ID: 1095982729

View in Genome Browser
Species Human (GRCh38)
Location 12:47982215-47982237
Sequence TTGCTCAGTCCCACCCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 745
Summary {0: 1, 1: 2, 2: 25, 3: 121, 4: 596}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095982721_1095982729 -5 Left 1095982721 12:47982197-47982219 CCCCAGGACCCCCATGGTTTGCT 0: 1
1: 0
2: 1
3: 10
4: 144
Right 1095982729 12:47982215-47982237 TTGCTCAGTCCCACCCAGGCTGG 0: 1
1: 2
2: 25
3: 121
4: 596
1095982719_1095982729 2 Left 1095982719 12:47982190-47982212 CCAGGCACCCCAGGACCCCCATG 0: 1
1: 0
2: 1
3: 50
4: 443
Right 1095982729 12:47982215-47982237 TTGCTCAGTCCCACCCAGGCTGG 0: 1
1: 2
2: 25
3: 121
4: 596
1095982722_1095982729 -6 Left 1095982722 12:47982198-47982220 CCCAGGACCCCCATGGTTTGCTC 0: 1
1: 0
2: 0
3: 9
4: 134
Right 1095982729 12:47982215-47982237 TTGCTCAGTCCCACCCAGGCTGG 0: 1
1: 2
2: 25
3: 121
4: 596
1095982723_1095982729 -7 Left 1095982723 12:47982199-47982221 CCAGGACCCCCATGGTTTGCTCA 0: 1
1: 0
2: 1
3: 20
4: 126
Right 1095982729 12:47982215-47982237 TTGCTCAGTCCCACCCAGGCTGG 0: 1
1: 2
2: 25
3: 121
4: 596
1095982716_1095982729 11 Left 1095982716 12:47982181-47982203 CCGCCTCAGCCAGGCACCCCAGG 0: 1
1: 0
2: 3
3: 59
4: 543
Right 1095982729 12:47982215-47982237 TTGCTCAGTCCCACCCAGGCTGG 0: 1
1: 2
2: 25
3: 121
4: 596
1095982715_1095982729 15 Left 1095982715 12:47982177-47982199 CCAGCCGCCTCAGCCAGGCACCC 0: 1
1: 0
2: 2
3: 39
4: 473
Right 1095982729 12:47982215-47982237 TTGCTCAGTCCCACCCAGGCTGG 0: 1
1: 2
2: 25
3: 121
4: 596
1095982718_1095982729 8 Left 1095982718 12:47982184-47982206 CCTCAGCCAGGCACCCCAGGACC 0: 1
1: 0
2: 0
3: 50
4: 547
Right 1095982729 12:47982215-47982237 TTGCTCAGTCCCACCCAGGCTGG 0: 1
1: 2
2: 25
3: 121
4: 596

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095982729 Original CRISPR TTGCTCAGTCCCACCCAGGC TGG Intronic
900206713 1:1434791-1434813 TGGCCCAGCCCCACCCAAGCAGG + Intergenic
900518322 1:3093777-3093799 TTGCTCAGCCACAGCCAGGTGGG - Intronic
900611450 1:3546277-3546299 TAGCTCAGCCCCACCATGGCTGG - Intronic
901010033 1:6195413-6195435 TTGCTCTTTGTCACCCAGGCTGG - Intronic
901340904 1:8498326-8498348 TCGCTCTGTCTCTCCCAGGCTGG - Intronic
901349431 1:8579970-8579992 TTGCTCTCTCTCTCCCAGGCTGG - Intronic
901488697 1:9584427-9584449 TCGCTCTGTCTCTCCCAGGCTGG + Exonic
901574882 1:10192856-10192878 TTGCTCTGTCTCACCCAGGCTGG + Intergenic
901604613 1:10449426-10449448 GGGCTCTGGCCCACCCAGGCTGG - Intronic
902040501 1:13489019-13489041 TTACTCAGCCCCACTCAGCCCGG - Intronic
902221148 1:14966699-14966721 TTGCTCTGTCTCACCCAGACTGG + Intronic
902256848 1:15194952-15194974 TTGCTGTGTGTCACCCAGGCTGG + Intronic
902562848 1:17288670-17288692 TTGCTCTGTCTCACCCAAGCTGG - Intergenic
902565960 1:17311552-17311574 TCGCTCTGTCCAGCCCAGGCTGG + Intronic
902683276 1:18058763-18058785 TAGCTCAGCCCAACCCAGCCCGG + Intergenic
902730803 1:18367635-18367657 TGGCTCTGTCACACCCAGGCTGG + Intronic
903427248 1:23263149-23263171 TTGCTCTGTCACCCCAAGGCTGG - Intergenic
903741453 1:25560831-25560853 CTGCTCAGGCCTGCCCAGGCGGG - Intronic
903806557 1:26009833-26009855 TGGCTCTGTCTCACCCAGGCTGG - Intergenic
904531730 1:31174354-31174376 TCGCCCTGTCACACCCAGGCTGG - Intergenic
904631338 1:31844613-31844635 TTGCTCTGTCTCTCCCAGGCTGG - Intergenic
904646751 1:31973392-31973414 TCTCTCTGTACCACCCAGGCTGG - Intergenic
905048498 1:35028284-35028306 TTGCTCTGTCACTCCCAGGCTGG - Intronic
905055122 1:35087020-35087042 TTGCTCTGTCGTACCCAGGCTGG + Intronic
905373907 1:37504911-37504933 TTGCTGTGTCACGCCCAGGCTGG + Intronic
905398124 1:37680662-37680684 AGTCTCACTCCCACCCAGGCTGG - Intergenic
906353279 1:45081610-45081632 GTGCTCAATGGCACCCAGGCTGG + Intronic
906547872 1:46634583-46634605 TTGCTCTGTCTTGCCCAGGCTGG - Exonic
906678575 1:47709933-47709955 ATGCTCAGCCCCACCCCGCCCGG - Intergenic
907105075 1:51875586-51875608 TGTCTCACTGCCACCCAGGCTGG + Intronic
907185850 1:52608459-52608481 TTGGTCAGCCCCACACAGGTGGG - Exonic
907389754 1:54150563-54150585 TCACTCTGTCTCACCCAGGCTGG - Intronic
907435064 1:54440350-54440372 TTCCTCACACCCACCCAGGAGGG + Intergenic
907495929 1:54844682-54844704 TTGCTGTGTCCAGCCCAGGCTGG + Intergenic
907496517 1:54848806-54848828 TTGCTCTGTGTCACCCCGGCTGG + Intergenic
907762297 1:57373155-57373177 TTGTTCTGTCACACCCAAGCTGG - Intronic
908228997 1:62085320-62085342 TTGCTCTCTGTCACCCAGGCTGG - Intronic
908970415 1:69822155-69822177 TTTCTCAGTCCCACAAAGCCAGG + Intronic
909089406 1:71206739-71206761 TTTCTCTCTGCCACCCAGGCTGG - Intergenic
911202195 1:95056613-95056635 TGTCTCACTCTCACCCAGGCTGG - Intronic
911778635 1:101846873-101846895 GTGTTCAGTCCCACCAAGGATGG + Intronic
912713305 1:111964762-111964784 TTGCTTAGTCCCTCCCTGGTGGG - Intronic
912781174 1:112549361-112549383 ATTCTCACTCTCACCCAGGCTGG - Intronic
912922858 1:113885876-113885898 TCACTCTGTCACACCCAGGCTGG - Intronic
913151113 1:116045071-116045093 TTGCTCTGTCATGCCCAGGCTGG + Intronic
913548222 1:119891126-119891148 GTTCTCACTCTCACCCAGGCTGG - Intergenic
913579970 1:120216600-120216622 TTGCTCACTGTCACCCAGGCTGG + Intergenic
913628205 1:120681792-120681814 TTGCTCACTGTCACCCAGGCTGG - Intergenic
914561900 1:148828032-148828054 TTGCTCACTGTCACCCAGGCTGG + Intronic
914610930 1:149302181-149302203 TTGCTCACTGTCACCCAGGCTGG - Intergenic
914750627 1:150532582-150532604 ATTCTCTGTCCCACCAAGGCGGG - Intergenic
914797104 1:150929406-150929428 TTGCTCTGTCTCACCCAGGCTGG + Intronic
914818107 1:151078238-151078260 TCACTCTGTCTCACCCAGGCTGG - Intronic
915255315 1:154623971-154623993 TTGCTCTGTCGCCCCCAGGCTGG - Intronic
916093994 1:161332002-161332024 TTTCACTGTGCCACCCAGGCTGG + Intronic
916751340 1:167725309-167725331 TTGCTCTGTCTCGCCCAGGCTGG + Intronic
917324650 1:173819557-173819579 TTGCTCTGTCTCACCCAGGCTGG - Intronic
918117005 1:181506374-181506396 CTGCTCACTCCCACCCTTGCAGG - Intronic
918514541 1:185348440-185348462 TTGCTCTCTGTCACCCAGGCTGG + Intergenic
919106562 1:193159398-193159420 TTTCACTGTCTCACCCAGGCTGG + Intronic
919388204 1:196948303-196948325 TTGCTCTGTCGCCCCCAGGATGG + Intronic
920039226 1:203085102-203085124 CTGCTCAGCCACACCCAGGATGG + Intronic
920148326 1:203882358-203882380 TTGCTCTGTTGCCCCCAGGCTGG - Intergenic
920451403 1:206063691-206063713 GTGCTCAGTGGCGCCCAGGCTGG + Intronic
920912234 1:210229764-210229786 TTGCTCTGTTGCACCCAGGCTGG + Intergenic
921043809 1:211460026-211460048 GTGCTCAGTGGCGCCCAGGCTGG + Intergenic
921347066 1:214197117-214197139 TCGCTCTGTCTCACCCAGGCTGG - Intergenic
921389920 1:214606825-214606847 GTGCCCAGTCCCAACCACGCGGG + Intronic
922183294 1:223253059-223253081 TCACTCTGTCTCACCCAGGCTGG - Intronic
923575197 1:235152001-235152023 TCGCTGTGTCTCACCCAGGCTGG - Intronic
923873077 1:238017146-238017168 TCTCTCTGTCTCACCCAGGCTGG - Intergenic
