ID: 1095982186

View in Genome Browser
Species Human (GRCh38)
Location 12:47979989-47980011
Sequence GTGTCAGAGGCCTCACTCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 122}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095982173_1095982186 27 Left 1095982173 12:47979939-47979961 CCGCCATGGGAGCCTCTGGGGCC 0: 1
1: 0
2: 1
3: 44
4: 415
Right 1095982186 12:47979989-47980011 GTGTCAGAGGCCTCACTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 122
1095982176_1095982186 15 Left 1095982176 12:47979951-47979973 CCTCTGGGGCCAGGCCTCTTTGT 0: 1
1: 0
2: 1
3: 28
4: 334
Right 1095982186 12:47979989-47980011 GTGTCAGAGGCCTCACTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 122
1095982170_1095982186 29 Left 1095982170 12:47979937-47979959 CCCCGCCATGGGAGCCTCTGGGG 0: 1
1: 0
2: 2
3: 17
4: 215
Right 1095982186 12:47979989-47980011 GTGTCAGAGGCCTCACTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 122
1095982174_1095982186 24 Left 1095982174 12:47979942-47979964 CCATGGGAGCCTCTGGGGCCAGG 0: 1
1: 0
2: 5
3: 46
4: 513
Right 1095982186 12:47979989-47980011 GTGTCAGAGGCCTCACTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 122
1095982178_1095982186 6 Left 1095982178 12:47979960-47979982 CCAGGCCTCTTTGTGAGGTGCAG 0: 1
1: 0
2: 0
3: 17
4: 176
Right 1095982186 12:47979989-47980011 GTGTCAGAGGCCTCACTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 122
1095982172_1095982186 28 Left 1095982172 12:47979938-47979960 CCCGCCATGGGAGCCTCTGGGGC 0: 1
1: 0
2: 2
3: 39
4: 321
Right 1095982186 12:47979989-47980011 GTGTCAGAGGCCTCACTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 122
1095982168_1095982186 30 Left 1095982168 12:47979936-47979958 CCCCCGCCATGGGAGCCTCTGGG 0: 1
1: 0
2: 4
3: 18
4: 270
Right 1095982186 12:47979989-47980011 GTGTCAGAGGCCTCACTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 122
1095982181_1095982186 1 Left 1095982181 12:47979965-47979987 CCTCTTTGTGAGGTGCAGGGTGG 0: 1
1: 0
2: 0
3: 20
4: 232
Right 1095982186 12:47979989-47980011 GTGTCAGAGGCCTCACTCACCGG 0: 1
1: 0
2: 1
3: 19
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095982186 Original CRISPR GTGTCAGAGGCCTCACTCAC CGG Exonic
900471367 1:2856636-2856658 CAGTCAGAGGCCTCACGCAGAGG + Intergenic
900552370 1:3263288-3263310 TTGTCAAAGGCCTCACCCCCAGG + Intronic
902748502 1:18489839-18489861 TGGTCAGTGGCCTCACTCACAGG - Intergenic
903791568 1:25896765-25896787 CTGGCAGAGGCCTCAGCCACAGG + Intronic
905249529 1:36638979-36639001 GTGTCAGAGGCCTCTCTGTCGGG - Intergenic
905913532 1:41670025-41670047 CTAGCAGAGGCCTCACTCCCTGG + Intronic
906228107 1:44138644-44138666 GTTTCTGGGCCCTCACTCACCGG + Intergenic
909036951 1:70604336-70604358 GAATCAGAGGCTTCACTCACGGG - Intergenic
910719562 1:90271395-90271417 TTGTCACAGGCCTCACTCTTTGG - Intergenic
912442964 1:109712824-109712846 AGGCCAGAGGGCTCACTCACGGG - Intronic
912545751 1:110450240-110450262 GGGTCAGGGGCTTCCCTCACAGG + Intergenic
914770541 1:150680463-150680485 GTTTCAGCGGCCTCACACATAGG - Intronic
