCCATGAGGATGG - Intronic
1173639740 20:44592571-44592593 TCCTTTGCACCTCAGCAAGGAGG + Intronic
1174851158 20:53996587-53996609 TCCTACCCTCCTGAGGAGGTCGG - Intronic
1175732656 20:61364523-61364545 TCTGTTCCGCATCAGGAGGGGGG + Intronic
1176717363 21:10364487-10364509 TCCTTTTCACCTCAGGAGGGAGG - Intergenic
1180007089 21:45027851-45027873 TCCTTGCCCCCTGAGGAGAGGGG + Intergenic
1180298587 22:11017407-11017429 TCCTTTTCACCTCAGGAGGGAGG - Intergenic
1180600979 22:17015506-17015528 TCCTTTTCACCTCAGGAGGGAGG + Intergenic
1181423577 22:22818651-22818673 TCCATTCTGGCTCAGGAGGGAGG - Intronic
1181570168 22:23764135-23764157 TGCTTTCTGCCTCAGGTGGGCGG - Exonic
1182432679 22:30309550-30309572 GCCTTTCCTCCTCAGAAGCTGGG - Intronic
1182503395 22:30764781-30764803 TTCTCTCCTCCTCAGGACTGAGG - Intronic
1182551228 22:31101814-31101836 TCCTGTTGTCCTCAGGAGGAAGG - Intronic
1183039275 22:35164368-35164390 TCTTTTCCTCCTCCCAAGGGTGG - Intergenic
1183249624 22:36720901-36720923 TTCTCTCCTCCTCAGGAGGCTGG + Intergenic
1183530731 22:38351965-38351987 TCCCTACCTCCTGAGGCGGGTGG + Intronic
1183828503 22:40405983-40406005 TCCTTTGCTCTTAAGCAGGGAGG + Intronic
1184212213 22:43042831-43042853 TCCATTACTCCTCAGGAGCCAGG + Intronic
1184264316 22:43338947-43338969 TTCTCTCAGCCTCAGGAGGGAGG - Intronic
1184366997 22:44058029-44058051 TCCTTTCCTCCACTGGACAGGGG - Intronic
1184601629 22:45547216-45547238 TGCTTTCCCCCTCAGCAGGCAGG - Intronic
1184908495 22:47509153-47509175 CCCTTTCCTCTGCTGGAGGGAGG - Intergenic
1184981969 22:48101351-48101373 CCCTTTGCTCCTCAGGAGAATGG + Intergenic
1185180032 22:49354587-49354609 TTCCTTCCTCCTCTTGAGGGTGG + Intergenic
950233222 3:11294769-11294791 TTCTTTCCTCCACAGGAAGTGGG + Intronic
950514374 3:13454637-13454659 CCCCTTCCTCCTTAGGAGGCAGG - Intergenic
954569756 3:51630865-51630887 CATTTTCCTCCTCTGGAGGGTGG - Exonic
955956497 3:64295225-64295247 TACTTTACTCCTCAGAAGGTAGG + Intronic
956199353 3:66690348-66690370 TGCTTTCCTCATCAGTAAGGTGG - Intergenic
957018930 3:75101772-75101794 TCCTTTCCTCATGCGGAAGGAGG + Intergenic
961174490 3:124822595-124822617 TCTTTTCCTCCTCATGTTGGCGG - Intronic
963056951 3:141193785-141193807 TCCATTCCTCCTCACCAGGCAGG + Intergenic
963967406 3:151388013-151388035 CCTCTTCCTCCTCAGGAGGCAGG - Exonic
966884866 3:184371706-184371728 TCCTGACCTCCACAGGAGGGAGG + Intronic
967328285 3:188264529-188264551 TCTTTTCCTCTTTAGGAGGTTGG + Intronic
967397529 3:189024222-189024244 TCCATTCCTCCTCACGGGGAAGG - Intronic
968161692 3:196432187-196432209 TCGCCTCTTCCTCAGGAGGGAGG + Intronic
970372512 4:15422423-15422445 TCCTTTGGTCTTCAGGAGGAAGG - Intronic
970643176 4:18090172-18090194 TCCTGTCCTGCCCAGGAGAGTGG + Intergenic
978311075 4:107385546-107385568 TCTATTCCTCCTGAGGAGGATGG - Intergenic
983354685 4:166641271-166641293 TCCTTTCCTCCTCACAATGAGGG + Intergenic
983524418 4:168746236-168746258 TCTTTTCCTCATCAAGAGGAGGG + Intronic
983820928 4:172192936-172192958 TCCATTTCTCCTCAGCAGGTAGG + Intronic
985256518 4:188075711-188075733 TGCTTTCCTCCTGAGGGTGGGGG - Intergenic
