ID: 1095985588

View in Genome Browser
Species Human (GRCh38)
Location 12:47997523-47997545
Sequence GCTGCTTGCACTTACCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 112}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095985588_1095985594 15 Left 1095985588 12:47997523-47997545 CCAGCCAGGTAAGTGCAAGCAGC 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1095985594 12:47997561-47997583 TTTCTGGAGGGACAGCCTGAAGG 0: 1
1: 0
2: 2
3: 33
4: 253
1095985588_1095985592 3 Left 1095985588 12:47997523-47997545 CCAGCCAGGTAAGTGCAAGCAGC 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1095985592 12:47997549-47997571 TTAAAAGCCACATTTCTGGAGGG 0: 1
1: 0
2: 1
3: 31
4: 361
1095985588_1095985596 21 Left 1095985588 12:47997523-47997545 CCAGCCAGGTAAGTGCAAGCAGC 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1095985596 12:47997567-47997589 GAGGGACAGCCTGAAGGAATGGG 0: 1
1: 0
2: 0
3: 28
4: 236
1095985588_1095985590 -1 Left 1095985588 12:47997523-47997545 CCAGCCAGGTAAGTGCAAGCAGC 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1095985590 12:47997545-47997567 CAATTTAAAAGCCACATTTCTGG 0: 1
1: 0
2: 1
3: 34
4: 340
1095985588_1095985597 29 Left 1095985588 12:47997523-47997545 CCAGCCAGGTAAGTGCAAGCAGC 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1095985597 12:47997575-47997597 GCCTGAAGGAATGGGAAGTAAGG 0: 1
1: 0
2: 1
3: 22
4: 257
1095985588_1095985595 20 Left 1095985588 12:47997523-47997545 CCAGCCAGGTAAGTGCAAGCAGC 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1095985595 12:47997566-47997588 GGAGGGACAGCCTGAAGGAATGG 0: 1
1: 1
2: 6
3: 57
4: 1049
1095985588_1095985591 2 Left 1095985588 12:47997523-47997545 CCAGCCAGGTAAGTGCAAGCAGC 0: 1
1: 0
2: 2
3: 10
4: 112
Right 1095985591 12:47997548-47997570 TTTAAAAGCCACATTTCTGGAGG 0: 1
1: 0
2: 1
3: 45
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095985588 Original CRISPR GCTGCTTGCACTTACCTGGC TGG (reversed) Intronic
900142372 1:1144118-1144140 GCTGCTTGCCCGGACCTGGGAGG - Intergenic
900304935 1:2001076-2001098 GCTGTTTGCAGGTGCCTGGCTGG + Intronic
901514276 1:9734651-9734673 ACTGCTTGCACCTGCCAGGCTGG - Intronic
903307139 1:22420855-22420877 CCTGTTTGGACTCACCTGGCTGG - Intergenic
904279691 1:29410077-29410099 CCTGTTCGCAGTTACCTGGCTGG + Intergenic
904475732 1:30763633-30763655 GCTGCTTGGAGTAACCTGCCTGG - Intergenic
906617382 1:47242907-47242929 TTTGCTTCCACTTACCTGGAAGG + Intergenic
911530632 1:99039429-99039451 GCTCCTTGCACTTCCTGGGCGGG - Intergenic
911942298 1:104062065-104062087 GTTGTTTCCACTTTCCTGGCTGG - Intergenic
913021528 1:114792595-114792617 GCTGCTTGCGCTTCCCCGGTGGG + Intergenic
