ID: 1095983596

View in Genome Browser
Species Human (GRCh38)
Location 12:47985937-47985959
Sequence CCCGGCAACCGCGGTTTCCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 589}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095983596_1095983602 -1 Left 1095983596 12:47985937-47985959 CCTGGGAAACCGCGGTTGCCGGG 0: 1
1: 0
2: 1
3: 14
4: 589
Right 1095983602 12:47985959-47985981 GAGCACCCTAAGGAGCCACAGGG 0: 1
1: 0
2: 1
3: 7
4: 146
1095983596_1095983606 7 Left 1095983596 12:47985937-47985959 CCTGGGAAACCGCGGTTGCCGGG 0: 1
1: 0
2: 1
3: 14
4: 589
Right 1095983606 12:47985967-47985989 TAAGGAGCCACAGGGAGGAGAGG 0: 1
1: 1
2: 5
3: 55
4: 472
1095983596_1095983601 -2 Left 1095983596 12:47985937-47985959 CCTGGGAAACCGCGGTTGCCGGG 0: 1
1: 0
2: 1
3: 14
4: 589
Right 1095983601 12:47985958-47985980 GGAGCACCCTAAGGAGCCACAGG 0: 1
1: 0
2: 0
3: 17
4: 140
1095983596_1095983603 2 Left 1095983596 12:47985937-47985959 CCTGGGAAACCGCGGTTGCCGGG 0: 1
1: 0
2: 1
3: 14
4: 589
Right 1095983603 12:47985962-47985984 CACCCTAAGGAGCCACAGGGAGG 0: 1
1: 0
2: 3
3: 14
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095983596 Original CRISPR CCCGGCAACCGCGGTTTCCC AGG (reversed) Exonic
901377504 1:8849755-8849777 CGCTGCAACCGCTGCTTCCCGGG + Intergenic
901407031 1:9056259-9056281 CACGGCAACCTCCGCTTCCCAGG + Intronic
901883578 1:12207832-12207854 CCCTGCAACCTCCGCTTCCCGGG - Exonic
901958957 1:12809682-12809704 CGCCGCAACCTCGGCTTCCCGGG + Intergenic
902006087 1:13233289-13233311 CACTGCAACCTCTGTTTCCCAGG + Intergenic
902249093 1:15141574-15141596 CACTGCAACCACTGTTTCCCAGG - Intergenic
903205799 1:21781656-21781678 CACTGCAACCTCCGTTTCCCAGG - Intronic
903206666 1:21787462-21787484 CCCTGCAACCGCTGCCTCCCAGG - Intergenic
903415222 1:23177777-23177799 CCCGGCACCGGCGGCTTCCCAGG - Exonic
903481466 1:23656658-23656680 CCCTGCAACCTCCGCTTCCCAGG + Intergenic
903607669 1:24586684-24586706 CACTGCAACCTCCGTTTCCCGGG - Intronic
904063156 1:27726479-27726501 CCCCGCCGCCGCGGTCTCCCTGG + Intronic
904516201 1:31057325-31057347 CACTGCAACCACGGTCTCCCTGG - Intronic
904528049 1:31149415-31149437 CACTGCAACCTCCGTTTCCCGGG + Intergenic
904582478 1:31555877-31555899 CACTGCAACCTCCGTTTCCCGGG - Intergenic
904640333 1:31922405-31922427 CCCTGCAACCTCTGTCTCCCAGG - Intronic
904760007 1:32796218-32796240 CACTGCAACCTCTGTTTCCCAGG - Intronic
905558824 1:38909664-38909686 CACTGCAACCTCCGTTTCCCAGG - Intronic
905682566 1:39884556-39884578 CACTGCAACCTCCGTTTCCCCGG - Intergenic
905990882 1:42335679-42335701 CCCGGAATCCGCGGTGTGCCAGG - Intronic
906402083 1:45512159-45512181 CACTGCAACCTCGGTCTCCCGGG + Exonic
906544903 1:46613849-46613871 TCCGGCCACCGGGGATTCCCAGG + Intronic
907012699 1:50978127-50978149 CCCGGGAGCTGCGGGTTCCCCGG + Intergenic
907801277 1:57768099-57768121 CACTGCAACCTCGGTATCCCAGG - Intronic
908241439 1:62192419-62192441 CACTGCAACCTCCGTTTCCCAGG + Intergenic
908318577 1:62959156-62959178 CACTGCAACCTCTGTTTCCCGGG - Intergenic
909205386 1:72750278-72750300 CACTGCAACCTCTGTTTCCCGGG + Intergenic
909407691 1:75311190-75311212 CACTGCAACCTCCGTTTCCCAGG + Intronic
909631047 1:77770207-77770229 CACTGCAACCTCTGTTTCCCAGG - Intergenic
909876826 1:80816157-80816179 CACTGCAACCGCTGTCTCCCAGG - Intergenic
910062188 1:83106956-83106978 CACGGCAACCTCTGTCTCCCGGG - Intergenic
910880949 1:91921872-91921894 CACTGCAACCTCTGTTTCCCGGG - Intergenic
911208592 1:95117449-95117471 CCCGGAACCCGCGGCTTCCCTGG + Exonic
911597519 1:99813908-99813930 CACTGCAACCTCAGTTTCCCAGG - Intergenic
912846067 1:113075769-113075791 CCCTGCAACCTCTGCTTCCCAGG + Intronic
912886959 1:113484798-113484820 CCCTGCAACCTCTGTGTCCCGGG + Intronic
913466006 1:119143399-119143421 CCCTGCAACCTCTGTCTCCCTGG - Intergenic
914845336 1:151280811-151280833 CACGGCAACCTCCGTCTCCCAGG - Intronic
915487150 1:156229644-156229666 CACGGCAACCTCTGCTTCCCGGG + Intronic
915615687 1:157036395-157036417 CCCTGCAACCTCTGTCTCCCGGG + Intronic
916237236 1:162602672-162602694 CCCTGCAACCTCTGCTTCCCGGG + Intergenic
916952517 1:169795123-169795145 CCCAGCTAGCGCGGTTCCCCTGG + Intronic
916971110 1:170017179-170017201 CACTGCAACCTCTGTTTCCCGGG - Intronic
917160778 1:172054881-172054903 CACTGCAACCGCCGCTTCCCAGG - Intronic
917339927 1:173965513-173965535 CACTGCAACCGCTGTCTCCCAGG - Intronic
917371057 1:174294992-174295014 CACTGCAACCTCTGTTTCCCAGG + Intronic
917851625 1:179069444-179069466 CACTGCAACCGCTGTCTCCCGGG + Intronic
918037037 1:180883631-180883653 CACTGCAACCTCCGTTTCCCAGG - Intronic
919217021 1:194569835-194569857 CACTGCAACCTCTGTTTCCCAGG - Intergenic
919532437 1:198740504-198740526 CACTGCAACCTCGGCTTCCCAGG - Intronic
919576909 1:199321775-199321797 CACTGCAACCTCGGCTTCCCAGG + Intergenic
919909120 1:202099581-202099603 CCCTGCAACCTCTGCTTCCCAGG + Intergenic
920135571 1:203766407-203766429 CACTGCAACCTCTGTTTCCCGGG - Intronic
920234079 1:204491311-204491333 CCCTGCAACCTCCGTCTCCCAGG - Intronic
920271584 1:204768906-204768928 CACTGCAACCTCTGTTTCCCAGG + Intergenic
920603395 1:207353127-207353149 CACGGCAACCTCTGTTTCCCAGG + Intronic
921093348 1:211864000-211864022 CACTGCAACCTCCGTTTCCCAGG - Intergenic
921211461 1:212902950-212902972 CACTGCAACCTCTGTTTCCCAGG - Intergenic
921294079 1:213685552-213685574 CACGGCAACCTCTGCTTCCCAGG - Intergenic
922596634 1:226818752-226818774 CACCGCAACCTCCGTTTCCCAGG - Intergenic
922656709 1:227391086-227391108 CCCTGCAACCTCTGCTTCCCGGG - Intergenic
922677371 1:227561106-227561128 CCCGGCAACCCCGGGTCCACGGG - Intergenic