915646133 1:157273946-157273968 GTATCAGAGCCCTCACCCATGGG - Intergenic
915994770 1:160551203-160551225 TTGGCTGAGGCCTCACCCACAGG + Intronic
916304931 1:163319649-163319671 GGGTCAGAGGCATCAGACACAGG + Intronic
916954798 1:169820665-169820687 GGGTTAGAGGCCTAACTTACGGG - Intronic
917122553 1:171656844-171656866 CTGTCATAGCCCTCACACACAGG - Intergenic
917617572 1:176761707-176761729 ATCTCAGAGCCCTCACTCTCAGG - Intronic
920515494 1:206581981-206582003 GTGTCAGAGTCATCCCTCACTGG + Intronic
920543639 1:206797962-206797984 GTGGCAGAGCCGTGACTCACAGG + Intergenic
921660149 1:217791837-217791859 GGGTCAGAGGCCAGAGTCACTGG + Intronic
922375269 1:224957621-224957643 GTGTCACAGGACTCACCCAAAGG + Intronic
922802043 1:228368869-228368891 ATGTCGGAGGCTTCGCTCACAGG - Exonic
1063543393 10:6957017-6957039 CTGCCAGAGTCATCACTCACTGG + Intergenic
1071428390 10:85582572-85582594 GCTTCAGAGGCTTCACTCACTGG + Intergenic
1073306362 10:102505744-102505766 GTGTCGCAGTCCTCTCTCACTGG + Intronic
1073377073 10:103044841-103044863 GTGTAAGAAGCCTAATTCACAGG + Intronic
1076473551 10:130736675-130736697 GTGTCTGAGGACACACTCCCTGG + Intergenic
1077430247 11:2512683-2512705 GTGTCTGGGGCCACACTCTCTGG + Intronic
1077859239 11:6160397-6160419 GTGTCAGAGGCCCTACTTAGGGG - Intergenic
1080319578 11:30991057-30991079 TTGTCAGTTGCCTCACTCTCTGG - Intronic
1082053387 11:47791910-47791932 GTGTGAGACTCCTGACTCACTGG + Exonic
1083534030 11:63452633-63452655 GTCTCAGAGGCCTGACATACAGG - Intergenic
1095735544 12:45552755-45552777 GTGTCAGAGAGCTTACTCACTGG + Intergenic
1095982186 12:47979989-47980011 GTGTCAGAGGCCTCACTCACCGG + Exonic
1096156813 12:49345658-49345680 AGGGCAGAAGCCTCACTCACGGG + Intergenic
1099854142 12:88142413-88142435 GTTTCAGTGGCGTCACTCGCTGG + Exonic
1103360979 12:120353399-120353421 GTGTCAGATGGCTCATCCACAGG + Intronic
1104902197 12:132195473-132195495 GGGTCAGCGTCCTCACTCCCTGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107735762 13:43397057-43397079 GTGCCGCAGGCCTCACCCACCGG - Intronic
1112345307 13:98584436-98584458 CTGTCAGATGCCACACTGACGGG - Intergenic
1115972234 14:38958474-38958496 GAGTTCCAGGCCTCACTCACTGG - Intergenic
1117251008 14:53937479-53937501 GTAACAGAGGCCTAACTCAGTGG - Intergenic
1119201188 14:72754059-72754081 GTGTCAAAGGCCACACACACAGG - Intronic
1119465551 14:74855358-74855380 GTGCCAGAGCCCTCACTAGCGGG + Intronic
1124155703 15:27223780-27223802 GGGTCAGGGGCAGCACTCACTGG - Intronic
1127601703 15:60544014-60544036 GGGAGAGAGGCCTCACACACTGG + Intronic
1128155438 15:65388934-65388956 GTGTCAGGGGGCTCAGTCGCAGG + Exonic
1128247956 15:66145703-66145725 GAGCCAGATGCCTCCCTCACAGG - Intronic
1134397630 16:13879647-13879669 GTGTCAGTCACCTCACTCCCAGG - Intergenic
1138353865 16:56362410-56362432 GTGCCAGAGGCCAGACCCACGGG - Exonic
1138499226 16:57428680-57428702 GCACCAGAGGACTCACTCACTGG - Exonic
1139050198 16:63115542-63115564 GTCTCAGGTGCCTCATTCACAGG + Intergenic
1142123332 16:88397923-88397945 GTGTCAGGGGCCTGGCTCTCAGG + Intergenic
1145067039 17:19768652-19768674 GGGTGAGACGCCTCACTCCCTGG - Intergenic
