ID: 1095982881

View in Genome Browser
Species Human (GRCh38)
Location 12:47982855-47982877
Sequence CCCGGCACTCCTGGCACTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095982881_1095982894 6 Left 1095982881 12:47982855-47982877 CCATCAGTGCCAGGAGTGCCGGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1095982894 12:47982884-47982906 ACGGGGACCCTGGAGGCCCTGGG 0: 1
1: 0
2: 0
3: 40
4: 295
1095982881_1095982891 -1 Left 1095982881 12:47982855-47982877 CCATCAGTGCCAGGAGTGCCGGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1095982891 12:47982877-47982899 GGAGGCCACGGGGACCCTGGAGG 0: 1
1: 0
2: 2
3: 45
4: 459
1095982881_1095982897 13 Left 1095982881 12:47982855-47982877 CCATCAGTGCCAGGAGTGCCGGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1095982897 12:47982891-47982913 CCCTGGAGGCCCTGGGCACCGGG 0: 1
1: 1
2: 9
3: 74
4: 566
1095982881_1095982890 -4 Left 1095982881 12:47982855-47982877 CCATCAGTGCCAGGAGTGCCGGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1095982890 12:47982874-47982896 CGGGGAGGCCACGGGGACCCTGG 0: 1
1: 0
2: 3
3: 36
4: 429
1095982881_1095982893 5 Left 1095982881 12:47982855-47982877 CCATCAGTGCCAGGAGTGCCGGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1095982893 12:47982883-47982905 CACGGGGACCCTGGAGGCCCTGG 0: 1
1: 0
2: 3
3: 73
4: 612
1095982881_1095982895 12 Left 1095982881 12:47982855-47982877 CCATCAGTGCCAGGAGTGCCGGG 0: 1
1: 0
2: 0
3: 18
4: 171
Right 1095982895 12:47982890-47982912 ACCCTGGAGGCCCTGGGCACCGG 0: 1
1: 1
2: 10
3: 55
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095982881 Original CRISPR CCCGGCACTCCTGGCACTGA TGG (reversed) Exonic
900293424 1:1935617-1935639 CCTGGCATTCCTGACAGTGACGG + Intronic
900590925 1:3459504-3459526 CCCGGCCCTCATTGCCCTGAAGG - Intronic
902160977 1:14530158-14530180 ACCTGCCCTCCTGGCACTGGGGG - Intergenic
902245930 1:15120372-15120394 CCAGGCAGCCCTGGCATTGAGGG + Intergenic
902376565 1:16032684-16032706 CCCCGCAACCCTGGCAGTGAGGG - Intronic
904027618 1:27514298-27514320 CCCAGCTGTCCTGGCACTGCAGG + Intergenic
905216578 1:36412598-36412620 GCTGGCACTGCTGGCACTGCTGG + Intergenic
905216579 1:36412607-36412629 GCTGGCACTGCTGGCACTGCTGG + Intergenic
905601075 1:39251972-39251994 GCTGGCACTGCTGGCACTGCAGG + Intronic
907559489 1:55375593-55375615 CCTGGCACTGCTGGCCCTGCTGG + Intergenic
908401237 1:63774447-63774469 CCCGCCGCTCCTGGCGCTGCTGG + Exonic
908768858 1:67577776-67577798 GCTGGCACTGCTGCCACTGAAGG + Intergenic
909335230 1:74465367-74465389 GGCGCCACTCCAGGCACTGAGGG + Intronic
909628119 1:77742283-77742305 CCCGGCACTATTGACACTTAGGG + Intronic
912867342 1:113269654-113269676 CTCTGCACTACTGGCCCTGAGGG - Intergenic
919479179 1:198065377-198065399 CCTGGCAGTGCTGGCAGTGAGGG - Intergenic
922021207 1:221706395-221706417 CCCGGCACTCTTGGAGCTGGAGG + Exonic
923433752 1:233949323-233949345 CCCAGCACTCCTGGCACACCAGG - Intronic
924647420 1:245891582-245891604 CCCGACATTGCTGTCACTGAGGG - Intronic