923595402 1:235357378-235357400 CACTGCAACCTCGGCTTCCCAGG - Intergenic
923716854 1:236432311-236432333 CCCTGCAACCTCTGCTTCCCAGG - Intronic
923865970 1:237939898-237939920 CACGGCAACCTCTGCTTCCCGGG - Intergenic
924111902 1:240708467-240708489 CACGGCAACCTCCGTCTCCCAGG + Intergenic
924569635 1:245226536-245226558 CCCTGCAACCTCCTTTTCCCAGG + Intronic
924799163 1:247314820-247314842 CACGGCAACCGCTGCTTCCCAGG + Intronic
1062898679 10:1125285-1125307 CACGGCAACCTCTGTCTCCCAGG + Intronic
1065034106 10:21620764-21620786 CCCTGCAACCTCCGTCTCCCAGG + Intronic
1065345850 10:24747521-24747543 CACTGCAACCGCTGCTTCCCAGG + Intergenic
1065899514 10:30192602-30192624 CCCTGCAACCTCTGCTTCCCAGG + Intergenic
1067968881 10:50946480-50946502 CACTGCAACCTCTGTTTCCCGGG + Intergenic
1068109690 10:52665396-52665418 CACTGCAACCTCGGCTTCCCGGG + Intergenic
1069444331 10:68458770-68458792 CCCGGCAACCTCCGCCTCCCAGG - Intronic
1069454840 10:68545907-68545929 CACCGCAACCTCCGTTTCCCGGG - Intergenic
1069468581 10:68664848-68664870 CACTGCAACCTCGGCTTCCCAGG + Intronic
1070278819 10:75033885-75033907 CTGGGCAACCGAGGTGTCCCTGG - Intergenic
1070603596 10:77882836-77882858 CACTGCAACCTCTGTTTCCCAGG - Intronic
1072075732 10:91971546-91971568 CCCTGCAACCGCTGCCTCCCGGG + Intronic
1072132538 10:92509515-92509537 CCCTGCAACCTCTGCTTCCCAGG - Intronic
1072425363 10:95325625-95325647 CACTGCAACCTCTGTTTCCCAGG + Intronic
1072989796 10:100181588-100181610 CACTGCAACCTCGGTCTCCCAGG + Intronic
1073029589 10:100514903-100514925 CACTGCAACCTCTGTTTCCCAGG - Intronic
1073236224 10:102018879-102018901 CACTGCAACCTCTGTTTCCCGGG - Intronic
1073499089 10:103919613-103919635 CACTGCAACCGCTGTCTCCCAGG - Intergenic
1073722187 10:106185062-106185084 CCCTGCAAACTCTGTTTCCCAGG - Intergenic
1073781351 10:106842307-106842329 CACTGCAACCGCCATTTCCCAGG + Intronic
1074903890 10:117843464-117843486 CACTGCAACCTCCGTTTCCCAGG + Intergenic
1075270414 10:121044626-121044648 CACTGCAACCTCGGCTTCCCGGG + Intergenic
1075394626 10:122118087-122118109 CACGGCAACCCCTGCTTCCCCGG + Intronic
1076926432 10:133491250-133491272 CACGGCAACCTCTGTCTCCCAGG + Intergenic
1078152264 11:8769311-8769333 CCCCGCAACCTCTGCTTCCCAGG + Intronic
1078629716 11:12991013-12991035 CACTGCAACCGCCGCTTCCCGGG - Intergenic
1080122992 11:28698862-28698884 CACGGCAACCTCTGTTTCCTGGG + Intergenic
1081465470 11:43312374-43312396 CCTGGGGACCGCGGTCTCCCTGG - Intronic
1081720626 11:45285974-45285996 CCCGGCAACCCCGCCTTGCCCGG + Intronic
1082020197 11:47526242-47526264 CACGGCAACCTCCGCTTCCCAGG - Intronic
1082831290 11:57619666-57619688 CACTGCAACCTCTGTTTCCCAGG + Intergenic
1083205040 11:61143734-61143756 CACGGCAACCTCCGCTTCCCGGG + Intronic
1083258812 11:61512179-61512201 CACTGCAACCTCAGTTTCCCAGG + Intergenic
1083603288 11:63961897-63961919 CCTGGCAACAGCTGTATCCCAGG + Intergenic
1083979983 11:66159359-66159381 CACGGCAACCTCCGTCTCCCGGG - Intronic
1084314835 11:68339421-68339443 CACTGCAACCTCTGTTTCCCAGG + Intronic
1085187771 11:74590971-74590993 CACCGCAACCTCGGTCTCCCAGG + Intronic
1085694674 11:78693937-78693959 CACGGCAACCTCTGTCTCCCGGG - Intronic
1086093918 11:83031601-83031623 CACCGCAACCTCCGTTTCCCGGG + Intronic
1086748994 11:90466570-90466592 CACTGCAACCTCGGTTTCCTGGG - Intergenic
1087208606 11:95422820-95422842 CACTGCAACCTCTGTTTCCCAGG + Intergenic
1087414582 11:97837743-97837765 CACTGCAACCTCGGTCTCCCGGG + Intergenic
1088692868 11:112342767-112342789 CCCTGCAACCTCTGCTTCCCAGG + Intergenic
1090194144 11:124800429-124800451 TCCGGCCACCGCGGTCTCCGGGG + Exonic
1091188200 11:133665841-133665863 CACGGCAACCTCCGTATCCCAGG + Intergenic
1091309761 11:134563995-134564017 CTCTGCAACCGCCATTTCCCGGG + Intergenic
1091430978 12:434426-434448 CCCTGCAACCGCTGCCTCCCAGG + Intronic
1091621179 12:2090391-2090413 CACTGCAACCTCGGTCTCCCAGG + Intronic
1091898303 12:4122409-4122431 CCCTGCAACCTCCGTCTCCCGGG + Intergenic
1092267533 12:6994281-6994303 CACGGCAACCTCCGCTTCCCAGG + Intronic
1092870986 12:12805599-12805621 CACTGCAACCTCGGTCTCCCGGG - Intronic
1093238711 12:16642273-16642295 CACGGCAACCTCTGTCTCCCAGG + Intergenic
1093475324 12:19548443-19548465 CACGGCAACCTCTGCTTCCCGGG + Intronic
1093736864 12:22630684-22630706 CACTGCAACCTCCGTTTCCCAGG + Intronic
1094187975 12:27665110-27665132 CCCTGCAACCTCCGCTTCCCGGG - Intronic
1094849551 12:34376279-34376301 CCAGGGAACCTGGGTTTCCCTGG - Intergenic
1095983596 12:47985937-47985959 CCCGGCAACCGCGGTTTCCCAGG - Exonic
1096292924 12:50357424-50357446 CACCGCAACCGCCGCTTCCCAGG - Intronic
1096489644 12:52006765-52006787 CCCAGCTCCCGCAGTTTCCCCGG + Intergenic
1096982302 12:55735400-55735422 CACGGCAACCTCCGTCTCCCGGG - Intergenic
1097385673 12:58947751-58947773 CACGGCAACCTCCATTTCCCGGG + Intergenic
1097861811 12:64525198-64525220 CACTGCAACCGCGGCTTTCCAGG - Intergenic
1100258214 12:92905528-92905550 CACTGCAACCTCGGTCTCCCGGG - Intronic
1100361339 12:93882343-93882365 CACTGCAACCTCCGTTTCCCGGG - Intronic
1100535659 12:95506370-95506392 CACGGCAACCTCCGCTTCCCGGG + Intronic
1100536145 12:95511465-95511487 CACGGCAACCTCCGCTTCCCGGG + Intronic
1100979003 12:100150158-100150180 CACTGCAACCTCCGTTTCCCAGG + Intergenic
1101003589 12:100380121-100380143 CCCCGCAACCTCTGCTTCCCAGG - Intronic
1101221879 12:102650035-102650057 CACTGCAACCCCCGTTTCCCGGG - Intergenic
1101454280 12:104813709-104813731 CACTGCAACCTCTGTTTCCCAGG + Intronic
1102277254 12:111592004-111592026 CACTGCAACCTCTGTTTCCCGGG - Intronic