924220928 1:241874361-241874383 TTGCACTGTCTCACCCTGGCTGG - Intronic
924229719 1:241953341-241953363 TTACCCAGTGTCACCCAGGCCGG - Intergenic
924383264 1:243482527-243482549 GTCCCCAGTCCTACCCAGGCAGG + Intronic
924506771 1:244693459-244693481 TTGCTCTTTGTCACCCAGGCTGG + Intronic
924514069 1:244751701-244751723 GTGCTCAGCCCCAGCAAGGCGGG + Intergenic
924878942 1:248136981-248137003 TTCCTCAGTCCCACCCAGCACGG + Intergenic
1063176238 10:3553116-3553138 TTGCTCAGGCCCACCCTGCTGGG + Intergenic
1063845881 10:10126475-10126497 TTGCTCCATCTCACCCAGGCTGG + Intergenic
1064309544 10:14200321-14200343 TCACTCTGTCACACCCAGGCTGG + Intronic
1064575704 10:16744098-16744120 TTGCTCTGTGTCACCCAGACTGG - Intronic
1064656173 10:17558283-17558305 TCGCTCTGTCCCCTCCAGGCTGG - Intergenic
1064945939 10:20789816-20789838 TTGCTCTCTGTCACCCAGGCTGG - Intronic
1065166348 10:22982346-22982368 TCGCTCTGTTGCACCCAGGCTGG - Intronic
1065307740 10:24384564-24384586 TGGCTCAGTGTCGCCCAGGCTGG + Intronic
1065771505 10:29082587-29082609 TTGTTCAGTCCCTCGCAGGCAGG + Intergenic
1065831295 10:29616750-29616772 TGGCTCTGTCACACCCATGCTGG + Intronic
1066043051 10:31570455-31570477 TTTCTCTGTGTCACCCAGGCTGG - Intergenic
1066353803 10:34662840-34662862 TTTCTCACTGTCACCCAGGCTGG - Intronic
1066543796 10:36477268-36477290 TTGCACACTGTCACCCAGGCTGG - Intergenic
1067765288 10:49081287-49081309 TTGCATAGTCCCTTCCAGGCAGG - Intronic
1068501742 10:57847426-57847448 TTGCTGTGTTTCACCCAGGCTGG - Intergenic
1070066656 10:73041509-73041531 TTGCTCTGTCGCCCCCAGGCTGG - Intronic
1070108686 10:73461415-73461437 TTGCTCTGTTGCGCCCAGGCTGG - Intronic
1070499978 10:77063413-77063435 TTTCGCTGTCTCACCCAGGCTGG - Intronic
1070529885 10:77327381-77327403 TCGCTCTGTCACACCCAGGCTGG + Intronic
1070984818 10:80679572-80679594 TCGCTCTGTCACACCCAGGCTGG - Intergenic
1071465846 10:85939083-85939105 TTGCTCAGTCCCAGGCCGCCTGG + Intronic
1071504638 10:86225173-86225195 TTTCCCAGCCCCTCCCAGGCCGG + Intronic
1072158087 10:92741977-92741999 TCACTCTGTCTCACCCAGGCTGG - Intergenic
1072473383 10:95735059-95735081 TTGCTCTGTCTTGCCCAGGCTGG + Intronic
1073430569 10:103484018-103484040 TCGCTCTGTTGCACCCAGGCTGG - Intergenic
1074284044 10:112081117-112081139 TCTCACAGTCTCACCCAGGCTGG - Intergenic
1074698343 10:116071154-116071176 TTGCCCAGCCTCACCCTGGCTGG - Intronic
1074916794 10:117964464-117964486 TTTATCAGACCCACCAAGGCAGG + Intergenic
1075816589 10:125269434-125269456 TTGCTCTCTGTCACCCAGGCTGG - Intergenic
1076132661 10:128024710-128024732 CTGCCCAGTCCAAGCCAGGCAGG + Intronic
1077179764 11:1207104-1207126 AGGCTCATTCCCACCCGGGCAGG + Intergenic
1078275509 11:9841560-9841582 TTGCTCTGTCCGACCCAGGCTGG + Intronic
1078587216 11:12602672-12602694 TTCCTCAGTCCCACCCATTTCGG + Intergenic
1079131157 11:17747626-17747648 TAGCTCGTCCCCACCCAGGCTGG - Intronic
1081842794 11:46215441-46215463 AGTCTCACTCCCACCCAGGCGGG + Intergenic
1081972037 11:47205958-47205980 TCGCTCTGTCCAGCCCAGGCTGG - Intergenic
1082015620 11:47484283-47484305 TTGCTCTCTCTCACCCAGGCTGG - Intronic
1082055124 11:47808249-47808271 TCGCTCTCTCTCACCCAGGCCGG - Intronic
1082831126 11:57618191-57618213 TTGCTCTGTCTTGCCCAGGCTGG + Intergenic
1082907965 11:58333548-58333570 TCCCTCTGTCACACCCAGGCTGG + Intergenic
1083332764 11:61906572-61906594 CTGCTGAGCCCCACCAAGGCCGG - Exonic
1083403777 11:62442836-62442858 TTGCTCTGTCTTGCCCAGGCTGG - Intronic
1083586481 11:63863492-63863514 TTTCTCTCTGCCACCCAGGCTGG + Intronic
1083822986 11:65182979-65183001 TAGCCGAGTCCCACCCAGGATGG - Intronic
1084102256 11:66957584-66957606 TTGCTGTCACCCACCCAGGCTGG - Intronic
1084476340 11:69391734-69391756 TCGCACAGTGCCACCCAGGCCGG + Intergenic
1084522073 11:69669628-69669650 CTGCTCAGACACACCCAGCCGGG + Intronic
1084732513 11:71082548-71082570 GTACACAGTCCCACCCTGGCAGG + Intronic
1084909240 11:72374150-72374172 TTGCTCAATACCTCCTAGGCAGG + Intronic
1085106366 11:73846730-73846752 TCTCTCTCTCCCACCCAGGCTGG + Intronic
1085167033 11:74411884-74411906 TTGCTCTGTCCAGCCCAGGCTGG + Intergenic
1085357174 11:75849146-75849168 TCGCTCTGTCTCGCCCAGGCTGG - Intronic
1085557119 11:77434474-77434496 TTGCTATGTCACCCCCAGGCTGG + Intronic
1085640079 11:78188153-78188175 TTCCCCAATCTCACCCAGGCTGG + Intronic
1086019202 11:82206023-82206045 TCACTCTGTCTCACCCAGGCTGG + Intergenic
1086138182 11:83463759-83463781 TTGCTCTGTCCAGCCCAAGCTGG - Intronic
1086662642 11:89440347-89440369 TTACTCTGTCACGCCCAGGCTGG + Intronic
1087051364 11:93889412-93889434 TCACTCTGTCTCACCCAGGCTGG + Intergenic
1087841339 11:102923776-102923798 TTACTCTGTCCTGCCCAGGCTGG + Intergenic
1088125491 11:106418666-106418688 TTGCACTGTATCACCCAGGCTGG - Intergenic
1088165855 11:106935815-106935837 TTGCTGTGTCTCACCCAGGCTGG - Intronic
1088827104 11:113505292-113505314 TTGTTCATTCCCTCCCAGACAGG + Intergenic
1090228187 11:125084027-125084049 TTTCTTAGGCCCACCCAGCCAGG - Intronic
1090395627 11:126416291-126416313 TTAATCAGTCCCAGGCAGGCTGG - Intronic
1090665877 11:128914603-128914625 TTGCTCAAACCCGCTCAGGCAGG - Intronic
1090780517 11:130002622-130002644 TTGCTTAGTCCCACCCAAAATGG - Intronic
1091326641 11:134694624-134694646 TTGCTCTGTCCTGCCCAGGCTGG - Intergenic
1091493900 12:955808-955830 TTGCTCTGTTGCGCCCAGGCTGG + Intronic
1092610328 12:10165729-10165751 TCGCTGTGTCACACCCAGGCTGG - Intronic
1092896403 12:13015307-13015329 TCACTCTGTCTCACCCAGGCTGG + Intergenic
1092958355 12:13571256-13571278 TTGCACAGTCCCAGCCACACTGG - Intronic
1093064307 12:14640429-14640451 TTGCTCTGTCACCCCCAGGCTGG - Intronic
1093749642 12:22783130-22783152 TCACTCTGTCTCACCCAGGCTGG - Intergenic
1094014577 12:25849048-25849070 TTGCTCTCTGTCACCCAGGCTGG - Intergenic
1095157153 12:38871386-38871408 ATGCTCAGTCCCATCTAGCCTGG + Intronic
1095982729 12:47982215-47982237 TTGCTCAGTCCCACCCAGGCTGG + Intronic
1096053686 12:48633115-48633137 TTGCTCTCTGTCACCCAGGCTGG + Intergenic
1097093275 12:56524747-56524769 TTGCTCTGTCGCGCCCAGGCTGG + Intronic
1097115234 12:56692095-56692117 CTGCTCATGGCCACCCAGGCAGG - Intergenic
1097378169 12:58862389-58862411 TTGCTCTGTCGTGCCCAGGCTGG + Intergenic
1097680876 12:62647797-62647819 TGTCCAAGTCCCACCCAGGCTGG - Exonic
1097712999 12:62935191-62935213 TTGCTCAGCCCCTCCCCTGCCGG + Intergenic
1098900368 12:76105901-76105923 TCTCTCACTCTCACCCAGGCTGG + Intergenic
1098941415 12:76541446-76541468 TTGCTCTGTGTCACCCAGGCTGG - Intronic
1098996693 12:77128809-77128831 TTGCTCTGTCTTTCCCAGGCTGG - Intergenic
1100266754 12:92984487-92984509 GGGCTCACTCTCACCCAGGCTGG - Intergenic
1100442588 12:94630223-94630245 TTGCTCTCTATCACCCAGGCTGG - Intronic
1100547570 12:95617825-95617847 TTGCTCTGTCACACCCAGGCTGG + Intergenic
1102529838 12:113538105-113538127 TTTCTCAGCCCCACTCAGGGAGG - Intergenic