913215221 1:116614376-116614398 GGTGCTTACACTTACCTGTCTGG + Intronic
915074399 1:153296823-153296845 GCCACTTGCCCTTGCCTGGCTGG - Intergenic
916095215 1:161343562-161343584 CCTGCTTGCACTGAACTGGTGGG + Intronic
922901672 1:229141899-229141921 GCTGATTGCACTTTCCTTGATGG - Intergenic
1069717999 10:70532973-70532995 GCTGCTCTCCCTCACCTGGCAGG + Exonic
1070693356 10:78543785-78543807 GGGGCATGCACTTAGCTGGCAGG - Intergenic
1071023266 10:81083243-81083265 GCTGCCTGCACTTGACAGGCAGG - Intergenic
1073248754 10:102109020-102109042 GATGCTTACAGGTACCTGGCTGG + Exonic
1075946169 10:126435119-126435141 GTGGCTTCCACTTACCTGACAGG - Intronic
1078085499 11:8231077-8231099 GCTGCCTCCGCTTACCTGCCAGG - Intronic
1078869013 11:15326902-15326924 GCTTCTGGCTCTAACCTGGCTGG + Intergenic
1090314908 11:125777682-125777704 GCTGATGTCCCTTACCTGGCAGG - Intronic
1091522243 12:1257230-1257252 TTTGCTTCCACTTACATGGCTGG - Intronic
1095985588 12:47997523-47997545 GCTGCTTGCACTTACCTGGCTGG - Intronic
1100198355 12:92272521-92272543 CCTGCTTCTACTTGCCTGGCTGG + Intergenic
1100246036 12:92757799-92757821 GTTGCCTGCAGTTTCCTGGCTGG - Intronic
1101492274 12:105220725-105220747 GATGCTGGCAGTTCCCTGGCAGG - Intronic
1101640838 12:106584810-106584832 CCTGATTGCACTCCCCTGGCTGG + Intronic
1101827626 12:108232756-108232778 GCTGCTTGGACTTGCCTGGCAGG - Exonic
1102513827 12:113433693-113433715 GCTGCTTGAACTCAACTAGCAGG + Intronic
1105243702 13:18628967-18628989 GCTGCCTGCCCGGACCTGGCGGG + Intergenic
1105281260 13:18963934-18963956 GCTGCCTGCACTCACCTGAGGGG + Intergenic
1105290465 13:19049944-19049966 GCTGCCTGCACTCACCTGAGGGG + Intergenic
1105571827 13:21610633-21610655 GACCCTTTCACTTACCTGGCTGG - Intergenic
1121189175 14:92009479-92009501 ACTCTCTGCACTTACCTGGCAGG - Intronic
1122149214 14:99715812-99715834 GCTGCTTCCTCTTCCCTGGCAGG - Exonic
1123487593 15:20755664-20755686 GCTGCCTGCCCAGACCTGGCGGG - Intergenic
1123544085 15:21324722-21324744 GCTGCCTGCCCAGACCTGGCGGG - Intergenic
1125925595 15:43560369-43560391 GCTGCTGCCACTACCCTGGCTGG - Intronic
1125938740 15:43659920-43659942 GCTGCTGCCACTACCCTGGCTGG - Intronic
1125994773 15:44147880-44147902 GCTGCTTGCACATAGCTTGCAGG + Intronic
1127329294 15:57923015-57923037 GCTGCTTGCCCAAATCTGGCAGG - Intergenic
1202952427 15_KI270727v1_random:51995-52017 GCTGCCTGCCCAGACCTGGCGGG - Intergenic
1133042830 16:3069516-3069538 CCTGCTTATACTTCCCTGGCAGG + Exonic
1133044871 16:3082158-3082180 CCTGCTTATACTTCCCTGGCAGG + Intronic
1138270304 16:55691304-55691326 GCTGCATGCACCTATCTGACTGG - Intronic
1140912181 16:79464256-79464278 CATGCTTGCATTTACCTGTCTGG - Intergenic
1141222737 16:82086525-82086547 GCTGTGTTCCCTTACCTGGCAGG - Intronic