1102281632 12:111623196-111623218 CCCTGCAGCCTCTGTTTCCCAGG + Intergenic
1102290572 12:111695936-111695958 CACTGCAACCTCTGTTTCCCGGG - Intronic
1102483541 12:113240820-113240842 CACTGCAACCTCGGCTTCCCAGG + Intronic
1102923742 12:116811449-116811471 CACTGCAACCTCTGTTTCCCAGG + Intronic
1104004487 12:124882502-124882524 CCCGCCCTCAGCGGTTTCCCAGG + Intronic
1104067111 12:125315272-125315294 CACGGCAACCTCCGTCTCCCAGG + Intronic
1104632261 12:130413555-130413577 CACTGCAACCTCTGTTTCCCAGG - Intronic
1104985544 12:132594640-132594662 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1105349226 13:19601314-19601336 CACTGCAACCTCTGTTTCCCGGG + Intergenic
1105879791 13:24593960-24593982 CACGGCAACCTCTGTCTCCCAGG - Intergenic
1105920057 13:24955134-24955156 CACGGCAACCTCTGTCTCCCAGG + Intergenic
1106051707 13:26196555-26196577 CACGGCAACCTCCGTCTCCCAGG - Intronic
1106131411 13:26942804-26942826 CACTGCAACCTCTGTTTCCCAGG + Intergenic
1106887050 13:34198510-34198532 CGCCGCAACCTCGGCTTCCCGGG + Intergenic
1109476985 13:62892304-62892326 CACCGCAACCGCGGCCTCCCAGG - Intergenic
1110368730 13:74717572-74717594 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1111585932 13:90284740-90284762 CACTGCAACCTCGGTCTCCCAGG + Intergenic
1112038369 13:95518681-95518703 CACTGCAACCTCCGTTTCCCAGG - Intronic
1112274613 13:98004969-98004991 CACCGCAACCGCCGTCTCCCGGG + Intronic
1112344901 13:98581091-98581113 CCCTGCAACCGCTGTCTCCCAGG + Intergenic
1113461573 13:110485753-110485775 CCCGGCATCCCCGGTTTGCCAGG + Exonic
1114293716 14:21310007-21310029 CACTGCAACCTCGGCTTCCCAGG - Intronic
1114518179 14:23314287-23314309 CCCTGCAACCTCCGTCTCCCGGG - Intronic
1115657195 14:35455129-35455151 CACTGCAACCGCCGTCTCCCAGG + Intergenic
1116617146 14:47154366-47154388 CCCGGCTCCCGCAGTTTCCATGG - Intronic
1116815317 14:49578634-49578656 CACTGCAACCTCGCTTTCCCCGG + Intronic
1117366765 14:55037039-55037061 CACTGCAACCTCTGTTTCCCAGG - Intronic
1117654126 14:57937141-57937163 CACGGCAACCTCCGCTTCCCAGG + Intronic
1119224005 14:72930053-72930075 CCCGGCAACCTCCATCTCCCCGG - Intronic
1119378736 14:74215252-74215274 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1120024663 14:79569682-79569704 CCCTGCAACCTCCGTCTCCCGGG + Intronic
1120441960 14:84553202-84553224 CACTGCAACCTCCGTTTCCCAGG + Intergenic
1120585711 14:86309361-86309383 CCCTGCAACCTCCGCTTCCCAGG - Intergenic
1120592727 14:86394887-86394909 CACGGCAACCTCGGCCTCCCGGG - Intergenic
1121286729 14:92741785-92741807 CACTGCAACCGCTGCTTCCCAGG - Intronic
1122332616 14:100933671-100933693 CACTGCAACCGCCATTTCCCGGG + Intergenic
1122407596 14:101509453-101509475 CCCTACAGCTGCGGTTTCCCCGG - Intergenic
1122706110 14:103623021-103623043 CCCTGCAACCTCTGTCTCCCAGG + Intronic
1123031459 14:105453733-105453755 CACTGCAACCTCCGTTTCCCGGG - Intronic
1123414961 15:20088702-20088724 CCCTGCAACCTCTGCTTCCCGGG + Intergenic
1123524303 15:21095816-21095838 CCCTGCAACCTCTGCTTCCCGGG + Intergenic
1124268449 15:28258394-28258416 CACGGCAACCTCTGTCTCCCGGG - Intronic
1124448841 15:29765814-29765836 CCCTGCAACCTCTGCTTCCCAGG - Intronic
1124487332 15:30130753-30130775 CACTGCAACCTCTGTTTCCCAGG + Intergenic
1124542422 15:30599727-30599749 CACTGCAACCTCTGTTTCCCAGG + Intergenic
1124756194 15:32407570-32407592 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1124947748 15:34286147-34286169 CCCTGCAACCGCCGCCTCCCGGG + Intronic
1125442372 15:39716888-39716910 CCCGGCAACCTCTGCCTCCCGGG + Intronic
1125564357 15:40664755-40664777 CCCTGCAACCTCTGTCTCCCGGG - Intergenic
1125702354 15:41698242-41698264 CACTGCAACCTCTGTTTCCCGGG + Intronic
1125806327 15:42496639-42496661 CACTGCAACCTCTGTTTCCCAGG - Intronic
1125985625 15:44048646-44048668 CACGGCAACCTCCGTCTCCCAGG + Intronic
1126079969 15:44950174-44950196 CACTGCAAGCTCGGTTTCCCTGG - Intergenic
1126319953 15:47411169-47411191 CACTGCAACCTCGGTTTCCTGGG + Intronic
1126353971 15:47775422-47775444 CCCTGCAACCTCTGTATCCCGGG + Intergenic
1126385780 15:48091965-48091987 CACTGCAACCTCTGTTTCCCAGG + Intergenic
1126479562 15:49102887-49102909 CACCGCAACCTCCGTTTCCCGGG - Intergenic
1126497609 15:49309694-49309716 CCCTGCAACCTCTGCTTCCCGGG + Intronic
1127259582 15:57318385-57318407 CCCAGCAACCTCCGCTTCCCAGG - Intergenic
1127996326 15:64155037-64155059 CACGGCAACCCCCGCTTCCCGGG + Exonic
1128104179 15:65030865-65030887 CACTGCAACCGCTGCTTCCCAGG + Intergenic
1128314450 15:66651743-66651765 CACTGCAACCTCGATTTCCCAGG - Intronic
1128439415 15:67690607-67690629 CACTGCAACCTCTGTTTCCCAGG + Intronic
1129082567 15:73052990-73053012 CCCGGCAGCCGCCCCTTCCCCGG - Intronic
1129614390 15:77086935-77086957 CACTGCAACCTCGGTCTCCCAGG + Intergenic
1130328368 15:82899944-82899966 CCCTGCAACCGCCGCCTCCCTGG - Intronic
1130514657 15:84617044-84617066 CCCCGCAACCTCTGTTCCCCGGG - Intronic
1130675057 15:85944945-85944967 CACTGCAACCTCGATTTCCCTGG + Intergenic
1131236548 15:90701838-90701860 CACGGCAACCTCCGTCTCCCAGG - Intergenic
1131581373 15:93646837-93646859 CGCTGCAACCTCCGTTTCCCAGG - Intergenic
1132173618 15:99689554-99689576 CACGGCAACCTCCGTCTCCCGGG + Intronic
1132330309 15:101008065-101008087 CACTGCAACCGCCGCTTCCCGGG - Intronic
1132796594 16:1726851-1726873 CCCGGCAACGGCTGTGGCCCCGG - Intronic
1132912536 16:2322120-2322142 CACTGCAACCGCTGTGTCCCAGG - Intronic
1133311431 16:4849022-4849044 CACGGCAACCTCCGCTTCCCGGG - Intronic
1133811300 16:9163046-9163068 CACTGCAACCTCCGTTTCCCAGG + Intergenic
1135078258 16:19412439-19412461 CACTGCAACCGCTGTCTCCCAGG + Intronic