1102697870 12:114814285-114814307 ATGCTCAGTTGCCCCCAGGCTGG + Intergenic
1103776088 12:123367388-123367410 TTGCTTTATCTCACCCAGGCTGG + Intergenic
1104918451 12:132278422-132278444 TGGCTCAGACCCTCCCGGGCGGG - Intronic
1106344537 13:28862581-28862603 TTGCTCTGCCGCGCCCAGGCCGG - Intronic
1106369378 13:29116800-29116822 TTGTTCAGTCCCATCCAGGATGG - Intronic
1106498641 13:30306870-30306892 GCGCTCAGCCCCACCCCGGCTGG - Intronic
1106716616 13:32396001-32396023 TTGCTTTGTCACCCCCAGGCTGG + Intronic
1107372254 13:39766038-39766060 CTGCTGAGTCTCAGCCAGGCTGG - Intronic
1107654687 13:42579377-42579399 TTTGTCACCCCCACCCAGGCTGG - Intronic
1107661569 13:42644309-42644331 TTGCTCTGTCTCGCCCAGGCTGG + Intergenic
1107873895 13:44772074-44772096 TTGCTCTCTGTCACCCAGGCTGG + Intergenic
1108371274 13:49771667-49771689 TTATTTAGTCTCACCCAGGCTGG + Intronic
1108501847 13:51077449-51077471 GTGCTCAATGGCACCCAGGCTGG + Intergenic
1108517314 13:51215580-51215602 TTGCTCAAGCCCACCCAGTGAGG + Intergenic
1108623879 13:52209262-52209284 TTGCTCTCTGTCACCCAGGCTGG + Intergenic
1109514424 13:63423574-63423596 TTGTTCAGTCCCACCAACTCTGG + Intergenic
1110848897 13:80222094-80222116 TCACTCTGTCACACCCAGGCTGG + Intergenic
1112027972 13:95429860-95429882 TTGCTCTCTCTCACCCAGGCTGG + Intergenic
1112560282 13:100506653-100506675 GTCCTCAGTCCCCCCCAGGTTGG - Intronic
1113146141 13:107209465-107209487 TCGCTCTGTGTCACCCAGGCTGG - Intronic
1113408905 13:110066342-110066364 GTGCTGAGTCCCACCCAGTCTGG + Intergenic
1113464615 13:110504633-110504655 TCGCTCTGTCTCACCCAGGCTGG + Intronic
1113808352 13:113122880-113122902 CTGCTCAGTGCCTCCCTGGCTGG + Exonic
1114752331 14:25219006-25219028 TCTCTCAGTATCACCCAGGCTGG + Intergenic
1115384646 14:32782133-32782155 TTGCTCTCTGTCACCCAGGCTGG - Intronic
1115977166 14:39009397-39009419 GTGCTGAGTTCCACCTAGGCAGG + Intergenic
1116102907 14:40464766-40464788 TGGCTCAGTCCCACCCTGCATGG - Intergenic
1116821297 14:49630199-49630221 TCGCTCTGTCTCACCCAGGCTGG - Intronic
1117123901 14:52599461-52599483 TCTCGCAGTCTCACCCAGGCTGG + Intronic
1117401235 14:55360049-55360071 TTCCTCACTCTCATCCAGGCTGG - Intronic
1117858966 14:60069377-60069399 TTTCTCTGTCTCGCCCAGGCTGG - Intergenic
1118361852 14:65063592-65063614 TTGCTCAAATGCACCCAGGCTGG + Intronic
1118614288 14:67564716-67564738 TTGCTCAGTCTTGCCCAGGCTGG + Intronic
1119217356 14:72879345-72879367 TCTCTCTGTCTCACCCAGGCTGG - Intronic
1119372343 14:74157662-74157684 TTGCTCTGTGCTGCCCAGGCTGG + Intronic
1119789087 14:77333049-77333071 TTGCTCTGTCATGCCCAGGCTGG + Intergenic
1119800090 14:77436472-77436494 TTTCTCTGTGTCACCCAGGCTGG + Intronic
1120960206 14:90117558-90117580 TCGCTCTGTCTCGCCCAGGCTGG - Intronic
1121053455 14:90834587-90834609 TTGCTCTGTCACACCCAGGCTGG - Intergenic
1121448020 14:93990483-93990505 TGGCTCAGTCCACTCCAGGCTGG - Intergenic
1121635562 14:95451764-95451786 TTGCTCGGTTCCACACAGGGAGG + Intronic
1121642983 14:95498813-95498835 CCTCTCAGTCCCCCCCAGGCTGG + Intergenic
1121898311 14:97669743-97669765 GTTCTCATTGCCACCCAGGCAGG + Intergenic
1122223257 14:100255587-100255609 TCGCTCTGTCCCCCCCAGGTTGG - Intronic
1122810196 14:104284008-104284030 TGGCCCAGCCCCAGCCAGGCAGG - Intergenic
1122887562 14:104717213-104717235 TTCCTCAGTCCCCCCCGGGCAGG + Intronic
1124232896 15:27960872-27960894 TTGCTCTGTCATGCCCAGGCTGG - Intronic
1124291357 15:28456107-28456129 GTGCCCAGTCCCAACCACGCGGG + Intergenic
1124628248 15:31322501-31322523 TGGGTCAGGCCCACCCAGGGAGG + Intergenic
1125700335 15:41677169-41677191 TCGCTCTGTCGCCCCCAGGCAGG + Intronic
1125875231 15:43138163-43138185 TTGCTGAGTCCAATCCAAGCAGG - Intronic
1126316110 15:47371622-47371644 TTGCTCAGTACCACATATGCAGG - Intronic
1126357616 15:47812967-47812989 TTGCTCAGACCCATCAGGGCTGG - Intergenic
1126603675 15:50454481-50454503 TCACTCTGTCTCACCCAGGCTGG + Intronic
1126647270 15:50887554-50887576 TCGCTCTGTCGCGCCCAGGCTGG + Intergenic
1127120007 15:55763319-55763341 TTGCTCTCTGTCACCCAGGCTGG - Intergenic
1127426377 15:58863079-58863101 TTGCTCTGTCTTGCCCAGGCTGG + Intergenic
1127450695 15:59113753-59113775 TTGTTCCGTCCAGCCCAGGCTGG + Intronic
1127553522 15:60065054-60065076 TCACTCTGTCCCCCCCAGGCTGG + Intergenic
1127581756 15:60345226-60345248 CTGCCCAGCCCCACCAAGGCAGG + Intergenic
1128085803 15:64885813-64885835 TTGCTCTGTCACACCCAGGCTGG - Intronic
1128143382 15:65317749-65317771 TTGCTCTGTCTCACCCAGGCTGG - Intergenic
1128255636 15:66194576-66194598 TTGCTCTGTCTCACCCAGGCTGG - Intronic
1128293931 15:66500750-66500772 TTGTTCTGTCTCACCCACGCTGG - Intronic
1128661785 15:69506646-69506668 GGGCTCACTCCCACCCAGGCTGG + Intergenic
1129517707 15:76166627-76166649 TGGCTGAGTCCCACCCTGGCCGG + Intronic
1129586710 15:76874934-76874956 TCACTCTGTCACACCCAGGCTGG - Intronic
1129666168 15:77580652-77580674 TGGCTCAGTCCCCCACTGGCCGG - Intergenic
1129806702 15:78467177-78467199 TCACTCCGTCACACCCAGGCTGG - Intronic
1130145898 15:81273457-81273479 GACTTCAGTCCCACCCAGGCTGG - Intronic
1131706784 15:95005247-95005269 TTACACTGTGCCACCCAGGCTGG + Intergenic
1131835102 15:96382698-96382720 TTGCTCCGTCCCACCCAGGCTGG + Intergenic
1132062276 15:98702378-98702400 TTGCTCTGTGTCTCCCAGGCTGG + Intronic
1132399401 15:101496261-101496283 TTCCTCAGCCCCACCCAGCCCGG - Intronic
1133647513 16:7777864-7777886 TTGCTCCGTCATGCCCAGGCTGG - Intergenic
1134313832 16:13099994-13100016 CTGCTGAGTCCCATCCAGCCTGG - Intronic
1134573604 16:15313245-15313267 TTGCTCTGTCACACCCATGTTGG - Intergenic
1134649476 16:15897296-15897318 GTTCTCACTCTCACCCAGGCTGG + Intergenic
1134892787 16:17855664-17855686 TTGCTGTGTTGCACCCAGGCTGG - Intergenic
1134938621 16:18268854-18268876 TTGCTCTGTCACACCCATGTTGG - Intergenic
1135724277 16:24842818-24842840 TTGCTCTGTCTCACCCAGGCTGG + Intergenic
1135934978 16:26771926-26771948 TTGCTCTTTCTCACCCAGGCTGG + Intergenic
1135962482 16:27009270-27009292 AATCTCACTCCCACCCAGGCTGG + Intergenic
1136418660 16:30118549-30118571 TTCCGCAGACCCCCCCAGGCAGG + Intronic
1136658020 16:31724660-31724682 TTGCTCTCTGTCACCCAGGCTGG - Intronic
1136707420 16:32201564-32201586 ATGCCCAGTCCCAACCACGCGGG - Intergenic
1136760492 16:32727853-32727875 ATGCCCAGTCCCAACCACGCGGG + Intergenic
1136807611 16:33142533-33142555 ATGCCCAGTCCCAACCACGCGGG - Intergenic
1137303245 16:47174548-47174570 TTGCTCTGTCTTGCCCAGGCTGG + Intronic
1137445413 16:48528714-48528736 TCGCTCTGTGTCACCCAGGCTGG + Intergenic
1137618884 16:49863073-49863095 TTGCTCTGTGTCACCCAGGCTGG + Intergenic
1138461198 16:57148814-57148836 TCACTCTGTCCCACCCAGGCTGG + Intergenic
1138481315 16:57305170-57305192 TCGCTCTGTCGCGCCCAGGCTGG - Intergenic
1138523812 16:57590157-57590179 TTGCCCTGTCACACCCAGGCTGG + Intronic
1139181934 16:64759147-64759169 TTGCTCTGTCACCCCCAGGCTGG + Intergenic
1139399072 16:66665744-66665766 TCGCTCTGTCTCACCCAGGCTGG - Intronic