1063167643 10:3478611-3478633 CCAGGCATTGCTGGAACTGATGG + Intergenic
1064250035 10:13699887-13699909 CGCAGCTCTCCTGGCAGTGATGG - Intronic
1065590317 10:27256625-27256647 CCCGGGACCCCTAGCACTGCCGG + Intergenic
1067660434 10:48233194-48233216 CCTGACACTCCTGGCACCCAGGG + Intronic
1070850631 10:79559365-79559387 CCCGGCACTCCTGGATCCCACGG - Exonic
1070856587 10:79611922-79611944 CCCGGCACTCCTGGATCCCACGG + Exonic
1071678988 10:87685428-87685450 GCCTGCAATCCTGGCACTTACGG + Intronic
1073132681 10:101200374-101200396 CCCTGCACGCTTGACACTGAAGG + Intergenic
1077116584 11:887856-887878 CCAGGCACTCCTGGCAGAGCTGG + Intronic
1078663439 11:13305270-13305292 CCCTGCCCTCATGGCACAGATGG + Intronic
1083960388 11:66012002-66012024 CTCGGCACTCACGGCTCTGAGGG + Exonic
1083986380 11:66218447-66218469 CCTGGCACTCCTGGGACAGGTGG - Intronic
1089567148 11:119377839-119377861 CCAGGCGCTCCTGGCCCTGGGGG + Intronic
1092169015 12:6361838-6361860 CCCTGCACTGCTGGATCTGAGGG - Intronic
1093827458 12:23711015-23711037 CAAGGCACTCCTTGAACTGATGG - Intronic
1095982881 12:47982855-47982877 CCCGGCACTCCTGGCACTGATGG - Exonic
1097048591 12:56206304-56206326 CCCTGCCCTTCTGGCACTGAAGG - Exonic
1097799586 12:63899120-63899142 CCCAGCACTCCTAGCACTTTGGG + Intronic
1098217766 12:68238161-68238183 AAGGGCACTCCTGGGACTGAGGG + Intergenic
1101099269 12:101375501-101375523 CTCGGCACTCCTGACATTGTGGG - Intronic
1103050962 12:117779094-117779116 CCTGGCACACCTGGCTCTGAAGG - Intronic
1103340928 12:120220816-120220838 CCCTGCACCCTTGGCCCTGATGG - Intronic
1103969407 12:124660661-124660683 CCCGCCCCTCCTGCCACTGGGGG + Intergenic
1105344474 13:19560626-19560648 CCCGACCCTGCTGGCCCTGATGG - Intergenic
1106146657 13:27055244-27055266 CTCGGGACTCCAGGTACTGAGGG - Intergenic
1110222474 13:73088528-73088550 ACCTGCAATCCTGGCACTTAGGG + Intergenic
1110708118 13:78618538-78618560 CCCTGCACTCTTATCACTGAAGG + Intronic
1111449059 13:88390639-88390661 CCCCGAACTCCTGGCATTGAGGG + Intergenic
1113422192 13:110179351-110179373 CCCGGCATTCCTGGCACACCCGG - Exonic
1116835793 14:49768195-49768217 CCCGGGACTCGGGGCACTGCAGG - Exonic
1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG + Intergenic
1117072587 14:52069552-52069574 CCGGGCGCTCCTGGCTCTGGAGG + Intergenic
1117565624 14:56991127-56991149 CCCGGCACTCGGAGCAATGAGGG + Intergenic
1118212390 14:63777750-63777772 CCCGGAACTCCTGGGCCTAAGGG + Intergenic
1118837394 14:69486509-69486531 CCCAGCTCTCCTGGCCCTGGGGG - Intronic
1122575223 14:102737706-102737728 CCCTGGCCTCATGGCACTGATGG - Intergenic
1122924268 14:104892491-104892513 CCTGGCACTCCTCACACTGAGGG - Intronic
1128235713 15:66065889-66065911 CCCAGGTCTCCTGGCACAGAGGG + Intronic
1131116848 15:89801293-89801315 CCCTGAACTCCTGGCTCTGGAGG + Intronic
1132400980 15:101505101-101505123 CCCACCACTCTTGGCACCGAGGG + Intronic
1132693614 16:1192537-1192559 CATGGCCTTCCTGGCACTGAGGG - Intronic
1132747393 16:1442738-1442760 CCCAGCACGCTTGGCACCGAGGG + Intronic
1132862364 16:2077953-2077975 CCCGGCACGCCTGGCTCTCTCGG - Intronic