1146658471 17:34649172-34649194 GGGGCAGAGGCTTCACTCACAGG + Intergenic
1147160910 17:38569022-38569044 GTGCCAGGAACCTCACTCACTGG + Intronic
1151974684 17:77477737-77477759 GAGTCAGAGGCCTCAGGCTCTGG - Intronic
1155513528 18:26600812-26600834 GCACCAGAGGACTCACTCACTGG + Intronic
1160173027 18:76570133-76570155 GAGTTACAGGCCTCACTCTCAGG + Intergenic
1160540576 18:79617984-79618006 ATGTCAGAGGCCGCAGGCACCGG - Intergenic
1161767306 19:6214738-6214760 TTGTCAGGGGCCCCTCTCACTGG - Intronic
1163726623 19:18926651-18926673 ATGTCAGAGGCCCCATTGACAGG + Intronic
1165989716 19:39803210-39803232 GAGACAGAGGCCTGACTCAGCGG + Intergenic
1166384833 19:42375245-42375267 GTGCCAGAGGCCTCAGTATCAGG + Intronic
1167385477 19:49160656-49160678 GTGTCAGAGGCCACCCTAAGGGG + Intronic
1167752545 19:51389378-51389400 GTGACAGAGGCCACGCTCTCCGG + Exonic
1168425991 19:56239440-56239462 GTTTGAGAGGCCTCAGTCAGGGG + Intronic
925901418 2:8511821-8511843 GTCTCAAAGGCTGCACTCACAGG + Intergenic
928162507 2:28940931-28940953 GTTTCAGAGGACTCATTAACAGG + Intronic
937467947 2:122151430-122151452 GTGTCAGTGGCCTCCTTCTCCGG - Intergenic
938120068 2:128626938-128626960 GTGTCACAGGCCTGACTCAAGGG + Intergenic
938778294 2:134560908-134560930 CTCTCAGAGGTCTCACACACAGG + Intronic
938930989 2:136086867-136086889 GTGTCAGTGGCATCCCTCACTGG + Intergenic
940337758 2:152546692-152546714 GTGTCAGAGTCCTAAGTCTCGGG - Intronic
940837380 2:158538204-158538226 GGGTCAGAATGCTCACTCACAGG + Intronic
945892901 2:215449089-215449111 GTGTCAGAGGCTTTTCTCAAAGG - Intergenic
948346891 2:237306232-237306254 GTATCACAGGTCCCACTCACAGG + Intergenic
1168844348 20:933507-933529 GAGTCAGAGGCCCAACTCACAGG - Intergenic
1169046501 20:2537858-2537880 GGGGCAGAAGCCACACTCACAGG + Intronic
1169522154 20:6385737-6385759 CTGGCAGTGGCCTCATTCACAGG - Intergenic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170410351 20:16082424-16082446 GTGTCAGAGGGCTGCCTCACTGG - Intergenic
1173183384 20:40821057-40821079 GTTTCAGAGGTCTCCCTAACTGG + Intergenic
1173620987 20:44435823-44435845 ATCTCAGAGGCCTGAATCACAGG + Intergenic
1174060842 20:47831857-47831879 GGATCAGAGGCCGCACTCACCGG + Intergenic
1174071056 20:47899513-47899535 GGATCAGAGGCCGCACTCACCGG - Intergenic
1174404865 20:50296507-50296529 GGGTCAGAGGCCTCACTGGAAGG + Intergenic
1175330996 20:58163785-58163807 GCCTCAGAGGCCTTCCTCACTGG - Intergenic
1175954190 20:62599886-62599908 GTGTCTGACGCCTCATTCCCTGG + Intergenic
1178517709 21:33262988-33263010 GTGGCAGAGGCCTGACCCAGAGG - Exonic
1181309527 22:21937147-21937169 GTGTCACAGGCCACACCCAAAGG + Intronic
1183230774 22:36580544-36580566 GTGACACAGGCCACACACACAGG - Intronic
1184721666 22:46318099-46318121 GGGCCAGTGGCCTCACTGACTGG - Intronic
1185200894 22:49504133-49504155 GGGCCAGAGCCCTCACTCGCTGG + Intronic
951651998 3:24960963-24960985 CTGTCACAGGCCCCTCTCACAGG - Intergenic
952844414 3:37674989-37675011 CAGTGACAGGCCTCACTCACTGG + Intronic
953739587 3:45525918-45525940 GTGTCAGATGCCTCTTTCATAGG + Intronic
953747061 3:45583229-45583251 CTGGCAGAGGCCACACACACAGG + Intronic