1139449227 16:67016790-67016812 TAGCACACTCCCACCCAGCCAGG + Intergenic
1139745873 16:69073927-69073949 TTGCTCTGTGCCCCCCAGGCTGG - Intronic
1140035534 16:71368603-71368625 TTGCTCAGGACCACACAGCCAGG - Intronic
1140400942 16:74670991-74671013 TTGCTCTGTCACGCCCAGGCTGG - Intergenic
1140492362 16:75348894-75348916 TTGCTGTCTGCCACCCAGGCTGG + Intronic
1141130614 16:81433877-81433899 TCGCTCTGTGTCACCCAGGCTGG - Intergenic
1141477317 16:84282553-84282575 TCGCTCTGTCTCACCAAGGCTGG - Intergenic
1141481273 16:84308381-84308403 GCGCTCGGTCCCAGCCAGGCAGG + Intronic
1203062645 16_KI270728v1_random:988168-988190 ATGCCCAGTCCCAACCACGCGGG + Intergenic
1142754656 17:2008975-2008997 TTACTCACTCCCACCCTGCCTGG + Intronic
1142797580 17:2320589-2320611 TCACTCTGTCCAACCCAGGCTGG + Intronic
1143051056 17:4126192-4126214 TTGCTCTCTGTCACCCAGGCTGG - Intronic
1143589214 17:7870855-7870877 TTGCTCTGTCGCCCCCAAGCTGG - Intronic
1143713347 17:8749291-8749313 TCGCTCTGTCACACCCAGGCTGG + Intergenic
1143869212 17:9945952-9945974 TCACTCTGTCTCACCCAGGCTGG - Intronic
1143902551 17:10184954-10184976 TTGCTGTGTCTCACTCAGGCTGG + Intronic
1144155388 17:12495236-12495258 TTTCTCCTTGCCACCCAGGCTGG - Intergenic
1144435448 17:15235780-15235802 TTACTCTGTCACCCCCAGGCTGG + Intronic
1144531063 17:16039818-16039840 TCTCTCTGTCGCACCCAGGCTGG + Intronic
1144717837 17:17446746-17446768 CTGCTCAGCCCCATGCAGGCTGG + Intergenic
1144916696 17:18729423-18729445 TTGCTCTTTCCCCCCAAGGCCGG + Intronic
1144957860 17:19028498-19028520 TTGCTGAGTCCCAGCTAGACTGG - Intronic
1144977298 17:19146022-19146044 TTGCTGAGTCCCAGCTAGACTGG + Intronic
1145032503 17:19515628-19515650 TTGCGCTCTCTCACCCAGGCTGG + Intronic
1145191197 17:20842993-20843015 GTGCCCAGTCCCAACCACGCGGG - Intronic
1146154117 17:30505756-30505778 TTTCTCAGTTGCCCCCAGGCTGG + Intronic
1146259431 17:31411965-31411987 ATGCTCGGTCCTACCCAGCCTGG - Intronic
1146455765 17:33008571-33008593 TGGCTCTGTCGCACCTAGGCTGG - Intergenic
1146787939 17:35734669-35734691 CTGCCCAGTCCCACCCATTCAGG + Intronic
1147118889 17:38323565-38323587 TTGCTCTGTCAGGCCCAGGCTGG + Intergenic
1147240019 17:39084718-39084740 TGGCTCTGTCCTGCCCAGGCTGG - Intronic
1147283748 17:39384202-39384224 TTTCTCTCTGCCACCCAGGCTGG - Intronic
1147422342 17:40328124-40328146 TCCCTCAGTTCCACACAGGCTGG + Intronic
1147433515 17:40390655-40390677 TTGCTCTATCTCGCCCAGGCTGG + Intronic
1147682081 17:42256042-42256064 TTTCTCTGTGTCACCCAGGCTGG - Intronic
1147781655 17:42947361-42947383 TTGCTCACTACCACTCAGGTGGG - Intergenic
1148508387 17:48146656-48146678 TTGCTCTTTGTCACCCAGGCTGG + Intronic
1148617219 17:49010048-49010070 TTGCTCCTTTTCACCCAGGCTGG - Intronic
1148736415 17:49867730-49867752 ATGCTCAGTATTACCCAGGCAGG + Intergenic
1148848882 17:50544777-50544799 TTTTTCTGTCCCAGCCAGGCTGG + Intronic
1149816251 17:59727162-59727184 TTGCTCTGTCTCGCCCATGCTGG + Intronic
1149879266 17:60271839-60271861 TTGCTCTGTCACTCCCAAGCTGG + Intronic
1150425632 17:65074816-65074838 CTGCCCAGACCCACCCAGCCAGG - Intergenic
1150562355 17:66303968-66303990 TCGCTCTGTCTCACCCAGGCTGG - Intronic
1150776579 17:68086439-68086461 TTACTCACTGTCACCCAGGCTGG + Intergenic
1151457644 17:74235862-74235884 TCGCTCTGTGTCACCCAGGCTGG - Intronic
1151764714 17:76126676-76126698 TGGCTCTGTCTCACCCAGGCTGG - Intergenic
1152335865 17:79700018-79700040 TGACTCAGTCCCCTCCAGGCAGG - Intergenic
1152452540 17:80391298-80391320 TGTCTCACTCCCACCCAAGCTGG + Intronic
1152778625 17:82216755-82216777 TTGCTCTGGCCCATGCAGGCTGG - Intergenic
1153513046 18:5876366-5876388 TTACTCTGTCACGCCCAGGCTGG - Intergenic
1153525800 18:5993360-5993382 TTGCTCAGTGACACCTAGACAGG - Intronic
1153591636 18:6680092-6680114 TTGCTCTCTGTCACCCAGGCTGG - Intergenic
1153845826 18:9049041-9049063 TTGCTCACTCTCCTCCAGGCAGG - Intergenic
1156152157 18:34255024-34255046 TTGCTCTGTCGCCCCCAGGCTGG - Intergenic
1156760762 18:40586048-40586070 TTGCTCTATGTCACCCAGGCTGG - Intergenic
1156971975 18:43167549-43167571 TCACTCTGTCTCACCCAGGCTGG + Intergenic
1157640276 18:49206026-49206048 TTGCTCTGTGTCACCCAGGCTGG + Intronic
1157749528 18:50165744-50165766 TGGCTCTGTCGCACCCAGGCTGG - Intronic
1158739643 18:60125581-60125603 ATGCTGAGTTCCACCTAGGCAGG - Intergenic
1159462967 18:68743376-68743398 TCGCTCTGTCTCACCCAGTCTGG - Intronic
1159641914 18:70873326-70873348 CTGCTCCGTCCCACTCAGGAAGG - Intergenic
1159952026 18:74491400-74491422 TCACTCTGTCTCACCCAGGCTGG - Intergenic
1160183861 18:76659761-76659783 TTGCTCAGTCGCAGGGAGGCTGG + Intergenic
1160530851 18:79561474-79561496 TTGCTCTGTCCCACCCAGGCTGG - Intergenic
1160678249 19:401698-401720 GTGTCCAGTCCCACCCAGGAAGG + Intergenic
1160678367 19:402188-402210 GGCCTCAGACCCACCCAGGCGGG - Intergenic
1161103109 19:2431035-2431057 TTGCTCAGCCCCTCCCTGGTGGG - Intronic
1161128846 19:2576350-2576372 TGGGTCAGCCCCACCCAGGGCGG - Intronic
1161441781 19:4295946-4295968 TCGCTCTGTGTCACCCAGGCTGG + Intronic
1161665843 19:5576076-5576098 TGGCTCTGTGTCACCCAGGCTGG + Intergenic
1161677060 19:5657557-5657579 TTGCTGTGTCGCGCCCAGGCTGG + Intronic
1162137896 19:8567396-8567418 TTGCTCTGTTGCACCCAGGCTGG + Intronic
1162303804 19:9859344-9859366 TTGCTCTGTCTTGCCCAGGCTGG + Intronic
1162457206 19:10792635-10792657 TTACTCTGTCTCGCCCAGGCTGG + Intronic
1162706013 19:12555457-12555479 TTGCCGAGTCCCAAGCAGGCAGG + Intronic
1163058964 19:14744212-14744234 TCGCTCTGTCACTCCCAGGCTGG - Intronic
1163211846 19:15846668-15846690 TTGCTCTGTCTTGCCCAGGCTGG + Intergenic
1163550342 19:17963035-17963057 TTGCTCTGTCAAGCCCAGGCTGG + Intronic
1163952914 19:20607422-20607444 TTGCACTGTGTCACCCAGGCTGG + Intronic
1165837484 19:38768200-38768222 TTGCTCTGTCTCACCCAGGCTGG - Intronic
1166296244 19:41891310-41891332 TCGCTCTGTGTCACCCAGGCTGG + Intronic
1166549555 19:43656221-43656243 TTGCTCTCTGTCACCCAGGCTGG - Intronic
1166741843 19:45119182-45119204 TTGCTCTCTGTCACCCAGGCTGG + Intronic
1166872617 19:45879965-45879987 TTGCTCTCTGTCACCCAGGCTGG - Intergenic
1167164507 19:47789394-47789416 TTTTTCACTCTCACCCAGGCTGG - Intergenic
1167334809 19:48878275-48878297 TTGTTCTGTCCAGCCCAGGCTGG + Intergenic
1167535920 19:50051281-50051303 TATTTCAGTCCCACCCAGCCCGG - Intronic
1167969542 19:53179344-53179366 TCGCTCTGTGTCACCCAGGCTGG - Intronic
1168135813 19:54350781-54350803 TCGCTCTGTCACACCCAGGCTGG + Intergenic
1168312472 19:55467889-55467911 CAGCTCTGTCCCACTCAGGCCGG + Intergenic
1168499169 19:56878928-56878950 TTGTTCTGTCTCGCCCAGGCAGG + Intergenic
924969245 2:109138-109160 CTGCTGGGTCCCACCCAGGACGG + Intergenic
925261779 2:2535629-2535651 CTGCTCAGAACCACGCAGGCTGG + Intergenic
925385446 2:3458728-3458750 ATGCTCATTCCCACCAAAGCAGG - Intronic
926440782 2:12886390-12886412 TTCCTCACCCCCAACCAGGCTGG - Intergenic