1142712435 17:1730733-1730755 GCTGCTGGCCCTTCCGTGGCAGG + Exonic
1144738350 17:17567374-17567396 GCTGCTGGCACTGGCCTGGTGGG - Intronic
1145796960 17:27661133-27661155 TCTCCTTTCACTTACCTGGCTGG + Intergenic
1148264457 17:46214198-46214220 GTTGCTTGCACTTATCAGACTGG + Intronic
1151228964 17:72668245-72668267 GCTTCTAGCACATACCTGGTGGG + Intronic
1151586700 17:75013004-75013026 GCTGTCTGCGCTAACCTGGCCGG + Intronic
1154029873 18:10744340-10744362 GCTGCTTGTAGTTTCCTGGCTGG + Intronic
1154445240 18:14430918-14430940 GCTGCCTGCCCGGACCTGGCGGG - Intergenic
1155252760 18:23967633-23967655 TCTGCTTTCACTTACCAGGCAGG + Intergenic
1155436675 18:25819862-25819884 GCTGCTTGCTCTTTCCTAGTGGG - Intergenic
1158159727 18:54467636-54467658 GCTGATTGCACTTGACAGGCTGG + Intergenic
1159293809 18:66455052-66455074 GCTGGTTGCTCCTAACTGGCTGG - Intergenic
1160157670 18:76445961-76445983 GCTGCTGGCACACAGCTGGCTGG - Intronic
1163808151 19:19412809-19412831 GCTGCTTGCCCTGACCTCGGAGG + Intronic
1166050736 19:40257277-40257299 GCTGCTGGCACCTTCCTGCCAGG - Intronic
1167736225 19:51296075-51296097 GCTGCTTGCTCTGCCCTTGCTGG - Intergenic
925719284 2:6812106-6812128 TGGGCTTGCACTGACCTGGCAGG - Intergenic
929053231 2:37855521-37855543 GCTGCTTTCACTTCCCTGGCAGG - Intergenic
930705977 2:54505567-54505589 GCTGCCTGCACATACCTGCCAGG + Intronic
930941686 2:57021877-57021899 ACTGCTTGCACTTCCCGGGTGGG - Intergenic
932404621 2:71504916-71504938 GCTGCCTTCTCTTCCCTGGCTGG + Intronic
932809423 2:74811779-74811801 TCTGCTTTCTCTTTCCTGGCTGG - Intergenic
937203127 2:120218545-120218567 GCTGCTTCTACCTACATGGCTGG + Intergenic
943442126 2:187938304-187938326 GCAGCTTGCACCTGCCTGCCTGG + Intergenic
947551937 2:231052743-231052765 GCTGGATCCACCTACCTGGCAGG - Intergenic
948292241 2:236834424-236834446 GCAGCATGCACTTACCAGGCAGG + Intergenic
948663254 2:239519691-239519713 GCTGCTTGCATTTACCATGTTGG + Intergenic
948664939 2:239528891-239528913 GCAGGTAGCACTGACCTGGCTGG - Intergenic
1169889050 20:10433633-10433655 GCTGCTTTCACGTAGCTGGCAGG + Intronic
1172303464 20:33865495-33865517 GCTCCTGGCTCTTACCTGGGAGG + Intergenic
1176450752 21:6858945-6858967 GCTGCCTGCCCGGACCTGGCGGG + Intergenic
1176722181 21:10401931-10401953 GCTGCTAGGACTTTCCTCGCAGG + Intergenic
1176828921 21:13723963-13723985 GCTGCCTGCCCGGACCTGGCGGG + Intergenic
1182134409 22:27887783-27887805 TCTGCTTGCACTTAACGGGAGGG - Intronic
1182433081 22:30312153-30312175 GCTGCTTGAAATTCCCTTGCTGG + Intronic
1183166226 22:36149015-36149037 GCTTCTTCCTCTTCCCTGGCTGG - Intronic
950532899 3:13563353-13563375 GCTGCCTGCCCTTTGCTGGCAGG + Intronic
954294134 3:49664846-49664868 GCTGCTTGTACTCACCATGCTGG - Exonic
958914453 3:100033243-100033265 ACTGCTTGCAATTTCCAGGCAGG + Intronic