1135580681 16:23623587-23623609 CACTGCAACCTCTGTTTCCCGGG + Intronic
1135761142 16:25139013-25139035 CACTGCAACCTCCGTTTCCCGGG + Intronic
1136027329 16:27477380-27477402 CACTGCAACCTCCGTTTCCCAGG + Intronic
1136272872 16:29158836-29158858 CCCGGGAGCCGCGGTGACCCAGG - Intergenic
1136540061 16:30923955-30923977 CCCGCCCACCGCCGGTTCCCGGG - Intronic
1136925861 16:34373181-34373203 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1136978713 16:35038625-35038647 CACTGCAACCTCTGTTTCCCAGG + Intergenic
1137261898 16:46837610-46837632 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1139126088 16:64079385-64079407 CACGGCAACCTCTGTCTCCCAGG - Intergenic
1139255957 16:65543038-65543060 CACTGCAACCTCCGTTTCCCAGG + Intergenic
1139510749 16:67427222-67427244 CCCGGCAGCCGTGGCTTCGCAGG + Intergenic
1139856967 16:69989101-69989123 CACCGCAACCGCTGCTTCCCAGG - Intergenic
1140365745 16:74378874-74378896 CACCGCAACCGCTGCTTCCCAGG + Intronic
1140452122 16:75079402-75079424 CCCCGCAACCTCTGCTTCCCTGG - Intronic
1140848435 16:78911788-78911810 CCCTGCAACCTCCGCTTCCCGGG - Intronic
1142076426 16:88120648-88120670 CCCGGGAGCCGCGGTGACCCAGG - Intergenic
1142301199 16:89259113-89259135 CCCTGCAACCTCCGTCTCCCGGG + Intergenic
1142337409 16:89498664-89498686 CACGGCAACCACCGTCTCCCGGG - Intronic
1142433284 16:90042011-90042033 CACTGCAACCTCCGTTTCCCAGG + Intronic
1142746617 17:1962431-1962453 CCCTGCAACCTCCGTCTCCCGGG + Intronic
1142835468 17:2582636-2582658 CACGGCAACCTCCGTCTCCCGGG + Intergenic
1142885654 17:2910799-2910821 CCCTGCAACCTCCGTCTCCCAGG + Intronic
1143232207 17:5366519-5366541 CTCTGCAACCTCTGTTTCCCGGG + Intronic
1143361809 17:6377193-6377215 CCTGGCAACCGCACCTTCCCAGG + Intergenic
1143892125 17:10110539-10110561 CACGGCAACCTCCGTCTCCCGGG + Intronic
1143910498 17:10244995-10245017 CACGGCAACCTCTGTCTCCCAGG + Intergenic
1144588409 17:16503098-16503120 CCCTGCAACCTCCATTTCCCAGG + Intergenic
1144694878 17:17296190-17296212 CACTGCAACCGCCGTCTCCCGGG + Intergenic
1145743131 17:27293135-27293157 CACTGCAACCTCCGTTTCCCGGG - Intergenic
1146015142 17:29227273-29227295 CACTGCAACCTCCGTTTCCCAGG + Intergenic
1146116813 17:30147885-30147907 CCCTGCAACCTCTGCTTCCCGGG + Intronic
1146117277 17:30152196-30152218 CACGGCAACCTCTGCTTCCCGGG + Intronic
1146606531 17:34263229-34263251 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1146753820 17:35408347-35408369 CACGGCAACCTCCGCTTCCCGGG - Intergenic
1146818356 17:35963147-35963169 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1147335473 17:39724848-39724870 CCAGGCGTCCGCGGTTTTCCCGG - Exonic
1147380439 17:40052215-40052237 CACTGCAACCTCCGTTTCCCGGG - Intronic
1147714130 17:42492628-42492650 CACGGCAACCTCCGTCTCCCCGG - Intronic
1148600616 17:48891937-48891959 CCCTGCAACCTCGGCCTCCCGGG + Intergenic
1148737267 17:49871859-49871881 CACGGCAACCTTGGCTTCCCTGG + Intergenic
1148795420 17:50194598-50194620 CCTGGTAGCCGTGGTTTCCCTGG - Exonic
1148954158 17:51339655-51339677 CACTGCAACCTCGGCTTCCCAGG + Intergenic
1151484005 17:74387353-74387375 CCCAGCCACCGCTGTTTCCCTGG - Intergenic
1151769171 17:76148644-76148666 CCCTGCAACCTCCGGTTCCCAGG + Intronic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1151841616 17:76622438-76622460 CACTGCAACCTCGGCTTCCCGGG + Intergenic
1152022561 17:77788274-77788296 CACTGCAACCTCCGTTTCCCAGG - Intergenic
1152175408 17:78783543-78783565 CCCTGCAACCTCTGCTTCCCAGG + Intergenic
1152437339 17:80284466-80284488 CACTGCAACCTCTGTTTCCCGGG - Intronic
1152725869 17:81945624-81945646 CACGGCAACCTCGGTCTCCTGGG - Intronic
1152861568 17:82699130-82699152 CCAGGCACCCGAGGTCTCCCTGG - Intergenic
1153212740 18:2786087-2786109 CACTGCAACCTCGGTCTCCCGGG + Intronic
1154292573 18:13122503-13122525 CACTGCAACCTCTGTTTCCCTGG - Intronic
1154986364 18:21555018-21555040 CACTGCAACCTCCGTTTCCCGGG - Intronic
1155050014 18:22138834-22138856 CACGGCAACCTCTGTCTCCCGGG + Intergenic
1155151662 18:23127977-23127999 CCCTGCAACCTCCGTCTCCCAGG - Intergenic
1155669786 18:28356385-28356407 CACTGCAACCTCTGTTTCCCAGG + Intergenic
1155797185 18:30054738-30054760 CACTGCAACCTCGGTTTCCTGGG - Intergenic
1158272103 18:55727671-55727693 CCCTGCAACCTCTGCTTCCCGGG + Intergenic
1158518203 18:58148239-58148261 CACTGCAACCTCTGTTTCCCAGG + Intronic
1158790747 18:60777590-60777612 CCCTGCAACCTCTGCTTCCCAGG - Intergenic
1160961451 19:1723337-1723359 CACTGCAACCTCCGTTTCCCAGG - Intergenic
1160994035 19:1873582-1873604 CCCTGCAACAGCGTTCTCCCGGG - Intergenic
1161672673 19:5622899-5622921 TCCACCAACCGCGGGTTCCCCGG + Exonic
1162512331 19:11127012-11127034 CCCCGCAACCTCTGCTTCCCGGG + Intronic
1162556253 19:11387913-11387935 CACTGCAACCTCTGTTTCCCGGG + Intronic
1162670361 19:12251973-12251995 CACGGCAACCTCTGTCTCCCAGG - Intronic
1162687703 19:12401073-12401095 CCCGACTTCCGCGGTGTCCCAGG + Exonic
1162692026 19:12440917-12440939 CCCGACTTCCGCGGTGTCCCAGG + Exonic
1162840312 19:13351583-13351605 CACTGCAACCTCTGTTTCCCAGG + Intronic
1162898628 19:13780602-13780624 CACTGCAACCTCGGTCTCCCGGG - Intergenic
1162978524 19:14223205-14223227 CGCTGCAACCTCGGTCTCCCGGG + Intergenic
1163560504 19:18016598-18016620 CGCTGCAGCCGCGATTTCCCAGG - Intergenic
1163707552 19:18824233-18824255 CCCTGCAACCTCCGTTTCCCGGG + Intergenic
1163765219 19:19160042-19160064 CCCTGCAACCACTGCTTCCCAGG + Intronic
1163832299 19:19552883-19552905 CCTGACAAACGAGGTTTCCCAGG - Intergenic
1163930102 19:20381423-20381445 CACTGCAACCGCTGTCTCCCGGG + Intergenic
