ID: 1095979521

View in Genome Browser
Species Human (GRCh38)
Location 12:47963521-47963543
Sequence TGCGCTCTTCGCGGCTCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 29}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095979521_1095979524 6 Left 1095979521 12:47963521-47963543 CCTCCGGAGCCGCGAAGAGCGCA 0: 1
1: 0
2: 0
3: 5
4: 29
Right 1095979524 12:47963550-47963572 AGCGCGCGCCCGCGTTCTCCTGG 0: 1
1: 0
2: 2
3: 2
4: 52
1095979521_1095979529 15 Left 1095979521 12:47963521-47963543 CCTCCGGAGCCGCGAAGAGCGCA 0: 1
1: 0
2: 0
3: 5
4: 29
Right 1095979529 12:47963559-47963581 CCGCGTTCTCCTGGCGGGCTTGG 0: 1
1: 0
2: 1
3: 5
4: 85
1095979521_1095979526 10 Left 1095979521 12:47963521-47963543 CCTCCGGAGCCGCGAAGAGCGCA 0: 1
1: 0
2: 0
3: 5
4: 29
Right 1095979526 12:47963554-47963576 CGCGCCCGCGTTCTCCTGGCGGG 0: 1
1: 0
2: 0
3: 4
4: 70
1095979521_1095979525 9 Left 1095979521 12:47963521-47963543 CCTCCGGAGCCGCGAAGAGCGCA 0: 1
1: 0
2: 0
3: 5
4: 29
Right 1095979525 12:47963553-47963575 GCGCGCCCGCGTTCTCCTGGCGG 0: 1
1: 0
2: 1
3: 10
4: 55
1095979521_1095979530 22 Left 1095979521 12:47963521-47963543 CCTCCGGAGCCGCGAAGAGCGCA 0: 1
1: 0
2: 0
3: 5
4: 29
Right 1095979530 12:47963566-47963588 CTCCTGGCGGGCTTGGTATTTGG 0: 1
1: 0
2: 0
3: 9
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095979521 Original CRISPR TGCGCTCTTCGCGGCTCCGG AGG (reversed) Intergenic
900117326 1:1034200-1034222 TCCGGCCTGCGCGGCTCCGGGGG + Intronic
900255253 1:1694529-1694551 TGCGCTCTGACCGGCTCCCGGGG - Intronic
902245462 1:15117775-15117797 TCTGCTTTTCGAGGCTCCGGAGG + Exonic
903750248 1:25616943-25616965 TGCGCGCTCCGCGGAGCCGGCGG + Intergenic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
1066126506 10:32347328-32347350 CCCGCCCTTCGCGGGTCCGGGGG + Intronic
1084193289 11:67508625-67508647 TGCGCGCTTCTCCGCTCTGGGGG + Exonic
1089262778 11:117233406-117233428 TGCGCTCTTCAGTGTTCCGGGGG + Intronic
1090189845 11:124760545-124760567 TCCGCTCTTCTGGGCTCTGGAGG - Intronic
1095979521 12:47963521-47963543 TGCGCTCTTCGCGGCTCCGGAGG - Intergenic
1104376313 12:128267523-128267545 TGCGAACTTCCCGGTTCCGGGGG + Intronic
1104727660 12:131087796-131087818 TGGGCCCTTCGCGGCTGGGGAGG + Intronic
1117722176 14:58638413-58638435 GGCGCCCTGCGCGGCGCCGGGGG + Exonic
1118849326 14:69572389-69572411 CGCGCTCTTCGCGGCCACGGCGG + Exonic
1133760904 16:8797652-8797674 TGCGCTCTTAGGGGTTCCGGGGG - Intronic
1142657781 17:1405556-1405578 TGCGCTTTTCACGGCTGCTGCGG + Intergenic
1147424803 17:40341511-40341533 GCCGCTCTCCGCGTCTCCGGGGG + Intronic
1148549705 17:48543288-48543310 TGCGCGCTGCGCGGGGCCGGCGG - Exonic
1150137631 17:62704296-62704318 AGCGCCCTTCCCGGCTGCGGAGG + Intronic
1163509693 19:17727313-17727335 TGCCCTCTGCGGGGCTCCGGTGG - Exonic
1163709997 19:18840671-18840693 AGTGCTGTTCGGGGCTCCGGAGG + Intronic
937046688 2:118855552-118855574 TGTGCTCTCCGCGGAGCCGGCGG + Intergenic
947712877 2:232325945-232325967 TGCGCCCTTCGGGGCTCCCGTGG + Intronic
1178728576 21:35078330-35078352 TTCCCTCTTCCAGGCTCCGGTGG + Intronic
1179453428 21:41480977-41480999 CGCGCTCTCCACGGCTCCGGAGG + Intronic
1179661529 21:42879094-42879116 TCCGGTCTCCGCGGCGCCGGCGG - Intronic
1180077159 21:45468738-45468760 CGGGCTCTTCGTGGCTCAGGCGG + Exonic
1180921527 22:19523955-19523977 TGCGCTCTTCGTGACCCTGGCGG - Exonic
1182985773 22:34714767-34714789 TGCTCCCTTCGAGGCTCCAGGGG - Intergenic
972312099 4:37891218-37891240 TGCGCTCTTCCCGCCGCGGGGGG - Exonic
981494427 4:145375592-145375614 TGCGGACGTCTCGGCTCCGGAGG - Intergenic
1002355598 5:178626711-178626733 CGCTCGCGTCGCGGCTCCGGAGG - Intronic
1050182240 9:2934049-2934071 TGCGCTCTTGGGGGCCCAGGAGG + Intergenic
1056848050 9:90057517-90057539 TGCTCTCTTCTCTGCTCCAGAGG + Intergenic
1061713757 9:132505700-132505722 TGCGCTCTGCCTGGCTCCTGGGG + Intronic