926578654 2:14610626-14610648 TTGCTCTGTCACGCCCAGGCTGG - Intergenic
927121636 2:19969775-19969797 TTTCTCACTCTCACCCAGGCTGG + Intronic
927177474 2:20420760-20420782 TTGCTCTGCCGCGCCCAGGCTGG - Intergenic
927242493 2:20931039-20931061 CTGCTCACTCCCTCCCTGGCTGG - Intergenic
927726996 2:25433280-25433302 TTACTCCGTTCCACTCAGGCAGG + Intronic
927844000 2:26462046-26462068 CAGCTCAGTCCCTCCCATGCAGG + Intronic
927881958 2:26695249-26695271 TCACTCTGTCTCACCCAGGCTGG + Intronic
927919265 2:26959386-26959408 TCGCTCTGTGTCACCCAGGCTGG - Intergenic
928687285 2:33761883-33761905 GTGCTCAGTGCTGCCCAGGCTGG - Intergenic
929238441 2:39628886-39628908 GTGCTCAATGGCACCCAGGCTGG - Intergenic
929819420 2:45261401-45261423 GTGCTCCTTCCCACCCAGACAGG - Intergenic
930770859 2:55129076-55129098 TTGCTCTGTCACACCTAGGCTGG - Intergenic
931295390 2:60919453-60919475 TTGCTCTGTCTTGCCCAGGCTGG + Intronic
932434357 2:71694552-71694574 TTCCTCAGACCCACACAGTCAGG + Intergenic
932469457 2:71944406-71944428 TTCCTGATGCCCACCCAGGCAGG - Intergenic
933801428 2:85963334-85963356 CTGCTCTGTCACACCCAGGCTGG + Intergenic
934081136 2:88468617-88468639 TTGCTCTGTCTTGCCCAGGCTGG - Intergenic
934785326 2:97001017-97001039 TCGCTCTGTGGCACCCAGGCTGG + Intronic
935171603 2:100614719-100614741 CTGCTCTGTCCCACCCCAGCAGG + Intergenic
935580744 2:104754107-104754129 TTCCTCAGCCCCAGCCTGGCAGG + Intergenic
936018173 2:108975188-108975210 TTGCCCCTTCCCACACAGGCTGG - Intronic
936237107 2:110752052-110752074 TTGCTCTGTCTCGCCCAGGCTGG + Intronic
936479082 2:112868509-112868531 TTGCTCACTCACAGCTAGGCTGG - Intergenic
936544765 2:113381463-113381485 TCGCTCTGTCGCCCCCAGGCTGG + Intergenic
936789704 2:116137225-116137247 TTGCTCTGGCTCACCCAGGCTGG + Intergenic
936790047 2:116140586-116140608 TCACTCTGTCTCACCCAGGCTGG - Intergenic
937954575 2:127414891-127414913 CTGCTCAGCCCACCCCAGGCAGG - Intergenic
939818188 2:146922396-146922418 TCGCTCTGTGTCACCCAGGCTGG + Intergenic
940327520 2:152441504-152441526 TTGCTCTGTGTCACCCAGGCTGG - Intronic
940648175 2:156413552-156413574 TCACTCTGTCACACCCAGGCTGG - Intergenic
940819759 2:158339794-158339816 AAGCTCAGTCACACCCAGGCTGG - Intronic
940898745 2:159107055-159107077 TCGCTCTGTCTCGCCCAGGCTGG + Intronic
940960098 2:159775938-159775960 TTGCTCTGTCTCGCCCAGGCTGG + Intronic
941032131 2:160524642-160524664 TTGCTCAGTTCCAGCCACTCTGG - Intergenic
942613668 2:177767298-177767320 TTGCTCTTTGTCACCCAGGCTGG - Intronic
942721449 2:178957754-178957776 TTGCTCTGTGTCACCCAGACTGG + Intronic
944380312 2:199101614-199101636 TTGCTCAGTTCCACCTTGGATGG - Intergenic
944577488 2:201103559-201103581 TCGCTCTGTCGCACTCAGGCTGG + Intergenic
944718587 2:202400169-202400191 TTGCTCTGTCACTCTCAGGCTGG + Intronic
945172773 2:207014045-207014067 TGGCTCTGTCACGCCCAGGCAGG + Intergenic
945998875 2:216464010-216464032 TCGCTCTGTCTCGCCCAGGCTGG - Intronic
946041179 2:216784123-216784145 TTTCTCAGAGTCACCCAGGCTGG + Intergenic
946262434 2:218505892-218505914 TTGCTCTCTGTCACCCAGGCTGG + Intronic
946465719 2:219910148-219910170 TTCCTCTGTCCCTACCAGGCTGG - Intergenic
946920220 2:224572609-224572631 TCTCTCACTCTCACCCAGGCTGG - Intronic
947299647 2:228674973-228674995 TTTCTCTGTCCCATCCAGACTGG - Intergenic
948615759 2:239197881-239197903 GTGCTGAGTGTCACCCAGGCTGG + Intronic
948653951 2:239465280-239465302 TTGCTCACTCTCATCCAGCCGGG + Intergenic
948834993 2:240621900-240621922 TTGCTCTGTTGCAACCAGGCTGG + Intronic
1169140988 20:3227533-3227555 CTGCTCAGTCCCACCCACCCTGG + Exonic
1169968322 20:11241577-11241599 TCTCTCACTCTCACCCAGGCTGG - Intergenic
1170316852 20:15051779-15051801 TTTCTCTGTCCCCGCCAGGCTGG + Intronic
1170404302 20:16020134-16020156 TTTCTTAGTCCCACAAAGGCTGG + Intronic
1170561747 20:17564335-17564357 GTTCTCACTCTCACCCAGGCTGG - Intronic
1171278465 20:23877942-23877964 TTTCTTTGTCCCACCCTGGCTGG - Intronic
1171371851 20:24667492-24667514 TTGCTCTGTCTGGCCCAGGCTGG - Intergenic
1172003431 20:31799866-31799888 TCGCTCTGTCACCCCCAGGCTGG - Intronic
1172131378 20:32658330-32658352 GGGCTCACTCTCACCCAGGCTGG + Intergenic
1172283542 20:33725084-33725106 TTGCTCTGTTGCGCCCAGGCTGG + Intergenic
1172418051 20:34788203-34788225 TAGCTCTGTCTCGCCCAGGCTGG + Intronic
1172567794 20:35944599-35944621 TTGCTCTTTCTCGCCCAGGCTGG + Intronic
1172626254 20:36349071-36349093 TTGTTCTGTCACGCCCAGGCTGG - Intronic
1172748903 20:37235678-37235700 TTGCTCTGTCTCGCCCAGGCTGG + Intronic
1172765145 20:37346781-37346803 TGGCCCAGTCCCTTCCAGGCCGG - Intronic
1173089842 20:39959994-39960016 TTACTCTGTCGCATCCAGGCTGG - Intergenic
1173230982 20:41198032-41198054 TTGCTCTGCCCCACCCAGGCTGG + Intronic
1174031230 20:47629357-47629379 TTGCTCTGTCGTGCCCAGGCTGG + Intronic
1175039092 20:56028790-56028812 TCGCTCTGTCATACCCAGGCTGG + Intergenic
1175591440 20:60195092-60195114 TTGCTGAGTCCCAGCCTTGCTGG - Intergenic
1175905511 20:62377680-62377702 TGGCTCAGTGCCTCCCTGGCTGG + Intergenic
1176172583 20:63702702-63702724 TCTCTCATTCTCACCCAGGCTGG - Intronic
1176231786 20:64036617-64036639 CTGCTGTGTCCCACCCAGGTGGG - Intronic
1177152249 21:17466810-17466832 TTGCTCTCTGTCACCCAGGCTGG + Intergenic
1177486450 21:21762830-21762852 TTGCTCAACCCCTCCCAGTCTGG - Intergenic
1178056620 21:28806583-28806605 TTGGGCAGTCCCACAGAGGCTGG + Intergenic
1178092590 21:29180200-29180222 TCACTCTGTCGCACCCAGGCTGG - Intergenic
1179454670 21:41490876-41490898 TTGAACAGACCCTCCCAGGCTGG + Intronic
1179457460 21:41508736-41508758 TTCCTCACTCCCGCCCTGGCCGG - Intronic
1179640449 21:42744321-42744343 TTGCTCTGTCGAGCCCAGGCTGG - Intronic
1179949027 21:44699348-44699370 TGTCTCACTCTCACCCAGGCTGG - Intronic
1180123285 21:45768242-45768264 TGGCTCACTGCCACCCACGCAGG - Intronic
1180300524 22:11033124-11033146 TTGCTCTCTCTCACCCAGGCTGG + Intergenic
1180733316 22:17998269-17998291 TTGCTCTGTCGCGCCCAGTCTGG - Intronic
1180940004 22:19654508-19654530 TTTCACAATGCCACCCAGGCTGG - Intergenic
1181108438 22:20588042-20588064 ATGCTCAGACCCACCTGGGCAGG - Intergenic
1181134199 22:20752626-20752648 TCTCTCAGTCCCACCCACTCTGG - Intronic
1181283041 22:21733384-21733406 TCGCTCTGTCTCACCCAGGCTGG - Intronic
1181334026 22:22115995-22116017 GTGCCCAGTCCCAACCACGCGGG + Intergenic
1181395577 22:22618821-22618843 AAGCTCTGTCCCAGCCAGGCAGG + Intergenic
1181712133 22:24697322-24697344 CTGGTCACTCCCAGCCAGGCAGG + Intergenic
1181809516 22:25394945-25394967 GTCCTCAAGCCCACCCAGGCTGG + Intronic
1182323146 22:29491360-29491382 TTGCTCAGTCCCATGCAGTCTGG - Exonic
1182501224 22:30749084-30749106 TCGCTCTGTCTCACCCAGGCTGG - Intronic
1182575160 22:31268020-31268042 ATGCTCAGTCCCACCCAGCATGG - Intronic
1183435872 22:37794727-37794749 TTGCTGTGCCTCACCCAGGCTGG + Intergenic
1183595682 22:38808704-38808726 TCGCTCTGTCCAGCCCAGGCTGG + Intergenic