962437953 3:135383722-135383744 GCTTTCTGCACTTCCCTGGCTGG - Intergenic
964590790 3:158360653-158360675 GCAGTGTGCACATACCTGGCGGG + Intronic
964691345 3:159453501-159453523 GCTGCTTTCACTTAGCTGTGTGG + Intronic
969940562 4:10726837-10726859 CCTGCTTGCTGTTACCTAGCAGG + Intergenic
970608875 4:17707518-17707540 GCTGCTTGATCTGACCTGCCTGG - Intronic
973176566 4:47213040-47213062 GCTGCTTTCACTCACCTTACAGG + Intronic
976213891 4:82697679-82697701 TCTTTCTGCACTTACCTGGCAGG - Intronic
978576333 4:110194040-110194062 GCTGTTAGCACAAACCTGGCAGG + Intronic
982271501 4:153593854-153593876 GAAGCTTGCCCTTACCTGGTAGG + Exonic
983168873 4:164513177-164513199 GCTGCTCCCACTCACCTGGCTGG - Intergenic
985953769 5:3244534-3244556 GCTGCTTCCACTCACCAGGAAGG + Intergenic
985955086 5:3259406-3259428 TCTGCTTCCACATACCTTGCCGG - Intergenic
994568817 5:101486618-101486640 GCTGTCTGCACTTCCCTAGCTGG - Intergenic
995484725 5:112628727-112628749 GCTTCTTGCACTGAAGTGGCAGG + Intergenic
1001290206 5:170451896-170451918 GCTGCATGCTCTTACCTCTCTGG - Intronic
1004322254 6:14641171-14641193 GACGCATGCACTTATCTGGCTGG - Intergenic
1004405807 6:15332422-15332444 GCTGCTTTCAAATACCTGCCAGG - Intronic
1006815800 6:36849024-36849046 GCTGCTTGTATTTGCCTGCCTGG + Intergenic
1007349533 6:41258854-41258876 ACTGCTTGCAATATCCTGGCTGG + Intergenic
1007363205 6:41373158-41373180 GCTGTTTGCATTTCTCTGGCAGG - Intergenic
1011873327 6:91925107-91925129 CCTGCTTGCAGTTACGTGGTCGG + Intergenic
1018067482 6:160134027-160134049 GCTGGTGGCGCTTACCGGGCTGG + Exonic
1018682353 6:166275096-166275118 GCTGCTGCCACTTGCTTGGCAGG + Intergenic
1019280978 7:200119-200141 GCTGCCTGCAGGTACCTGGGAGG + Intronic
1019724825 7:2595720-2595742 GCTGCCTGCACTTGCCTCCCTGG + Intronic
1024670242 7:51587702-51587724 GCTGCATGCTATCACCTGGCAGG - Intergenic
1028928678 7:96388852-96388874 GCTGCTCTCACTTCCCTGCCTGG - Intergenic
1033602512 7:142898435-142898457 GCTTCCTGCACTTACCTGTGAGG - Intergenic
1037977718 8:23225062-23225084 GCTTCTTGGATTGACCTGGCAGG - Exonic
1043963861 8:86449296-86449318 AATGTTTGGACTTACCTGGCTGG - Intronic
1049163511 8:141112384-141112406 TCTGGTAGCACTTTCCTGGCCGG - Intergenic
1060750025 9:126162853-126162875 GCCGGTTCCTCTTACCTGGCAGG - Intergenic
1061849350 9:133405324-133405346 GCTGCTGTCACTCACCAGGCTGG - Exonic
1062265372 9:135684448-135684470 GCTGCTTGCCCCATCCTGGCAGG + Intergenic
1062720932 9:138043641-138043663 GCTGCTTGCCCATCCCTGGTGGG + Intronic
1203518430 Un_GL000213v1:25572-25594 GCTGCCTGCCCGGACCTGGCGGG - Intergenic
1192494489 X:71605968-71605990 GGTGCCTGCAGTTACCTGGGTGG + Intronic
1193625204 X:83811579-83811601 CCTCCTTGCAGCTACCTGGCTGG + Intergenic