985488206 5:163510-163532 TCCCATCCTCCTCAGCAGGGTGG - Exonic
986808481 5:11331321-11331343 TGCTTTCCTCCTCAGTATGAGGG + Intronic
987520097 5:18970710-18970732 TTTTTTCCTCTTCAGGAGAGAGG - Intergenic
988821903 5:34895585-34895607 TCCTTTTCTCCTCATAAGAGGGG + Intronic
988935943 5:36083119-36083141 TCCTTTCCTCCTCACCAGACAGG + Intergenic
989193687 5:38695256-38695278 TCATTTCATTTTCAGGAGGGAGG + Intergenic
989578053 5:43007246-43007268 TCAATTCTTCCCCAGGAGGGAGG + Intergenic
992136528 5:73751656-73751678 TACCTTCCTCCTAAGGAAGGAGG - Intronic
992193384 5:74316203-74316225 TCGTTCCCTCCTCAGCAGTGAGG + Intergenic
992672570 5:79074959-79074981 TACTGTCCTCCTCAGCATGGGGG - Intronic
993613655 5:90084470-90084492 TGCTTTCTTTCTCAGCAGGGAGG + Intergenic
994167768 5:96625982-96626004 TCCCATCCTCCTCAGGAGTCAGG + Intronic
994551316 5:101238866-101238888 TCCATTCCTCCTCACTGGGGAGG - Intergenic
995108897 5:108405904-108405926 TCCTTTCCTCCACTCGAGGGAGG - Intergenic
995479673 5:112581773-112581795 TCCTATCCTCATCAGAAGGGAGG - Intergenic
998737415 5:145158441-145158463 TCCTCACCTCCTCAGGTAGGAGG + Intergenic
1000148837 5:158480226-158480248 TCCAGACCTCCTCAGGAGAGAGG - Intergenic
1000264299 5:159619920-159619942 TCCTCTCCTGCTAAGAAGGGAGG + Intergenic
1002056098 5:176598680-176598702 ACCCTGCCTCCTCAGGAGAGGGG - Exonic
1003152377 6:3563742-3563764 TCTTTCCCTCCTCAGGATGAGGG - Intergenic
1003570797 6:7255148-7255170 TCCTGTCCTCCTCAGGGAGGTGG - Intergenic
1003955808 6:11164103-11164125 TCCTGTCCTCTGCAGGAGGCAGG - Intergenic
1005915448 6:30346762-30346784 GCATTTTCTCCTCAGGAAGGCGG - Exonic
1006452336 6:34112460-34112482 TCTCTCCCACCTCAGGAGGGTGG - Intronic
1007203679 6:40132040-40132062 TCCTAGCCCCTTCAGGAGGGTGG - Intergenic
1010451465 6:76008523-76008545 TCCTTGCCTCCGCAGAAGGAGGG - Intronic
1011424807 6:87214682-87214704 TCCTTTCCCCCTAAGAAGTGAGG - Intronic
1012606348 6:101162580-101162602 TCATTTCCTTCTCAAGTGGGTGG + Intergenic
1013246191 6:108289690-108289712 TCCTTTCCTCCCTAGGGAGGTGG + Intergenic
1015176196 6:130311879-130311901 TTCATTCCCCATCAGGAGGGGGG + Intronic
1015928509 6:138334063-138334085 TCTTTTCCTCTCCAGGAGAGGGG - Exonic
1016891132 6:149007786-149007808 TCCTTTGCTCCTTAGGAGTAGGG - Intronic
1018994214 6:168698986-168699008 TCCTTTCCTCCACAGCTTGGAGG + Intergenic
1019931751 7:4228135-4228157 TCCTGTCCACCTCAGAAGGAAGG - Intronic
1021975105 7:26004321-26004343 CCCTTTCCTCCTCATGAGGTTGG - Intergenic
1022224373 7:28347905-28347927 TCCTCCCCAGCTCAGGAGGGAGG - Intronic
1023340210 7:39211771-39211793 TCCTCTCCTCTGCAGGAGGCAGG + Intronic
1023417852 7:39949736-39949758 TCCGCTCCTCGTCAGGAGGAGGG - Intergenic
1024852999 7:53743697-53743719 TCATTTCCTCGTCCTGAGGGTGG - Intergenic
1028245641 7:88473501-88473523 TCCTTTCCAACTCAGGATGTTGG + Intergenic
1028248853 7:88515700-88515722 TCCTTTGTTCCTCAAGAGGTGGG + Intergenic
1030207527 7:106965507-106965529 GCCCTTCCTCCTCAGGTTGGTGG + Intergenic
1032184519 7:129712713-129712735 TCCTTTCCACCTAAGGAGCCTGG + Intronic
1034535675 7:151724436-151724458 TCCTCCCCTCCTGAGGAAGGGGG + Intronic