1164214552 19:23133415-23133437 CACTGCAACCTCTGTTTCCCAGG + Intronic
1164932736 19:32187829-32187851 CCCTGCAACCTCTGTCTCCCAGG + Intergenic
1165041064 19:33067979-33068001 CACTGCAACCTCTGTTTCCCGGG + Intergenic
1165056140 19:33177348-33177370 CCAGGCGACCGCGGTTGCCATGG + Intergenic
1165808944 19:38598935-38598957 CACTGCAACCTCCGTTTCCCAGG - Intronic
1166167975 19:41005703-41005725 CACGGCAACCTCCATTTCCCAGG - Intronic
1166700866 19:44880846-44880868 CACGGCAACCTCCGCTTCCCAGG + Intronic
1167412481 19:49353172-49353194 CCCTGCAACCTCTGCTTCCCAGG + Intronic
1167555646 19:50193651-50193673 CACTGCAACCTCTGTTTCCCAGG + Intronic
1167945841 19:52988102-52988124 CACGGCAACCTCTGTCTCCCAGG + Intergenic
1168211228 19:54892053-54892075 CCCTGCAACCTCTCTTTCCCGGG + Intergenic
1168222047 19:54967404-54967426 CCCCGCAACCTCCGCTTCCCGGG - Intronic
925130687 2:1492228-1492250 CACGGCAACCTCCGTCTCCCAGG + Intronic
926198529 2:10777734-10777756 CCCGGGAACCCCGGGGTCCCTGG + Intronic
926539028 2:14151857-14151879 CACGGCAACCTCTGCTTCCCCGG + Intergenic
927045181 2:19271175-19271197 CCCTGCAACCTCTGCTTCCCAGG + Intergenic
927123406 2:19990119-19990141 CCGGGCAACAGCGGTTGCCAGGG - Exonic
927215846 2:20667425-20667447 CCCGGCCGCCGCGGTTCCCCGGG + Exonic
927459411 2:23284990-23285012 CCTGGCACCCAGGGTTTCCCTGG + Intergenic
927990920 2:27446338-27446360 CCTGGCAGCCACGGTTTCCTGGG + Exonic
928519723 2:32076949-32076971 CACTGCAACCTCTGTTTCCCAGG + Intronic
929006332 2:37396859-37396881 CACTGCAACCTCTGTTTCCCGGG - Intergenic
929468319 2:42166626-42166648 CACGGCAACCTCCGCTTCCCCGG - Intergenic
929489175 2:42381338-42381360 CCCTGCAACCTCTGTCTCCCGGG + Intronic
929665930 2:43833758-43833780 CACTGCAACCGCTGTCTCCCAGG + Intronic
929724715 2:44412998-44413020 CCCTGCAACCTCTGCTTCCCGGG - Intronic
930130465 2:47844725-47844747 CACTGCAACCTCCGTTTCCCTGG + Intronic
930808726 2:55519181-55519203 CACTGCAACCTCGGCTTCCCGGG + Intergenic
934684557 2:96311094-96311116 CCCTGCAACCTCTGATTCCCTGG - Intergenic
934929466 2:98409250-98409272 CACGGCAACCTCCGTCTCCCAGG + Intergenic
936120078 2:109733794-109733816 CACTGCAACCTCGGTTTCTCGGG - Intergenic
937583050 2:123512515-123512537 CACTGCAACCTCGGTCTCCCGGG - Intergenic
937646399 2:124270231-124270253 CCCTGCAACCACCGTCTCCCAGG - Intronic
938007375 2:127798290-127798312 CACTGCAACCTCTGTTTCCCAGG - Intronic
940227419 2:151414208-151414230 CCCTGCAACCTCTGCTTCCCAGG - Intronic
940713237 2:157187538-157187560 CCCTGCAACCTCTGCTTCCCAGG - Intergenic
941396199 2:164976887-164976909 CTAGGCAACAGCTGTTTCCCTGG + Intergenic
941850720 2:170177416-170177438 CACTGCAACCTCCGTTTCCCAGG + Intergenic
941900802 2:170676387-170676409 CCCTGCAACCTCCGTCTCCCAGG - Intergenic
941988663 2:171533289-171533311 CACTGCAACCTCGGATTCCCGGG - Intronic
943529802 2:189065029-189065051 CCTGGCAATCGTGGTTTTCCAGG - Exonic
943532300 2:189098041-189098063 CCTGGCAACAGCCATTTCCCAGG - Intronic
943795401 2:191986780-191986802 CACGGCAACCTCTGCTTCCCTGG - Intronic
944232733 2:197412429-197412451 CCCTGCAACCTCTGTCTCCCGGG + Intronic
944730965 2:202517142-202517164 CACTGCAACCTCCGTTTCCCGGG - Intronic
944735526 2:202559224-202559246 CACTGCAACCTCTGTTTCCCGGG - Intronic
944889237 2:204099923-204099945 CACTGCAACCTCTGTTTCCCGGG + Intergenic
946120194 2:217505039-217505061 CACTGCAACCGCCGTCTCCCAGG + Intronic
946615815 2:221508501-221508523 CCCTGCAACCTCAGTCTCCCGGG - Intronic
946825084 2:223669847-223669869 CACTGCAACCTCTGTTTCCCAGG + Intergenic
947203577 2:227639184-227639206 CACTGCAACCTCTGTTTCCCAGG - Intergenic
947540180 2:230971788-230971810 CACTGCAACCTCCGTTTCCCAGG - Intergenic
947784560 2:232804565-232804587 CCCTGCAACCTCTGCTTCCCAGG + Intronic
948402911 2:237697095-237697117 CACTGCAACCTCCGTTTCCCAGG + Intronic
948431962 2:237924515-237924537 CACGGCAACCTCGGCTTCCAGGG - Intergenic
1169955688 20:11100363-11100385 CACTGCAACCTCCGTTTCCCAGG + Intergenic
1170182009 20:13541967-13541989 CACTGCAACCTCTGTTTCCCGGG - Intronic
1170682726 20:18540778-18540800 CACTGCAACCTCGGCTTCCCAGG - Intronic
1171135350 20:22690198-22690220 CCCTGCAAACGCTGTTTTCCAGG - Intergenic
1171440262 20:25155076-25155098 CACTGCAACCTCTGTTTCCCAGG + Intergenic
1171506479 20:25639781-25639803 CCCTGCAACCTCCGCTTCCCGGG + Intergenic
1172119995 20:32592643-32592665 CGCTGCAACCTCTGTTTCCCAGG - Intronic
1172688508 20:36774631-36774653 CCCGGCAACCTCCGCCTCCCGGG + Intergenic
1172696185 20:36824726-36824748 CACTGCAACCTCCGTTTCCCAGG + Intronic
1173496549 20:43523030-43523052 CACTGCAACCTCCGTTTCCCAGG - Intronic
1173607200 20:44340028-44340050 CACTGCAACCTCGGTCTCCCAGG + Intronic
1175145195 20:56890600-56890622 CACTGCAACCTCTGTTTCCCGGG - Intergenic
1175411625 20:58773879-58773901 CACTGCAACCTCCGTTTCCCAGG + Intergenic
1176512273 21:7757808-7757830 CACTGCAACCTCTGTTTCCCAGG - Intronic
1178560244 21:33632451-33632473 CACTGCAACCTCCGTTTCCCAGG + Intronic
1178591171 21:33911740-33911762 CACTGCAACCTCGGCTTCCCAGG + Intronic
1178646385 21:34388332-34388354 CACTGCAACCTCTGTTTCCCAGG - Intronic
1179810325 21:43865571-43865593 CCCCGCAACCCCGGCCTCCCCGG + Intronic
1179894380 21:44353078-44353100 CACTGCAACCTCGGTCTCCCTGG - Intronic
1180089397 21:45526056-45526078 CCCGGCAGCCACGGGGTCCCAGG + Intronic
1180624929 22:17188026-17188048 CACTGCAACCTCGGCTTCCCAGG - Intronic
1182108062 22:27703478-27703500 CCCGGCAACCCTGTTTTCCAGGG + Intergenic
1182264673 22:29104816-29104838 CACTGCAACCGCTGCTTCCCAGG - Intronic