1183926095 22:41207271-41207293 TTGCTCTCTGTCACCCAGGCTGG + Intronic
1184083246 22:42240883-42240905 TTGCTCTGTCCCCCCCAGGCTGG + Intronic
1184169557 22:42750943-42750965 GTGCTCAGTGGCGCCCAGGCTGG - Intergenic
1184652727 22:45926481-45926503 GTGCTCAGTTACAGCCAGGCAGG + Intronic
1184948220 22:47819436-47819458 TCGCTCTGTCTCACCTAGGCTGG + Intergenic
1185034249 22:48463126-48463148 TTGCTCTGTCTCACCCAGGCTGG - Intergenic
949091711 3:37099-37121 TTGCTCTCTGTCACCCAGGCTGG + Intergenic
949707912 3:6840238-6840260 TTGCTCTGTGTCACCCAGGCTGG + Intronic
950407812 3:12815614-12815636 TTGCTCAAGCTCACTCAGGCAGG - Intronic
952930651 3:38358372-38358394 TTGCTCTGTTGCACCCAGGCTGG + Intronic
953498548 3:43410278-43410300 TCTCTCTGTCTCACCCAGGCTGG + Intronic
954259324 3:49427289-49427311 TTGCTCTGTCGCGCCCAGGCTGG - Intronic
954259783 3:49430353-49430375 TCGCTCAGTCGCGCCCAGGTTGG + Intergenic
954476808 3:50754124-50754146 TCACTCTGTCTCACCCAGGCTGG - Intronic
955386351 3:58484182-58484204 CTGTCCAGTCCCTCCCAGGCTGG - Intergenic
955597568 3:60608253-60608275 TGGCTCAGGCCTACTCAGGCTGG - Intronic
955924660 3:63993418-63993440 TCGCTCTGTCACCCCCAGGCTGG - Intronic
956532737 3:70238580-70238602 GTGCTCACTCTCATCCAGGCTGG - Intergenic
956885338 3:73553544-73553566 TTACTCTGTCACACCCAGGCTGG - Intronic
956892540 3:73626139-73626161 TTGCTGAATCCTACCCAGCCAGG - Intergenic
956914518 3:73857247-73857269 TTTCTCATTTTCACCCAGGCTGG + Intergenic
957301259 3:78394414-78394436 TTGCTCTGTCATGCCCAGGCTGG + Intergenic
957334722 3:78812338-78812360 TCACTCAGTCCCAGCCATGCTGG + Intronic
960565592 3:119128326-119128348 TTTCTCACTCTCACCCAGGCTGG - Intronic
961263543 3:125621845-125621867 TTGCTCTGTCTTGCCCAGGCTGG - Intergenic
961812406 3:129529488-129529510 GTGCTGAGTCAGACCCAGGCTGG + Intronic
961879379 3:130050056-130050078 TTGCTTTTTCTCACCCAGGCTGG - Intergenic
962253931 3:133857666-133857688 TTGCCCAGTCTCTCACAGGCTGG + Intronic
962330538 3:134473933-134473955 CTGCTCAGTCCAAGCCTGGCTGG + Intergenic
962554755 3:136536669-136536691 TTGCTCTGTCACCCCCAGGCTGG - Intronic
963186871 3:142428363-142428385 TTGCTCTGTCTCGCCCAAGCTGG - Intronic
963891709 3:150642916-150642938 TGTCTCACTCTCACCCAGGCTGG - Intergenic
964069537 3:152614812-152614834 TCGCTCTGTCGCCCCCAGGCTGG - Intergenic
964341430 3:155712708-155712730 TATCGCTGTCCCACCCAGGCTGG - Intronic
964812535 3:160681511-160681533 TCGCCCTGTCTCACCCAGGCTGG + Intergenic
964925814 3:161955342-161955364 TTTCTCTGTGTCACCCAGGCTGG - Intergenic
965852253 3:173042249-173042271 TCGCTCTGTCTCGCCCAGGCTGG + Intronic
966180582 3:177184767-177184789 TTGCTCTGTCTCATCCAGGCTGG - Intronic
966799508 3:183749669-183749691 TTGCTCTCTCTCACCCAGCCTGG + Intronic
966852981 3:184175830-184175852 TCCCTCAGTCCCAAACAGGCTGG - Intronic
966853416 3:184178031-184178053 TTGCCCAGTCCATCCAAGGCAGG - Intronic
966893529 3:184425723-184425745 TTGCTCTGTCTTACCCACGCTGG + Intronic
967013015 3:185456629-185456651 TTGCTCTGTCTTACCCAGGCTGG + Intronic
967034174 3:185635667-185635689 TGGCTCTGTCTCACCCAGGCTGG + Intergenic
967414523 3:189201677-189201699 TTGCTCCATTTCACCCAGGCTGG + Intronic
968701864 4:2061255-2061277 CGGCTCAGGCCCACCCACGCCGG - Intronic
968991607 4:3917075-3917097 TTGCTTTTTCTCACCCAGGCTGG - Intergenic
969198629 4:5583885-5583907 TTGCTCTGTCTCACCCAGGCTGG + Intronic
969360751 4:6662032-6662054 TTGCTCTGTCACCCACAGGCTGG - Intergenic
970560123 4:17274450-17274472 TTGCTCTGTGTCACCCAGGCTGG - Intergenic
971328170 4:25661415-25661437 TTGCTCTGTATCCCCCAGGCTGG + Intronic
971409296 4:26353636-26353658 TTGCTCTGTCACACCCAAGCTGG + Intronic
971642500 4:29153816-29153838 TTCCTGAGTCCCCCCCAGCCAGG - Intergenic
971759894 4:30752161-30752183 TCACTCTGTCGCACCCAGGCTGG + Intronic
973769800 4:54195862-54195884 TAGCTCTGTCACCCCCAGGCTGG - Intronic
973953035 4:56036673-56036695 TTGCTCTGTCTTGCCCAGGCTGG - Intergenic
973979595 4:56296947-56296969 TCGCTCTGTCTCACCTAGGCTGG + Intronic
974364080 4:60923183-60923205 TTGATCAGTCACCCCCAGACTGG + Intergenic
974757821 4:66234281-66234303 TTGCTCTGTCTCCCCCAGGCTGG - Intergenic
975551350 4:75616272-75616294 TCACTCTGCCCCACCCAGGCTGG - Intronic
975594744 4:76039127-76039149 TCTCTCTGTGCCACCCAGGCTGG + Intronic
975654822 4:76631236-76631258 TTGCTCTGTTGCACCCAGGCTGG + Intronic
976150220 4:82083997-82084019 TCGCTCTGTCTCACCCAGACTGG - Intergenic
976280228 4:83319988-83320010 TCGCCCAGTGTCACCCAGGCTGG - Intronic
976401245 4:84609147-84609169 TCGCTCTGTCGCACCCAGGCTGG - Intronic
976725249 4:88209625-88209647 TTGCTCTCACCCAGCCAGGCTGG - Intronic
976792234 4:88891388-88891410 TCTCTCTGTCTCACCCAGGCTGG - Intronic
976792301 4:88892142-88892164 TTGCTCTGTCTGGCCCAGGCTGG - Intronic
977352369 4:95904644-95904666 TTAGACAGTCTCACCCAGGCTGG + Intergenic
977907926 4:102499722-102499744 TCGCTCTGTCTCGCCCAGGCTGG + Intergenic
978458246 4:108919790-108919812 TTGCTCTGTCTCACCCAGGCTGG + Intronic
979228642 4:118320721-118320743 TTTCTCTGTGTCACCCAGGCTGG - Intronic
979298405 4:119058502-119058524 TTGCTCTGTCCCACCCAGTCTGG + Exonic
980796802 4:137696090-137696112 TTGCTCTGTGTCCCCCAGGCTGG - Intergenic
981443167 4:144806471-144806493 TCCCCCAGGCCCACCCAGGCTGG + Intergenic
982572085 4:157063288-157063310 TGTCTCACTCTCACCCAGGCTGG + Intergenic
982699535 4:158644074-158644096 TCGCTCTGTCGCCCCCAGGCTGG + Intronic
983841709 4:172464675-172464697 TCACTCTGTCTCACCCAGGCTGG - Intronic
984782686 4:183540128-183540150 TCACTCTGTCACACCCAGGCTGG - Intergenic
984820283 4:183875925-183875947 TTGCTCAGGTCCATCCAGGGAGG + Intronic
985010630 4:185578993-185579015 TTGCTCAGTGTCACCTGGGCTGG + Intergenic
985099917 4:186448694-186448716 TTGCACTGTGTCACCCAGGCTGG + Intronic
985239827 4:187918128-187918150 TTTCACACTGCCACCCAGGCTGG - Intergenic
985289294 4:188371315-188371337 TCGCTCTGTCCAGCCCAGGCTGG + Intergenic
987318075 5:16742778-16742800 TTGCTCTGTGTCACCCAGGCTGG - Intronic
988137910 5:27199580-27199602 TCACTCTGTCTCACCCAGGCTGG + Intergenic
989488366 5:42019661-42019683 TTGCTCTGTCTCACCCAGGCTGG - Intergenic
990404015 5:55469458-55469480 TCGCTGTGTCGCACCCAGGCTGG - Intronic
991056865 5:62330319-62330341 TTTCTCACTCTCGCCCAGGCTGG - Intronic
991064319 5:62409851-62409873 TTGCTCTGTTGCCCCCAGGCTGG + Intronic
991332634 5:65508754-65508776 TTGCTCTGTCGCACCCAGGCTGG - Intergenic
991689155 5:69209507-69209529 TTGCTCTGTGTCACCCAGGCTGG - Intronic
991706255 5:69361632-69361654 TTGCTCTGTCTTGCCCAGGCTGG + Intronic
992802781 5:80308963-80308985 TTGCTCTGTCACACCCAAGCTGG + Intergenic
992944556 5:81797141-81797163 TGGCTCTGTCGCACCCAGGCTGG + Intergenic
994099509 5:95878092-95878114 TCGCTCTGTCTCTCCCAGGCTGG - Intergenic
995864255 5:116674360-116674382 TTGCACAGTTCTACCCAGGGTGG + Intergenic
996748049 5:126862748-126862770 TTGCTCTGTCTTGCCCAGGCTGG - Intergenic