1034800239 7:154051786-154051808 TCCTGCCCTCCTCCGGAGAGAGG + Intronic
1038709335 8:29927165-29927187 TCCTTTCCTCCTCTTGCTGGGGG - Intergenic
1040385133 8:46909880-46909902 CCCTGTCCTCCTCAAGAGGAGGG + Intergenic
1040844054 8:51817238-51817260 TCCCTCCCTTCTCAGGAGGAGGG - Intergenic
1041756857 8:61323390-61323412 TCCATTCCACCTCTTGAGGGAGG + Intronic
1042773657 8:72405583-72405605 TCCATTCCTCCTCACTAGGCAGG + Intergenic
1045047645 8:98294323-98294345 TCCTCTCCTCCTCCGGTGCGAGG + Exonic
1045363616 8:101455181-101455203 CCCTTTCCCCCTCAGGTGAGAGG + Intergenic
1045476208 8:102555102-102555124 TCTTTTCCTCCCCAAGAGGCAGG + Intronic
1046092906 8:109524497-109524519 TGCTCACCTCCTCATGAGGGTGG + Intronic
1047348718 8:124053239-124053261 TGCTGTCAACCTCAGGAGGGAGG - Intronic
1047394252 8:124480013-124480035 TCCTATCTTACTCAGGAGGCTGG + Intronic
1048364925 8:133730247-133730269 TCCATTCCTGCGGAGGAGGGTGG + Intergenic
1048993728 8:139776095-139776117 TCCTCTTGTCCTCAGGAAGGAGG - Intronic
1050290019 9:4144199-4144221 TTCTTTCCTCCTTTGGACGGAGG - Intronic
1052734232 9:32323645-32323667 TCATTTCCTCTTCTGCAGGGTGG - Intergenic
1053455920 9:38233111-38233133 TGCCATCCTCCTCAGGAGGTTGG + Intergenic
1055257146 9:74384945-74384967 TCCTTTTCTCTACTGGAGGGAGG + Intergenic
1055479058 9:76692069-76692091 TCCTCTCATCCTCAGAAGGTAGG - Intronic
1056211440 9:84368689-84368711 TCCTTCTCTCCTCAAGAGGAAGG + Intergenic
1056256328 9:84803132-84803154 GCCTCTCCTCCACAGCAGGGTGG - Intronic
1056483823 9:87034311-87034333 TCCTTTCCTTATTAGGAGGCAGG + Intergenic
1056657791 9:88523242-88523264 TCCCTCCCTCCCCAGGAAGGTGG - Intergenic
1057949551 9:99359012-99359034 TTCTTGCCTGCTCAGCAGGGCGG - Intergenic
1058529489 9:105891471-105891493 TCCTTTCCTCCTCTGTAGAATGG - Intergenic
1059508846 9:114825182-114825204 TCTTTTCCTGTTCAGGAGGCTGG + Intergenic
1061001445 9:127905091-127905113 TCCTTTGCCCCTCAGCAGAGTGG - Intronic
1061920799 9:133781325-133781347 TCCTTGCCTCCTCTGGTGGTAGG - Intronic
1061946182 9:133909239-133909261 TCATTGCCTCCTCAGAAGGGGGG + Intronic
1187472111 X:19578857-19578879 TCCTTTGCTCCTCAGATGGAGGG + Intronic
1188006694 X:25020764-25020786 TCCTCTCCTCCGCCGGACGGCGG + Intergenic
1188684238 X:33049636-33049658 TCCTTTTGTTCTCTGGAGGGAGG - Intronic
1189284705 X:39843442-39843464 TCCTTTTCTCCCCAGTGGGGCGG - Intergenic
1190656092 X:52613312-52613334 TCTTTTCCTCCTAGGGAGAGTGG - Intergenic
1192433407 X:71127525-71127547 TCCTCTCCTCCTGAGTTGGGTGG - Intronic
1193078604 X:77382393-77382415 TTCTTTCCACCTGAGGAGAGGGG + Intergenic
1193478410 X:81996286-81996308 TCCATTCCTCCTCACCAGGCGGG + Intergenic
1193805140 X:85985595-85985617 CCCATTCCTCCTCATGAGGCAGG + Intronic
1194635698 X:96342963-96342985 TCCATTCCTCCTCACTAGGCAGG - Intergenic
1196932559 X:120696080-120696102 TCCCTTCCTCCTCACGGGGTGGG + Intergenic
1197083485 X:122446208-122446230 TGCTTTCTTTCTCAGCAGGGAGG + Intergenic
1199204603 X:145134152-145134174 TTCTTTCCTCCTCAGGGGCTGGG + Intergenic
1199998100 X:153039516-153039538 TCCTACCCTCCCCAGGAGGGAGG - Intergenic