1132915419 16:2341168-2341190 CTCGTCACTCCTGGCACCGGGGG + Intergenic
1132997871 16:2832645-2832667 CCAGGCTCGCCTGGCACTGGGGG + Intronic
1134762158 16:16723962-16723984 CCAGGAATTCCTGGAACTGAGGG - Intergenic
1134983902 16:18635208-18635230 CCAGGAATTCCTGGAACTGAGGG + Intergenic
1135686196 16:24500158-24500180 CCAGGCACTCTTTGAACTGATGG - Intergenic
1137751538 16:50864542-50864564 CCCAGCAGGCCTGGCACAGAGGG - Intergenic
1139306811 16:65993613-65993635 CCTGGCACCCTTGGCACAGATGG + Intergenic
1140079645 16:71733055-71733077 CCCCTCAGTCCTGGCAATGAGGG - Exonic
1143112078 17:4558524-4558546 CCCAGAACTGCTGGCACTGTTGG - Exonic
1147334086 17:39716389-39716411 CCACGCACTCCTGGCCCCGAAGG - Exonic
1151553308 17:74834327-74834349 CCCGCCACTCCTGACTCTGAGGG - Intronic
1152064334 17:78102193-78102215 CCCGTCTCTCCTGGCACAGATGG + Intronic
1152708832 17:81860209-81860231 CCCGGCGCGCCCGGAACTGAAGG - Intronic
1157158931 18:45295141-45295163 CAGGCCACTCCTGGCACAGAGGG + Intronic
1160923617 19:1532412-1532434 ACCGGTAATCCTGGCACTGTGGG + Intronic
1161326549 19:3667071-3667093 CCAGGCACCCCTGCCACTGAGGG + Intronic
1162216727 19:9140622-9140644 CCCGTGACCCCTGGAACTGAGGG - Intronic
1163167512 19:15508249-15508271 CCCCGCCCTCCTGCCACTGCTGG - Intergenic
1163741010 19:19012369-19012391 CCAGTCACTCATGGCTCTGATGG + Intronic
1164629066 19:29749261-29749283 CCCCGCCCTCCCGGCACAGATGG - Intergenic
1165407973 19:35642330-35642352 GCCTGGACTCCTGGCTCTGAGGG + Intronic
1166525565 19:43507685-43507707 GCCTGGACTCCTGGCTCTGAGGG - Intronic
1166662117 19:44654089-44654111 GCCTGGACTCCTGGGACTGAGGG + Intronic
1166689192 19:44812602-44812624 CCCTGGACTCCTGGGTCTGAGGG + Intronic
1167003019 19:46756905-46756927 CCCGGCACTGCTGAGTCTGACGG + Exonic
1167248727 19:48390015-48390037 CCCTGGACTCCTGGGTCTGAGGG - Intronic
1167249446 19:48392446-48392468 CCCTGAACTCCTGGGTCTGAGGG - Intergenic
1167564984 19:50250523-50250545 CCCTGGACTCCTGGCCCTGCTGG + Exonic
1167668877 19:50838634-50838656 GCCGGGACTCCTGGGACTGAGGG + Intergenic
1167669005 19:50839025-50839047 GCCCGCACTCCTGGGTCTGAGGG + Intergenic
1167689339 19:50975494-50975516 GCCTGCACTCCTGGGTCTGAGGG + Intergenic
1167738310 19:51310705-51310727 ACCTGGACTCCTGGCTCTGAGGG + Intergenic
1168092582 19:54095639-54095661 CCCGGGAATCCTGGGTCTGAGGG + Exonic
1168245918 19:55113180-55113202 GCCAGGACTCCTGGCTCTGAAGG - Intronic
1168250215 19:55137560-55137582 GCCTGCACTCCTGGGTCTGAGGG - Intronic
1168250299 19:55137811-55137833 CCCTGAACTCCTGGGTCTGAGGG - Intronic
1168277300 19:55284967-55284989 GCCTGCACTCCTGGGTCTGAAGG + Intronic
1168292007 19:55361622-55361644 CCCTGGACTCCTGGGTCTGAGGG - Intronic
1168292085 19:55361869-55361891 CCCTGGACTCCTGGGTCTGAGGG - Intronic
1168292109 19:55361941-55361963 CCCTGGACTCCTGGGTCTGAGGG - Intronic
1168295313 19:55375046-55375068 TCCGGGACTCCTGGGTCTGAGGG - Intergenic
1168295363 19:55375167-55375189 CCCTGGACTCCTGGGTCTGAGGG - Intergenic