1182406728 22:30140186-30140208 CACGGCAACCTCTGCTTCCCAGG - Intronic
1182587721 22:31354899-31354921 CCCTGCAACCTCCGCTTCCCAGG + Intergenic
1182655508 22:31886682-31886704 CACTGCAACCTCCGTTTCCCAGG - Intronic
1183130293 22:35828083-35828105 CACTGCAACCTCCGTTTCCCAGG - Intronic
1184487652 22:44790598-44790620 CACTGCAACCTCGGTCTCCCGGG - Intronic
1184585470 22:45445074-45445096 CACGGCAACCTCTGTCTCCCAGG - Intergenic
1185141056 22:49101474-49101496 CCCACCAACCGCGTGTTCCCTGG - Intergenic
1185377894 22:50490540-50490562 CACGGCAACCCCTGTCTCCCGGG - Intronic
949677446 3:6472364-6472386 CCCTGCAACCGCTGCCTCCCGGG + Intergenic
949699952 3:6745280-6745302 CACAGCAACCTCGGTCTCCCAGG - Intergenic
949979259 3:9490419-9490441 CACGGCAACCTCCGTCTCCCAGG - Intergenic
950007234 3:9699094-9699116 CACGGCAACCTCCGCTTCCCAGG - Intronic
950017424 3:9763908-9763930 CACTGCAACCTCCGTTTCCCAGG - Intronic
950645815 3:14376121-14376143 CCCTGCAACCTCCGTCTCCCGGG + Intergenic
950692024 3:14666545-14666567 CACTGCAACCTCGGCTTCCCAGG - Intronic
951517007 3:23571363-23571385 CACTGCAACCTCCGTTTCCCAGG + Intronic
954806067 3:53221528-53221550 CCCTGCAACCTCCATTTCCCAGG + Intergenic
954824936 3:53364489-53364511 CACTGCAACCTCGGTCTCCCTGG + Intergenic
955186615 3:56720425-56720447 CACTGCAACCTCCGTTTCCCAGG + Intergenic
955690006 3:61581683-61581705 CCCTGCAACCTCTGCTTCCCAGG + Intronic
957893730 3:86391357-86391379 CCCTGCAACCTCCGTCTCCCAGG - Intergenic
958418249 3:93902675-93902697 CACTGCAACCTCTGTTTCCCGGG - Intronic
959709244 3:109368825-109368847 CACTGCAACCTCCGTTTCCCAGG + Intergenic
959983204 3:112541309-112541331 CACTGCAACCGCCGTCTCCCAGG - Intronic
960004791 3:112770918-112770940 CACTGCAACCGCGGCTTCCCGGG - Intronic
961870768 3:129986482-129986504 CACTGCAACCTCAGTTTCCCAGG + Intergenic
962087956 3:132211539-132211561 CACTGCAACCTCTGTTTCCCAGG + Intronic
962116432 3:132513792-132513814 CCAGGCAACCGAGACTTCCCAGG + Intronic
962802492 3:138902254-138902276 CACTGCAACCTCCGTTTCCCAGG - Intergenic
963038346 3:141051288-141051310 CCCGGCGACCGCGCCTTCCGCGG + Intergenic
963526112 3:146416024-146416046 CACTGCAACCTCTGTTTCCCGGG + Intronic
964112773 3:153104614-153104636 CACCGCAACCGCCGTCTCCCAGG + Intergenic
965574811 3:170207033-170207055 CCCTGCAACCTCCGTCTCCCAGG - Intergenic
965685143 3:171294643-171294665 CACTGCAACCTCCGTTTCCCGGG - Intronic
965910760 3:173772540-173772562 CCCTGCAACCTCCGTCTCCCAGG - Intronic
966274675 3:178151112-178151134 CACTGCAACCTCGGCTTCCCAGG - Intergenic
966596952 3:181732712-181732734 CACTGCAACCTCCGTTTCCCGGG + Intergenic
966856830 3:184199934-184199956 CACTGCAACCTCGGTCTCCCGGG - Intronic
966900230 3:184477861-184477883 CACTGCAACCGCCGTCTCCCAGG + Intronic
967456174 3:189689189-189689211 CACTGCAACCTCCGTTTCCCAGG + Intronic
968821216 4:2853182-2853204 CCCTGCAACCTCTGTCTCCCAGG + Intronic
971212535 4:24633081-24633103 CACTGCAACCTCGGCTTCCCAGG - Intergenic
971301200 4:25443571-25443593 CACTGCAACCTCCGTTTCCCGGG - Intergenic
971397365 4:26241119-26241141 CACTGCAACCTCGGATTCCCAGG - Intronic
971791602 4:31176833-31176855 CACTGCAACCTCGGCTTCCCAGG + Intergenic
972776026 4:42241455-42241477 CACGGCAACCTCTGTCTCCCGGG + Intergenic
972820294 4:42694222-42694244 CCCTGCAACCTCTGTCTCCCAGG + Intergenic
974046338 4:56901921-56901943 CACTGCAACCTCCGTTTCCCAGG + Intergenic
974508921 4:62811558-62811580 CCCTGCAACCTCTGCTTCCCGGG + Intergenic
974604098 4:64126846-64126868 CACGGCAACCTCCATTTCCCGGG + Intergenic
975329999 4:73101587-73101609 CACTGCAACCTCCGTTTCCCGGG - Intronic
975355140 4:73393593-73393615 CCCTGCAACCTCGGCCTCCCAGG - Intergenic
975774582 4:77771235-77771257 CCCGGCAACCTCCGCCTCCCAGG - Intronic
975866066 4:78724704-78724726 CACGGCAACCTCTGTCTCCCAGG - Intergenic
976217663 4:82730370-82730392 CCCTGCAACCTCCGCTTCCCGGG + Intronic
978486772 4:109263051-109263073 CACTGCAACCTCAGTTTCCCAGG - Intronic
978814275 4:112885421-112885443 CACTGCAACCTCGGCTTCCCGGG - Intronic
978938361 4:114406892-114406914 CACTGCAACCTCTGTTTCCCAGG - Intergenic
979787453 4:124734019-124734041 CCCTGCAACCTAGGCTTCCCAGG - Intergenic
980078015 4:128314495-128314517 CACTGCAACCTCCGTTTCCCAGG + Intergenic
982346425 4:154365723-154365745 CACTGCAACCTCGGTTTCCCAGG + Intronic
983439402 4:167762402-167762424 CACGGCAACTTCTGTTTCCCGGG - Intergenic
983977552 4:173953771-173953793 CCCGGCAACCTCCGTCTCCCAGG + Intergenic
984017115 4:174439918-174439940 CACTGCAACCTCCGTTTCCCGGG - Intergenic
984118987 4:175718538-175718560 CACTGCAACCGCCGTCTCCCGGG - Intronic
984871973 4:184333779-184333801 CACGGCAACCTCGGCCTCCCGGG + Intergenic
985121364 4:186645868-186645890 CACTGCAACCTCGGCTTCCCAGG - Intronic
986680676 5:10230742-10230764 CCCAGGAACCCCGGTTTCACTGG + Intronic
986701902 5:10418302-10418324 CACTGCAACCGCGGCCTCCCAGG - Intronic
986799686 5:11246474-11246496 CCCGGAATCCTCGGTGTCCCTGG - Intronic
987050590 5:14144175-14144197 CCCGGCAGCCGCGGCTTCGCGGG + Intronic
987850924 5:23353047-23353069 CACTGCAACCTCGGTCTCCCAGG + Intergenic
988318815 5:29666010-29666032 CACTGCAACCTCCGTTTCCCAGG - Intergenic
988556462 5:32240321-32240343 CACGGCAACCTCTGTCTCCCTGG - Intronic
988796322 5:34656390-34656412 CCCGGCGGCCGCGTTTTCCTGGG + Intronic
988828313 5:34962800-34962822 CACTGCAACCGCTGTCTCCCGGG - Intergenic
988990233 5:36663289-36663311 CCCTGCAACCTCCGCTTCCCAGG + Intronic
989717489 5:44481372-44481394 CACTGCAACCTCCGTTTCCCGGG - Intergenic
990381944 5:55227421-55227443 CCTGGCAACCGGGCTTCCCCCGG + Intergenic
