ID: 1095983596

View in Genome Browser
Species Human (GRCh38)
Location 12:47985937-47985959
Sequence CCCGGCAACCGCGGTTTCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 589}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095983596_1095983603 2 Left 1095983596 12:47985937-47985959 CCTGGGAAACCGCGGTTGCCGGG 0: 1
1: 0
2: 1
3: 14
4: 589
Right 1095983603 12:47985962-47985984 CACCCTAAGGAGCCACAGGGAGG 0: 1
1: 0
2: 3
3: 14
4: 153
1095983596_1095983606 7 Left 1095983596 12:47985937-47985959 CCTGGGAAACCGCGGTTGCCGGG 0: 1
1: 0
2: 1
3: 14
4: 589
Right 1095983606 12:47985967-47985989 TAAGGAGCCACAGGGAGGAGAGG 0: 1
1: 1
2: 5
3: 55
4: 472
1095983596_1095983602 -1 Left 1095983596 12:47985937-47985959 CCTGGGAAACCGCGGTTGCCGGG 0: 1
1: 0
2: 1
3: 14
4: 589
Right 1095983602 12:47985959-47985981 GAGCACCCTAAGGAGCCACAGGG 0: 1
1: 0
2: 1
3: 7
4: 146
1095983596_1095983601 -2 Left 1095983596 12:47985937-47985959 CCTGGGAAACCGCGGTTGCCGGG 0: 1
1: 0
2: 1
3: 14
4: 589
Right 1095983601 12:47985958-47985980 GGAGCACCCTAAGGAGCCACAGG 0: 1
1: 0
2: 0
3: 17
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095983596 Original CRISPR CCCGGCAACCGCGGTTTCCC AGG (reversed) Exonic