1168306249 19:55437869-55437891 GCCTGCACTCCTGGGTCTGAAGG - Intronic
926174273 2:10575094-10575116 TCCAGCACTCCTGTCACAGAGGG + Intronic
926429114 2:12767766-12767788 CGCCGCACTGCTGGCACTGCCGG - Intergenic
927434251 2:23053588-23053610 CCCTGCAGGCCTGGCTCTGAGGG + Intergenic
928226746 2:29455907-29455929 CCCTGCACTCCTAGCATTGTGGG + Intronic
932876855 2:75461509-75461531 CCTTGCTTTCCTGGCACTGAAGG - Intergenic
932993457 2:76817181-76817203 GCATGCACTCCTGGCACTCATGG - Intronic
943106165 2:183546899-183546921 CCCGCCACCCCGGGCACTGAGGG - Intergenic
943528224 2:189045834-189045856 CCTGGAACTCCTGGCCCTGTGGG - Exonic
947713599 2:232329277-232329299 CCCAGCACTCCTGGGACTGTGGG + Intronic
947733036 2:232441514-232441536 CCCAGCACTCCTGGCCCTGTGGG + Intergenic
948893517 2:240917998-240918020 CCAGGCACTCCTGGGGCAGAAGG + Intergenic
1169215847 20:3794564-3794586 CCCTTCCCTCCTGGCACTAAGGG + Intronic
1172759832 20:37314250-37314272 CCCGGCCCTCCTCCCACTGGTGG - Intronic
1174291323 20:49510948-49510970 CCCTTCTCTCCTGGGACTGAGGG - Intronic
1174503567 20:51002766-51002788 CTCCCCACGCCTGGCACTGAGGG + Intergenic
1175052230 20:56166345-56166367 CCAGGCACTTCTGGCACTTTTGG + Intergenic
1176303531 21:5111369-5111391 CCCTGCTCTCCTGGCGCTCAGGG + Intergenic
1178381900 21:32117019-32117041 CCCAGCATCCCTGTCACTGAGGG + Intergenic
1179853499 21:44150581-44150603 CCCTGCTCTCCTGGCGCTCAGGG - Intergenic
1180226063 21:46393186-46393208 CCAGGCCCTCCTGGCCCTGGAGG - Intronic
1183387354 22:37522550-37522572 CCCTCCACTCCTGGTACGGAGGG + Intergenic
1183735556 22:39642983-39643005 CCCGGCTGTCCTGGCTCTGAGGG - Intronic
1185375950 22:50482645-50482667 CCGGGCCCTCCAGGCACAGAGGG + Exonic
953019985 3:39107231-39107253 TCCGGCACTGCTGGCACTTGGGG + Intronic
953458626 3:43063534-43063556 CCAGGTACTACTGGCACTGCTGG + Intergenic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
955073814 3:55593962-55593984 ACCGTAACTTCTGGCACTGAAGG - Intronic
962841724 3:139238663-139238685 CCCCTCATTCCTGGGACTGAAGG - Intronic
968482956 4:844887-844909 CCCGGCACACCTGGGGCTGGGGG + Intergenic
969461628 4:7332164-7332186 TCCTGAGCTCCTGGCACTGAAGG - Intronic
971959748 4:33470923-33470945 CCAGCCACTCCGGGCACTGGTGG + Intergenic
983877391 4:172893162-172893184 CCCAGCAATCTTGGCACAGAAGG - Intronic
986836758 5:11647465-11647487 CCAGTCACTCCAGCCACTGAAGG + Intronic
987099170 5:14577364-14577386 CCCGCCAGCCCTGGCAGTGAGGG + Intergenic
987374120 5:17218150-17218172 CCCGGGACTCAACGCACTGAGGG - Intronic
990869471 5:60415563-60415585 CCCGCCACCCCGGGCAGTGAGGG + Intronic
990996401 5:61736422-61736444 CTCGACTCTGCTGGCACTGAGGG + Intronic
997282333 5:132656736-132656758 AGCGGCACTCCAGGCACTGGGGG + Intronic
998218788 5:140258307-140258329 CCAGCCACTCCAGGGACTGAGGG - Intronic
1001907402 5:175484426-175484448 CCCCGCACACCTGGTACTGACGG - Intronic
1002082992 5:176748514-176748536 CCGGGCACTCCTGGCCCTCACGG + Intergenic
1004451714 6:15753834-15753856 CACAGCCCACCTGGCACTGAAGG - Intergenic