992382604 5:76253365-76253387 CACTGCAACCTCGGTCTCCCGGG + Intronic
992687634 5:79213695-79213717 CACTGCAACCTCTGTTTCCCAGG - Intronic
994804968 5:104434019-104434041 CACTGCAACCTCTGTTTCCCAGG + Intergenic
995198895 5:109404440-109404462 CGCTGCAACCTCGGTCTCCCAGG - Intronic
998827038 5:146113138-146113160 CACTGCAACCTCGGTCTCCCAGG + Exonic
1000215852 5:159155217-159155239 CACTGCAACCTCCGTTTCCCGGG - Intergenic
1001016240 5:168143923-168143945 CACTGCAACCTCCGTTTCCCGGG + Intronic
1001287098 5:170431680-170431702 CCCGGCAACCTCTGTCTTCCAGG - Intronic
1001691594 5:173636804-173636826 CACGGCAACCTCTGCTTCCCGGG + Intergenic
1002273414 5:178087646-178087668 CACGGCAACCTCGGCCTCCCAGG - Intergenic
1002277644 5:178114041-178114063 CCCTGCAAACGCGCTTTCCAGGG + Intronic
1002519829 5:179786162-179786184 CCCTGCAACCTCTGCTTCCCAGG - Intronic
1002720534 5:181258312-181258334 CACTGCAACCTCCGTTTCCCGGG - Intronic
1003864375 6:10349835-10349857 CCCCGCAACCTCTGCTTCCCGGG + Intergenic
1004368407 6:15031227-15031249 CACTGCAACCTCGGTCTCCCGGG - Intergenic
1004516896 6:16328151-16328173 CCCGGCCACCAGGGTTGCCCGGG + Exonic
1004633926 6:17448835-17448857 CACTGCAACCTCCGTTTCCCAGG + Intronic
1005332080 6:24760481-24760503 CACTGCAACCTCGGCTTCCCGGG + Intergenic
1005519580 6:26587747-26587769 CACTGCAACCTCGGCTTCCCGGG + Intergenic
1005528493 6:26677016-26677038 CACGGCAACCTCTGTCTCCCAGG - Intergenic
1005542302 6:26824623-26824645 CACGGCAACCTCTGTCTCCCAGG + Intergenic
1005733345 6:28720672-28720694 CCCGGCAACCTCCGCCTCCCGGG + Intergenic
1005736215 6:28749279-28749301 CGCTGCAACCTCCGTTTCCCTGG - Intergenic
1005756093 6:28926017-28926039 CCCTGCAACCTCTGTCTCCCAGG - Intergenic
1005762822 6:28983346-28983368 CACTGCAACCTCCGTTTCCCGGG + Intergenic
1006015735 6:31079154-31079176 CACTGCAACCTCGGTCTCCCGGG - Intergenic
1006077437 6:31542757-31542779 CACTGCAACCGCTGCTTCCCGGG + Intronic
1006269229 6:32951072-32951094 CCCGGCAACCTCTGCCTCCCTGG - Intronic
1006342590 6:33454690-33454712 CCGGGTGACCGCGGCTTCCCGGG + Exonic
1006493270 6:34402378-34402400 CACTGCAACCGCTGCTTCCCGGG - Intronic
1007039861 6:38711660-38711682 CACTGCAACCTCTGTTTCCCTGG - Intergenic
1007161079 6:39792353-39792375 GGCGGCAGCCGCGGCTTCCCGGG + Intronic
1007393567 6:41564341-41564363 CCCTGCAACCTCCGTCTCCCGGG - Intronic
1007607118 6:43125094-43125116 CACGGCAACCTCCGCTTCCCGGG - Intronic
1008190201 6:48446939-48446961 CACGGCAACCTCCGCTTCCCGGG + Intergenic
1010164307 6:72897464-72897486 CCCCGCAACAGCTGTCTCCCAGG - Intronic
1011014914 6:82743945-82743967 CACGGCAACCTCTGCTTCCCAGG - Intergenic
1012989704 6:105912483-105912505 CACTGCAACCTCCGTTTCCCGGG + Intergenic
1014604545 6:123456542-123456564 CACTGCAACCTCTGTTTCCCAGG + Intronic
1014902932 6:126989913-126989935 CACGGCAACCTCTGCTTCCCAGG - Intergenic
1015322103 6:131887934-131887956 CCCTGCAACCTCCGCTTCCCGGG + Intronic
1015356044 6:132278050-132278072 CACTGCAACCGCTGTCTCCCAGG + Intergenic
1015910227 6:138162006-138162028 CCAGGCAGCGGCGGCTTCCCCGG + Exonic
1016043109 6:139453001-139453023 CACTGCAACCTCGGTCTCCCGGG + Intergenic
1017636216 6:156445657-156445679 CACGGCAACCTCTGTCTCCCGGG + Intergenic
1019223643 6:170493834-170493856 CACTGCAACCTCTGTTTCCCTGG + Intergenic
1019412586 7:912774-912796 CCCTGCAACCTCCGCTTCCCAGG + Intronic
1019580828 7:1761516-1761538 CACTGCAACCTCCGTTTCCCGGG + Intergenic
1022159917 7:27699562-27699584 CACTGCAACCTCTGTTTCCCCGG + Intergenic
1022213619 7:28236456-28236478 CACTGCAACCTCCGTTTCCCAGG + Intergenic
1022856636 7:34321377-34321399 CACTGCAGCCGCGCTTTCCCAGG - Intergenic
1022867973 7:34442669-34442691 CACTGCAACCTCGGTCTCCCAGG - Intergenic
1023727330 7:43157634-43157656 CACTGCAACCTCTGTTTCCCAGG + Intronic
1024691602 7:51809047-51809069 CCCTGCAACCCCCGTCTCCCAGG + Intergenic
1025792609 7:64704319-64704341 CACTGCAACCTCCGTTTCCCAGG + Intronic
1025920903 7:65912046-65912068 CACTGCAACCTCTGTTTCCCAGG - Intronic
1025988969 7:66480613-66480635 CCCTGCAACCTCTGTCTCCCAGG + Intergenic
1026348344 7:69494316-69494338 CACTGCAACCTCCGTTTCCCGGG - Intergenic
1026821862 7:73555324-73555346 CACGGCAACCTCTGCTTCCCGGG - Intronic
1027211932 7:76156631-76156653 CCCTGCAACCTCTGTCTCCCAGG + Intergenic
1027270841 7:76517756-76517778 CACTGCAACCTCCGTTTCCCAGG - Intergenic
1027320604 7:77007586-77007608 CACTGCAACCTCCGTTTCCCAGG - Intergenic
1027377685 7:77569693-77569715 CACTGCAACCTCGGCTTCCCAGG - Intronic
1027399279 7:77790686-77790708 CACTGCAACCGCTGCTTCCCAGG + Intergenic
1027527767 7:79292555-79292577 CACGGCAACCTCTGTTTCTCAGG - Intronic
1027825659 7:83112131-83112153 CCCTGCAACCTCTGCTTCCCGGG + Intronic
1028168584 7:87568025-87568047 CCCGGCAACCTCTGCTTCCTGGG - Intronic
1028608242 7:92679794-92679816 CACTGCAACCTCGGTCTCCCGGG + Intronic
1029091523 7:98051915-98051937 CACTGCAACCTCTGTTTCCCGGG + Intergenic
1029264691 7:99328873-99328895 CACTGCAACCTCGGCTTCCCAGG - Intronic
1029358978 7:100074344-100074366 CACTGCAACCTCGGCTTCCCAGG + Intronic
1029529055 7:101113166-101113188 CACGGCAACCTCCGTCTCCCAGG - Intergenic
1030564602 7:111137898-111137920 CCCTGCAACCTCTGCTTCCCAGG + Intronic
1031340139 7:120590095-120590117 CACTGCAACCTCCGTTTCCCAGG + Intronic
1032245399 7:130206908-130206930 CACCGCAACCTCGGCTTCCCAGG - Intronic
1033071001 7:138202196-138202218 CACTGCAACCTCGGTCTCCCAGG - Intergenic
1033217112 7:139501194-139501216 CACGGCAACCTCGGCCTCCCAGG + Intergenic
1033796882 7:144855965-144855987 CCCTGCAACCTCTGTCTCCCAGG + Intergenic