996971876 5:129379634-129379656 TGGCTCAGTCCGTTCCAGGCTGG - Intergenic
997178459 5:131803114-131803136 TTGCTCTTTGTCACCCAGGCTGG - Intergenic
997390716 5:133512845-133512867 TTGCTCTCTCTCGCCCAGGCTGG + Intronic
997551530 5:134757723-134757745 TTTCTCTGTGCTACCCAGGCTGG + Intergenic
997915145 5:137917192-137917214 TCACTCTGTCTCACCCAGGCTGG + Intronic
997960052 5:138314023-138314045 TTGCTCTGTCGCACCCAGGCTGG + Intronic
999176764 5:149637307-149637329 TCGCTCTGTCTTACCCAGGCTGG + Intergenic
999492048 5:152060741-152060763 TTGCTCAGTCTTGCCCAGGCTGG - Intergenic
1000190095 5:158902059-158902081 TTGCTCTGTCGTGCCCAGGCTGG - Intronic
1001088442 5:168719079-168719101 TTGCTCTGTGTTACCCAGGCTGG + Intronic
1001121441 5:168984018-168984040 TTTCTCTCTCTCACCCAGGCTGG - Intronic
1001553567 5:172621353-172621375 TAGCACAGTTGCACCCAGGCTGG - Intergenic
1001607985 5:172977080-172977102 TTGCTCTGTCTCACCCAGGTTGG - Intergenic
1001954797 5:175841782-175841804 AAGGTCACTCCCACCCAGGCAGG - Intronic
1002258434 5:177977361-177977383 TCGCTCTGTTTCACCCAGGCTGG - Intergenic
1002472492 5:179444467-179444489 TTGCTCTCTGTCACCCAGGCTGG - Intergenic
1003004083 6:2364416-2364438 TGTCTCACTCTCACCCAGGCTGG - Intergenic
1003186202 6:3832887-3832909 TCGCTCTGTCTCACCCAGGTTGG + Intergenic
1004038466 6:11949590-11949612 TTGTTCAGTACCATCCAGGAAGG + Intergenic
1004391383 6:15212483-15212505 TTGCTCTGTCACCACCAGGCTGG - Intergenic
1004631326 6:17424368-17424390 TTGCTCTGTGTCGCCCAGGCTGG - Intronic
1005664172 6:28033964-28033986 TTTCTCAGGCAGACCCAGGCTGG + Intergenic
1006085746 6:31593697-31593719 TGGCTCTGTCTCACCCAGGCTGG + Intergenic
1006542318 6:34750387-34750409 TCACTCTGTCCCACCCAGGCTGG - Intergenic
1006656469 6:35598250-35598272 TTGCTCTGTCTCACCCAGGCTGG + Intronic
1007187534 6:39985065-39985087 CTGCTCATTACCACTCAGGCTGG - Intergenic
1007766695 6:44164917-44164939 TTACTCTCTGCCACCCAGGCTGG + Intronic
1007888044 6:45255449-45255471 TCGCTCTCTCTCACCCAGGCTGG + Intronic
1008390519 6:50946315-50946337 TCGCTCTGTTGCACCCAGGCTGG + Intergenic
1009433413 6:63591232-63591254 TTGCTCTGTCTCACCCAGGCTGG - Intergenic
1010354950 6:74921775-74921797 TCGCTCTGTCACTCCCAGGCTGG - Intergenic
1011585137 6:88916441-88916463 TGTCTCACTCTCACCCAGGCAGG - Intronic
1011660294 6:89588961-89588983 TCGCTCTGTCTCACCCAGGCTGG - Intronic
1013945200 6:115714855-115714877 TTGCTCAGTCTCTCCCCAGCTGG - Intergenic
1013991375 6:116258046-116258068 TCGCTCTGTCACAGCCAGGCTGG + Intronic
1014601302 6:123416729-123416751 TTGCTCTGTTGCACTCAGGCTGG + Intronic
1014927933 6:127296975-127296997 TTGCTCTGTCTCACCCAGGCTGG - Intronic
1015035088 6:128644085-128644107 TTGCTCACTGCCACACTGGCTGG + Intergenic
1015442684 6:133267410-133267432 TCACTCTGTCACACCCAGGCTGG + Intronic
1015513951 6:134066462-134066484 TCGCTCTGTCTCACCCAGTCTGG - Intergenic
1015673018 6:135712102-135712124 AGTCTCAGTCTCACCCAGGCTGG + Intergenic
1015799360 6:137044767-137044789 CTGCTCAGTCCCACGCCCGCTGG + Exonic
1016949865 6:149568859-149568881 TCGCTCTGTCTCACACAGGCTGG + Intronic
1017042829 6:150321757-150321779 TTTCTCAGCCCCTCCCATGCAGG + Intergenic
1017309695 6:152960620-152960642 TAGCTCTGTCACCCCCAGGCTGG + Intergenic
1017437989 6:154435755-154435777 GTGCTGAGTGCCACCCAGGCTGG - Intronic
1017640153 6:156485069-156485091 TTACTCACTGCCACCCAGGCTGG - Intergenic
1018542602 6:164898616-164898638 TTTCTCAGTCCCAGCCAGTCTGG - Intergenic
1018633916 6:165843874-165843896 TAGCTCAGTGCCACCCACACAGG - Intronic
1018680266 6:166258643-166258665 CTGTTCCTTCCCACCCAGGCTGG + Intergenic
1018699886 6:166418056-166418078 TCGCTCTGTCTCACCCAGGCTGG - Intronic
1019550824 7:1601697-1601719 TTGCTCTGTCCAGCCCAGGCTGG + Intergenic
1019551084 7:1602884-1602906 TTGCTCTGTCCAGCCCAGGCTGG - Intergenic
1019569664 7:1704986-1705008 TCTCGCAGACCCACCCAGGCTGG - Intronic
1019609858 7:1930892-1930914 ATGCTCAGGGCCAGCCAGGCCGG + Intronic
1019699628 7:2468366-2468388 GGGCTCAGCACCACCCAGGCAGG - Intergenic
1019780860 7:2938827-2938849 CTCCTCCCTCCCACCCAGGCCGG - Exonic
1019948327 7:4348328-4348350 TCGCTCTGTTACACCCAGGCTGG + Intergenic
1019950180 7:4365881-4365903 TCGCTGTGTCTCACCCAGGCTGG + Intergenic
1020187906 7:5972871-5972893 TTGTTCTATCTCACCCAGGCTGG + Intergenic
1020190558 7:5993829-5993851 TCGCTCTGTCACCCCCAGGCTGG - Intronic
1020200408 7:6075460-6075482 TTGCTCTGTCTTGCCCAGGCTGG + Intergenic
1020295011 7:6751899-6751921 TTGCTCTATCTCACCCAGGCTGG - Intergenic
1020410567 7:7887630-7887652 TTGCTCTGTTGCTCCCAGGCTGG + Intronic
1021319045 7:19188166-19188188 TTTCTCACTGTCACCCAGGCTGG - Intergenic
1022064143 7:26833364-26833386 TTGCTCTTTGTCACCCAGGCTGG - Intronic
1022065345 7:26849653-26849675 TCACTCTGTCGCACCCAGGCTGG - Intronic
1023886933 7:44364820-44364842 TTGCTCTGTCACCCCCAGGCTGG + Intergenic
1024151119 7:46571957-46571979 TCACTCTGTCACACCCAGGCTGG - Intergenic
1024222289 7:47298250-47298272 GTCCTCAGCCCCATCCAGGCTGG - Intronic
1024633405 7:51267602-51267624 TTGCTCTCTGTCACCCAGGCTGG + Intronic
1024643029 7:51347302-51347324 TTACTCTGTCTCACCCAGGCTGG + Intergenic
1025001651 7:55320347-55320369 TTGCTGTGTGTCACCCAGGCTGG - Intergenic
1025120538 7:56298016-56298038 TTGCTCTGTCTTCCCCAGGCTGG + Intergenic
1026010257 7:66630235-66630257 TTACTCTATCACACCCAGGCTGG - Intronic
1026344229 7:69460519-69460541 TTTCTCTGTTTCACCCAGGCTGG - Intergenic
1026593762 7:71717273-71717295 TTGCTCTGTCCAGCCCAGGCTGG + Intergenic
1026646282 7:72172122-72172144 TTGCTTAGTCACAATCAGGCTGG - Intronic
1026863266 7:73807614-73807636 TCGCTCTGTCTTACCCAGGCTGG - Intronic
1027192066 7:76002490-76002512 TGGCTCAGTGCTACCCAGGGAGG + Intronic
1027382074 7:77621637-77621659 TCGCTCTGTCACACCCAGGCTGG - Intronic
1027425152 7:78054687-78054709 TTGCTCTCTGTCACCCAGGCTGG + Intronic
1028875922 7:95823333-95823355 TTGCTCCGTGCCAGCCAGCCAGG - Intronic
1028948241 7:96604887-96604909 TTGCTCTGTCTCGCCCAGGCTGG - Intronic
1029369845 7:100142207-100142229 TTTCTCTGTGTCACCCAGGCTGG - Intergenic
1030044730 7:105484890-105484912 TTGCTCTGTGTCGCCCAGGCTGG + Intronic
1030766893 7:113421347-113421369 TTACTCTGTCGCGCCCAGGCTGG - Intergenic
1032244248 7:130194411-130194433 TTGCTCTTTATCACCCAGGCTGG - Intronic
1032277841 7:130475327-130475349 ATGCTCCGTGTCACCCAGGCAGG + Intergenic
1032391945 7:131560981-131561003 TGGCTCAGCCCCACCCGGGGAGG + Intergenic
1032710553 7:134457106-134457128 GGGCTCAGTGTCACCCAGGCTGG - Intronic
1033733423 7:144199760-144199782 TTGCTCTGTCCAGCCCAGGCTGG + Intergenic
1033749629 7:144351213-144351235 TTGCTCTGTCCAGCCCAGGCTGG - Intergenic
1034278101 7:149832910-149832932 CTGCCCAGACCCACCCTGGCAGG - Intergenic
1034413901 7:150955214-150955236 GTTCTCATTCCCTCCCAGGCTGG - Intronic
1034454791 7:151162834-151162856 TTGCTCGTTGCCCCCCAGGCTGG + Intronic