955422260 3:58750535-58750557 GTGCCTGAGGGCTCATTCACAGG - Intronic
958128065 3:89382914-89382936 GCATCTGAGGCCTCACTGACTGG - Intronic
970512986 4:16799387-16799409 GGGCCAGAGGAGTCACTCACGGG + Intronic
971793635 4:31199516-31199538 GGGTCAGAGGCCCCACACAGAGG - Intergenic
972163606 4:36255685-36255707 GCTTCAAAGGCCTAACTCACAGG + Intergenic
981392732 4:144210832-144210854 CTGCAAGAGGCCTCAGTCACTGG + Intergenic
987382397 5:17297740-17297762 GACTCAGAGGGTTCACTCACTGG + Intergenic
990879126 5:60520393-60520415 ATGTCAGAAGTCTCACTCCCAGG - Intronic
997233446 5:132259254-132259276 CTGTCAGCGGCCTCACGCCCAGG - Intronic
997460268 5:134047160-134047182 GTATCAAAGGCTTCATTCACTGG - Intergenic
999085429 5:148884561-148884583 GTCTCAGAGCCCTCACTCAATGG + Intergenic
1004202213 6:13559453-13559475 GTGCCAAAAACCTCACTCACAGG + Intergenic
1005968150 6:30742082-30742104 GGGGCAGAGGCCAGACTCACAGG + Intronic
1007861102 6:44909721-44909743 GTGTCAGAGCCCTTACCTACAGG - Intronic
1008586807 6:52958155-52958177 GGGACAGAGCCCTCACTCTCTGG - Intergenic
1010655283 6:78504558-78504580 GCTTCAGAGACATCACTCACAGG + Intergenic
1012520597 6:100116651-100116673 GTGTCAGATGCCACAGGCACTGG - Intergenic
1014429752 6:121354062-121354084 GAGTCAAATGCCTAACTCACAGG + Intergenic
1021412294 7:20342223-20342245 GTGACAGAGGACCCACTAACTGG + Intronic
1024838593 7:53556089-53556111 GTGTGAGAGGCCTTACTCACTGG + Intergenic
1025172373 7:56771175-56771197 ATGTCCGTGGCCTCACTCATGGG - Intergenic
1026975550 7:74495602-74495624 GTGTCAGAGCCCCCATGCACTGG - Intronic
1030107457 7:105999048-105999070 GGGCCAGTGGCCACACTCACAGG - Intronic
1034950402 7:155292866-155292888 GTGTGAGTGGCCTGAGTCACGGG - Intergenic
1038693015 8:29780357-29780379 GTGTCAGAGGCTTTAGTCCCTGG - Intergenic
1041132164 8:54712435-54712457 GTGTGAGAAGCCACACTCAAGGG - Intergenic
1041501416 8:58542717-58542739 GTGCCAGTGGCCTCACTCCAGGG + Intergenic
1049342615 8:142121234-142121256 GCGTCAGGGGCCTGACTCCCAGG + Intergenic
1049561867 8:143316141-143316163 CTGTCAGAGGCAGCACCCACGGG + Intronic
1049606718 8:143533008-143533030 GCGTCAGTGGCCTCACGCACAGG + Intronic
1052501578 9:29298602-29298624 GTTTCTGTGGCCTCACTCACAGG + Intergenic
1053489564 9:38488653-38488675 CTGGCTGAGGCCTCCCTCACAGG + Intergenic
1055978508 9:81977149-81977171 GTTTCCGAGGCCTCACGCGCTGG - Intergenic
1056300520 9:85235650-85235672 GTTGCAGAGGCATCAATCACTGG + Intergenic
1057695340 9:97318949-97318971 GTGTCAGAGGCATCTGACACTGG + Intronic
1057966971 9:99513704-99513726 GTGTCAGAGGCTGCAGCCACCGG - Intergenic
1061909715 9:133716198-133716220 GTGTCAGAGCACCCACCCACGGG + Intronic
1190689746 X:52903568-52903590 GTGTCAGATGCCTCTGTCACAGG + Intronic
1190696237 X:52952224-52952246 GTGTCAGATGCCTCTGTCACAGG - Intronic
1194253957 X:91613569-91613591 GGGTCAGAGCCCCCACACACTGG - Intergenic
1197961754 X:132014113-132014135 GGGTTAGAGGCCACACTCTCTGG + Intergenic
1200572741 Y:4853146-4853168 GGGTCAGAGTCCCCACACACTGG - Intergenic
1201492609 Y:14558786-14558808 GTGTCACAGGCCTAGGTCACTGG - Intronic