1034190868 7:149212654-149212676 CACCGCAACCTCCGTTTCCCGGG + Intronic
1036438374 8:8757486-8757508 CACGGCAACCTCTGCTTCCCAGG + Intergenic
1036552286 8:9826219-9826241 CACTGCAACCTCCGTTTCCCGGG - Intergenic
1037787489 8:21911530-21911552 CACTGCAACCGCCGCTTCCCGGG - Intronic
1038325904 8:26572573-26572595 CACTGCAACCTCCGTTTCCCAGG + Intronic
1038633587 8:29267698-29267720 TCCGCCCACCTCGGTTTCCCAGG + Intergenic
1038742372 8:30226764-30226786 CACTGCAACCTCTGTTTCCCGGG + Intergenic
1039243855 8:35586196-35586218 CACTGTAACCGCTGTTTCCCGGG - Intronic
1039300826 8:36206920-36206942 CACTGCAACCTCGGGTTCCCGGG + Intergenic
1040397623 8:47014469-47014491 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1042228911 8:66537538-66537560 CACTGCAACCTCGGCTTCCCAGG + Intergenic
1042556580 8:70038420-70038442 CCCGGCAACCTCGGCTTCCCAGG - Intergenic
1043403092 8:79902922-79902944 CCCTGCAACCTCTGCTTCCCGGG + Intergenic
1043500261 8:80847095-80847117 CACTGCAACCTCTGTTTCCCAGG - Intronic
1044650961 8:94494514-94494536 CACTGCAACCTCCGTTTCCCGGG - Intronic
1045477160 8:102563059-102563081 CACTGCAACCTCCGTTTCCCAGG + Intergenic
1045505015 8:102772140-102772162 CCCTGCAACCTCTGCTTCCCAGG - Intergenic
1046429715 8:114108832-114108854 CACTGCAACCTCCGTTTCCCGGG + Intergenic
1046936830 8:119892856-119892878 CACTGCAACCTCTGTTTCCCAGG + Intronic
1046995161 8:120511369-120511391 CACTGCAACCTCCGTTTCCCGGG + Intronic
1047241019 8:123088111-123088133 CACTGCAACCTCTGTTTCCCGGG - Intronic
1047739927 8:127798226-127798248 CCCGGCAACCTCCGCCTCCCGGG - Intergenic
1050247630 9:3707555-3707577 CCCTGCAACCACCGTCTCCCGGG - Intergenic
1050538193 9:6647954-6647976 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1050669403 9:7979226-7979248 CACTGCAACCTCGGTTTCCTGGG + Intergenic
1050748402 9:8905661-8905683 CACTGCAACCTCGGTCTCCCTGG - Intronic
1051027677 9:12633044-12633066 CACTGCAACCTCCGTTTCCCGGG + Intergenic
1051402573 9:16698616-16698638 CACCGCAACCTCTGTTTCCCCGG - Intronic
1051541226 9:18220848-18220870 CACTGCAACCTCGGCTTCCCAGG + Intergenic
1052784057 9:32812339-32812361 CCCTGCAACCTCTGCTTCCCAGG - Intergenic
1053068077 9:35082491-35082513 CACTGCAACCTCCGTTTCCCAGG - Intergenic
1053089931 9:35265899-35265921 CACGGCAACCTCCGTCTCCCTGG + Intronic
1053374488 9:37593588-37593610 CACTGCAACCGCTGCTTCCCAGG + Intronic
1053523889 9:38809493-38809515 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1054196121 9:62033905-62033927 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1054642284 9:67554784-67554806 CACTGCAACCTCTGTTTCCCAGG + Intergenic
1054801501 9:69354330-69354352 CACGGCAACCTCTGTTTCCTGGG + Intronic
1055265985 9:74497143-74497165 CCCGGCCACCTCGGACTCCCTGG + Intergenic
1055777428 9:79781595-79781617 CACTGCAACCTCGGCTTCCCGGG + Intergenic
1055805973 9:80093653-80093675 CACGGCAACCTCCGCTTCCCAGG - Intergenic
1056460867 9:86808703-86808725 CACGGCAACCTCTGCTTCCCAGG + Intergenic
1056463976 9:86836025-86836047 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1056646376 9:88415489-88415511 CACTGCAACCTCTGTTTCCCAGG + Intronic
1057232203 9:93329084-93329106 CACTGCAACCTCTGTTTCCCGGG - Intronic
1058067173 9:100562729-100562751 CACTGCAACCTCGGCTTCCCAGG + Intronic
1058929279 9:109702892-109702914 CACGGCAACCTCCGCTTCCCAGG + Intronic
1059194709 9:112359725-112359747 CCCGGCAACCTCCGCCTCCCGGG - Intergenic
1059297883 9:113288510-113288532 CACTGCAACCGCCGTCTCCCGGG + Intronic
1060193478 9:121607887-121607909 CCAGGCAACGGCTGTTTGCCGGG + Intronic
1061030598 9:128079913-128079935 GCCTGCAACCTCTGTTTCCCAGG - Intronic
1061272491 9:129551136-129551158 CACTGCAACCTCGGTCTCCCAGG - Intergenic
1061519312 9:131108273-131108295 CCCGGCAACCTCCACTTCCCAGG + Intronic
1061835477 9:133326308-133326330 CACTGCAACCTCCGTTTCCCAGG + Intergenic
1061998027 9:134197892-134197914 CACGGCAACCTCCGCTTCCCAGG - Intergenic
1185531419 X:822015-822037 CCAGGCAACAGCGGTTCCTCAGG + Intergenic
1185586918 X:1247735-1247757 CACGGCAACCTCCGTCTCCCAGG - Intergenic
1185624168 X:1471081-1471103 CTCGGCAACCTCCGCTTCCCCGG + Intronic
1185697775 X:2208115-2208137 CCCTGCAACCTCCGCTTCCCGGG - Intergenic
1185789844 X:2920444-2920466 CCCTGCAACCTCCGCTTCCCGGG + Intronic
1187038053 X:15563465-15563487 CACTGCAACCTCGATTTCCCAGG - Intronic
1187332932 X:18356570-18356592 CACGGCAACCTCTGCTTCCCAGG - Intergenic
1187372609 X:18723058-18723080 CACGGCAACCTCCGTCTCCCAGG + Intronic
1190035104 X:47015506-47015528 CACTGCAACCTCTGTTTCCCAGG - Intronic
1190857710 X:54313425-54313447 CACGGCAACCTCCGTCTCCCGGG + Intronic
1193570685 X:83137985-83138007 CACTGCAACCTCTGTTTCCCAGG - Intergenic
1195084431 X:101400909-101400931 CACTGCAACCTCTGTTTCCCAGG + Intronic
1195122365 X:101768341-101768363 CACTGCAACCTCGGCTTCCCAGG + Intergenic
1195803787 X:108739311-108739333 CCCTGCAACCTCGGTCTCCCGGG + Intergenic
1196670306 X:118358996-118359018 CACTGCAACCTCTGTTTCCCGGG - Intronic
1197333232 X:125180151-125180173 CCCGGCCCCCAGGGTTTCCCCGG + Intergenic
1198059599 X:133032071-133032093 CACTGCAACCTCCGTTTCCCAGG - Intronic
1198530614 X:137547428-137547450 TCCGGCAGCCGCGCTCTCCCCGG - Intergenic
1198895033 X:141444467-141444489 CACTGCAACCTCCGTTTCCCTGG + Intergenic
1199091812 X:143701893-143701915 CCCTGCAGCAGCGCTTTCCCAGG - Intergenic
1200653668 Y:5873144-5873166 CACTGCAACCTCCGTTTCCCAGG - Intergenic
1200761392 Y:7042466-7042488 CACTGCAACCTCCGTTTCCCAGG + Intronic
1201549810 Y:15207905-15207927 CACTGCAACCTCTGTTTCCCAGG - Intergenic