1006016515 6:31085668-31085690 CCCTGAATTCCTGGCACTAATGG + Intergenic
1006297621 6:33176999-33177021 CCCGGCATGCCTGGCTCAGACGG - Exonic
1007355275 6:41310471-41310493 CCCACCACTCCTGGGACTGGAGG - Intergenic
1008447430 6:51609515-51609537 CCTGTCACTCATGGAACTGATGG + Intergenic
1008778190 6:55066760-55066782 CCTGCCTCTTCTGGCACTGAGGG - Intergenic
1012034032 6:94108745-94108767 CCTGGCACTTCTGGGACAGATGG + Intergenic
1015485284 6:133763131-133763153 CCCTGCACTCATAGCTCTGACGG - Intergenic
1018175155 6:161172222-161172244 CCTTGCACTTCTCGCACTGAGGG - Intronic
1019778122 7:2924384-2924406 CCCGCCACCCCTGGTACTGATGG - Intronic
1024518058 7:50277497-50277519 CCTGGCCCTCCTGGCAGAGATGG + Intergenic
1027189036 7:75987359-75987381 CCTGCCACTCCTTGCACTGAGGG + Exonic
1028700907 7:93778294-93778316 TCCAGCACTCATGCCACTGAGGG - Intronic
1029436518 7:100566953-100566975 CTCGGCGCTCCTGGCATTAAGGG - Exonic
1029657268 7:101935546-101935568 CCGGGCACTCCTGGCCCAGCTGG + Intronic
1031605526 7:123763423-123763445 CCCGCCACCCCGGGCAGTGAGGG - Intergenic
1033810840 7:145009058-145009080 CCAGGAACTACTGTCACTGAAGG - Intergenic
1034451896 7:151141617-151141639 CTTGGCACCCCTGGCACTGCCGG - Intronic
1035305687 7:157929829-157929851 CCCGGGACACCAGGCACTGGAGG + Intronic
1035568652 8:658442-658464 CCCTGAACACCTGGCACTGTGGG + Intronic
1036708847 8:11065197-11065219 CCCGGCACCCATGGCAAAGAAGG + Intronic
1036810213 8:11862790-11862812 CCCGGCCCTCCGGGCTCTTAGGG + Intronic
1037582797 8:20255560-20255582 CCCTGCATTCCTGGAACTTAGGG + Intronic
1037750727 8:21680452-21680474 TCCTGCACTCCTGTCACTAATGG + Intergenic
1040747046 8:50656971-50656993 CCCGACCTTCCTGGCCCTGAGGG + Exonic
1041254941 8:55971989-55972011 CCAGGCCCTCCTGTCACCGAGGG - Intronic
1042089479 8:65143436-65143458 CACTGCACTCCTTGCAGTGACGG + Intergenic
1048373873 8:133804767-133804789 CCCGTGTATCCTGGCACTGAAGG - Intergenic
1049372819 8:142275850-142275872 CCTGGCACGACTGGCTCTGAGGG + Intronic
1057566408 9:96169435-96169457 CCCGGCACCCCTGGCAGTGCCGG + Intergenic
1059436905 9:114282517-114282539 CCTGGCACTCCAGGCCCTAAAGG + Exonic
1059471817 9:114510811-114510833 CCCTGCCCTCCTGGAGCTGATGG + Intergenic
1059769772 9:117414604-117414626 CCGGGCTCTCCTGGCTCTGCCGG - Exonic
1060480002 9:124012259-124012281 CCTGGCGCTCCTGGCGCTAACGG - Exonic
1061359682 9:130133075-130133097 CCCAGCACTCCTGTCTCTGTTGG + Intronic
1061485945 9:130920598-130920620 CCTGGGACTCCTGACACGGAAGG + Intronic
1061518464 9:131103250-131103272 CCCGGCTGACCTGGCAGTGATGG - Intronic
1186273467 X:7915424-7915446 CACTGCACTCCTGGCAGTAAGGG - Intronic
1187398226 X:18936285-18936307 TCCTGCACTCCTGGAGCTGAGGG - Intronic
1189303924 X:39972674-39972696 CCAGGCCTTCCTGGCAGTGATGG + Intergenic
1197969872 X:132103411-132103433 CCCGTCAGTCCTCCCACTGAAGG + Intronic
1198114833 X:133535039-133535061 CCCTGCTCTCATGGAACTGAAGG - Intergenic
1199713999 X:150492964-150492986 CTCTGCTCTCCTGTCACTGAAGG - Intronic
1201394792 Y:13536841-13536863 GCTGGCATTCCAGGCACTGATGG + Intergenic