1034652827 7:152705731-152705753 TTGCTCTGTCTTGCCCAGGCTGG + Intergenic
1034940721 7:155228536-155228558 TTGCTCACTTCCACCAGGGCTGG + Intergenic
1035819045 8:2571893-2571915 TGGCTCAGTCGCACCGAGGGGGG + Intergenic
1036073833 8:5472974-5472996 TCGCTCTGTCTCACCCAGGCTGG + Intergenic
1036208166 8:6820219-6820241 GTGCACAGACCCATCCAGGCCGG - Intronic
1036951219 8:13141223-13141245 TTGCACTGTGTCACCCAGGCTGG - Intronic
1037129299 8:15388616-15388638 TTTCTCACTGTCACCCAGGCTGG - Intergenic
1037974528 8:23200232-23200254 CTGGTCAGGCCCATCCAGGCAGG - Intronic
1038181828 8:25236253-25236275 CTGCTCAGACCCATCCAGGACGG - Intronic
1038467845 8:27782289-27782311 AGGCTCACTCTCACCCAGGCTGG + Intronic
1038621947 8:29152639-29152661 TTGCTCTCTGTCACCCAGGCTGG + Intronic
1038655336 8:29445600-29445622 TCGCTCTGTCGCGCCCAGGCTGG + Intergenic
1039060643 8:33569559-33569581 TTGCTCTGTGTCGCCCAGGCTGG + Intergenic
1040085801 8:43339476-43339498 TTGCTCCCTCACCCCCAGGCAGG - Intergenic
1040341185 8:46441943-46441965 TTGCTGTCTCACACCCAGGCTGG - Intergenic
1041458214 8:58082977-58082999 TTGCTCTGTGTCACTCAGGCTGG - Intronic
1042459044 8:69041076-69041098 TCACTCTGTCTCACCCAGGCTGG + Intergenic
1042916531 8:73880758-73880780 AGTCTCAGTCTCACCCAGGCTGG + Intergenic
1044672729 8:94699608-94699630 TTGCTCTTTGTCACCCAGGCTGG - Intronic
1045028138 8:98109162-98109184 TTACTCAGTGCCACTGAGGCTGG - Intronic
1045968816 8:108056591-108056613 TGGCTCTGTGTCACCCAGGCTGG - Intronic
1046098248 8:109585449-109585471 TTGCTCAGAGCCACACAGCCTGG + Intronic
1046937780 8:119902367-119902389 TTACTCTGTCTCACCCAAGCTGG + Intronic
1047208467 8:122821732-122821754 AGTCTCAGTCTCACCCAGGCTGG + Intronic
1047243849 8:123120640-123120662 TTGCTCTGTCTTGCCCAGGCTGG - Intronic
1047607637 8:126490820-126490842 TAGCTCTGTCGCCCCCAGGCTGG + Intergenic
1047756337 8:127921781-127921803 TCTCGCAGTCTCACCCAGGCTGG - Intergenic
1049257338 8:141620977-141620999 CTGCTCAGTTCCTCCCTGGCTGG - Intergenic
1049599430 8:143500143-143500165 GTGCTGAGGCCCACCCAGGATGG - Intronic
1050612320 9:7365758-7365780 TTGCTCTGTCCCCGCCAGGCTGG - Intergenic
1050620759 9:7449858-7449880 TGCCTTATTCCCACCCAGGCAGG + Intergenic
1051075646 9:13231524-13231546 TTGCTCTTTGTCACCCAGGCTGG - Intronic
1051268751 9:15334320-15334342 TCGCTCTGTCGCACCCAGGCTGG - Intergenic
1051279570 9:15428079-15428101 TTGCGCTGTGTCACCCAGGCTGG - Intronic
1051691659 9:19719611-19719633 TTCCTAAGTGCAACCCAGGCTGG - Intronic
1051995054 9:23204915-23204937 TTGCTCTGTCACACACAGGCTGG - Intergenic
1052046079 9:23795511-23795533 TTGCTCTGTCTCGCTCAGGCTGG - Intronic
1052959652 9:34284238-34284260 TTGCTCTGTCCAGCCCAGGCTGG - Intronic
1054417422 9:64890154-64890176 CAGCTCAGTCCCATCCAGGATGG - Intergenic
1054961463 9:70974895-70974917 TTGCTCTGTCACGCCCAGGCTGG + Intronic
1056238456 9:84619499-84619521 TTGCTCTGTCTGGCCCAGGCTGG + Intergenic
1056615785 9:88164313-88164335 TGGCTCAGTCCCTCCAGGGCTGG + Intergenic
1057341569 9:94206818-94206840 TTGCTCTCTCTCTCCCAGGCTGG + Intergenic
1057457438 9:95227310-95227332 AGGCTCAGTCCCAGCCAGGTAGG + Intronic
1057722595 9:97544977-97544999 TCGCTCTGTTGCACCCAGGCTGG - Intronic
1057852767 9:98577947-98577969 TTGCAGAGTCCCTCCAAGGCTGG - Exonic
1057904467 9:98973625-98973647 AAACTCAGCCCCACCCAGGCTGG - Intronic
1059188083 9:112295207-112295229 TTGCTCTGTCTCGCCCAGGCTGG - Intronic
1059481140 9:114590823-114590845 TCGCTCTGTCGCCCCCAGGCAGG + Intronic
1059989413 9:119851009-119851031 TTGCTCAATACCTCCCAAGCTGG - Intergenic
1060500994 9:124155145-124155167 TTGCTCTGTCTTGCCCAGGCTGG - Intergenic
1060554814 9:124502860-124502882 CTTCTCAGCCCAACCCAGGCTGG + Intronic
1060579346 9:124730259-124730281 TTGCTCTGTGTCACCTAGGCTGG + Intronic
1061886319 9:133592752-133592774 GTTCCAAGTCCCACCCAGGCCGG + Intergenic
1062093896 9:134693041-134693063 ATTCTCACTCTCACCCAGGCTGG - Intronic
1185866525 X:3629269-3629291 TTGCTCTGTTGCCCCCAGGCTGG + Intronic
1186213663 X:7276439-7276461 GGTCTCAGTCTCACCCAGGCTGG - Intronic
1186422844 X:9439977-9439999 TTGCTCCGTCTCACCCAGTCTGG - Intergenic
1186461759 X:9753789-9753811 ATGCTCAGTCCCACCTGGGAAGG + Intronic
1186748533 X:12596518-12596540 TTGTTCAGACCCACTCAAGCAGG - Intronic
1186887293 X:13926376-13926398 TCGCTCTGTGTCACCCAGGCTGG - Intronic
1186972118 X:14858363-14858385 TTGCTCTGTCATGCCCAGGCTGG - Intronic
1187024586 X:15420805-15420827 TTTCTCTGTGTCACCCAGGCTGG - Intronic
1188367221 X:29331135-29331157 TCGCTCTGTCACACCCAGGCTGG - Intronic
1188702656 X:33283492-33283514 TTGCTCTTTGTCACCCAGGCTGG - Intronic
1189679357 X:43499367-43499389 TCACTCTGTCGCACCCAGGCTGG + Intergenic
1189679805 X:43504232-43504254 TTGCTTAGGCCCAGCCTGGCTGG + Intergenic
1189739887 X:44106753-44106775 TTGCTCTTTCCCAAGCAGGCAGG - Intergenic
1189784443 X:44546596-44546618 TTGCTCTGTCTCACCCAGGCTGG - Intergenic
1189833150 X:44995499-44995521 TTGCTCTGTCTCCCCCAGGCTGG + Intronic
1189968848 X:46397573-46397595 TCGCCCTGTCCCCCCCAGGCTGG - Intergenic
1190067763 X:47253823-47253845 TTGCTCTGTCTCACCCAGGCTGG + Intergenic
1191112743 X:56820209-56820231 TTGCTCTGTCATGCCCAGGCTGG - Intergenic
1192108965 X:68344580-68344602 TTGCCCAGTGTCCCCCAGGCTGG - Intronic
1192404946 X:70875144-70875166 TCGCTCTGTCTCGCCCAGGCTGG - Intronic
1192449617 X:71235819-71235841 TTTCACACTGCCACCCAGGCTGG + Intergenic
1192493401 X:71596184-71596206 AGTCTCACTCCCACCCAGGCTGG - Intronic
1192744622 X:73926743-73926765 TTGCTCTCTGTCACCCAGGCTGG + Intergenic
1192745613 X:73935425-73935447 TTGTTCTGCCTCACCCAGGCTGG + Intergenic
1193568308 X:83107697-83107719 CAGCTCACTCTCACCCAGGCTGG - Intergenic
1195100354 X:101549814-101549836 TTGCTCTCTGTCACCCAGGCTGG + Intergenic
1195268190 X:103204318-103204340 TCGCTCTGTTGCACCCAGGCTGG + Intergenic
1195667316 X:107443082-107443104 ATCCTCAGCCCCACCCAGACAGG + Intergenic
1196084354 X:111668153-111668175 TTGCCCTGTCCCCCCCATGCTGG - Intronic
1197352922 X:125399914-125399936 TTGCTCTGTCACCCCCAGGCTGG - Intergenic
1197701745 X:129605011-129605033 TTGCTGAGTCCCACCAAGAATGG + Intergenic
1198229652 X:134676879-134676901 TTGCCCAAGGCCACCCAGGCAGG - Intronic
1200133115 X:153862234-153862256 GTTCCCAGTCCCAGCCAGGCTGG + Exonic
1200164018 X:154023820-154023842 ATGCTCTTTCCCACCCAGCCTGG - Intronic
1200797342 Y:7353013-7353035 TTGCTCTGTTGCCCCCAGGCTGG - Intergenic
1201257458 Y:12123169-12123191 TTTCTCTCTGCCACCCAGGCTGG + Intergenic
1201708866 Y:16967384-16967406 TTGCTCTGTCACACCCAGTCTGG + Intergenic
1201786745 Y:17791643-17791665 ATTCTCACTCTCACCCAGGCAGG - Intergenic
1201814808 Y:18114345-18114367 ATTCTCACTCTCACCCAGGCAGG + Intergenic
1202262838 Y:22987577-22987599 TTGGTGAGCCACACCCAGGCAGG - Intronic
1202415828 Y:24621318-24621340 TTGGTGAGCCACACCCAGGCAGG - Intronic
1202454959 Y:25048768-25048790 TTGGTGAGCCACACCCAGGCAGG + Intronic