ID: 1095986053

View in Genome Browser
Species Human (GRCh38)
Location 12:48000559-48000581
Sequence CTTCTCTGCTCCTGGGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 0, 2: 5, 3: 52, 4: 428}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095986053_1095986059 11 Left 1095986053 12:48000559-48000581 CCACCAGCCCAGGAGCAGAGAAG 0: 1
1: 0
2: 5
3: 52
4: 428
Right 1095986059 12:48000593-48000615 CTGCCTTCCTCTGGGAATTATGG 0: 1
1: 0
2: 2
3: 22
4: 247
1095986053_1095986058 3 Left 1095986053 12:48000559-48000581 CCACCAGCCCAGGAGCAGAGAAG 0: 1
1: 0
2: 5
3: 52
4: 428
Right 1095986058 12:48000585-48000607 TCTTTCTTCTGCCTTCCTCTGGG 0: 1
1: 1
2: 10
3: 99
4: 750
1095986053_1095986057 2 Left 1095986053 12:48000559-48000581 CCACCAGCCCAGGAGCAGAGAAG 0: 1
1: 0
2: 5
3: 52
4: 428
Right 1095986057 12:48000584-48000606 TTCTTTCTTCTGCCTTCCTCTGG 0: 1
1: 1
2: 14
3: 109
4: 816
1095986053_1095986060 12 Left 1095986053 12:48000559-48000581 CCACCAGCCCAGGAGCAGAGAAG 0: 1
1: 0
2: 5
3: 52
4: 428
Right 1095986060 12:48000594-48000616 TGCCTTCCTCTGGGAATTATGGG 0: 1
1: 0
2: 4
3: 27
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095986053 Original CRISPR CTTCTCTGCTCCTGGGCTGG TGG (reversed) Intronic
900019901 1:181146-181168 CCTCTCTGCGCCTGCGCCGGCGG - Intergenic
900298571 1:1965181-1965203 CTTCCCAGCTCCAGCGCTGGTGG - Intronic
900419541 1:2549744-2549766 CCCCTCTGCACCTGGGGTGGTGG + Intergenic
900425691 1:2577642-2577664 CCCCTCTGCACCTGGGGTGGTGG - Intergenic
900512376 1:3066797-3066819 CTCCTTTGCCCCTGGCCTGGAGG - Intergenic
900657156 1:3764058-3764080 CTGCCCTGTCCCTGGGCTGGAGG + Intronic
900829883 1:4958346-4958368 CTCCTCTCCTAATGGGCTGGGGG + Intergenic
901066291 1:6496296-6496318 CTCCACTGTTCCTGAGCTGGGGG + Intronic
901240066 1:7687707-7687729 CTTCTGTGTCCCTGGGCTCGTGG + Intronic
901628405 1:10636257-10636279 CCTCTCCTCTCCTGGGCTGCTGG - Intergenic
901649251 1:10734048-10734070 CAGCGCTCCTCCTGGGCTGGTGG - Intronic
901754436 1:11432765-11432787 CTGTTGTGCTCCTGGGCTTGTGG + Intergenic
901756264 1:11443314-11443336 ATGCTCTTCCCCTGGGCTGGTGG - Intergenic
901795478 1:11677058-11677080 CTGCTCAGCTGCTAGGCTGGGGG + Intronic
901854750 1:12037567-12037589 CTTCCCTGCTGCTGGGTGGGGGG + Intergenic
902399930 1:16152194-16152216 CTTCTCCGGTCCTGGCCTTGAGG - Intronic
903176949 1:21587108-21587130 ATTCTCTGCTCCTAGGGTCGGGG + Intergenic
903259947 1:22126221-22126243 CTCCCCTGCTCCTGGCCTGGAGG - Intronic
903265044 1:22153215-22153237 CCTCTCTGGTCCTGGGGTGAAGG + Intergenic
903969685 1:27110688-27110710 TTCTTCTGCTCCTGGGCTGGGGG - Intronic
904286800 1:29458103-29458125 CTGCACAGCTGCTGGGCTGGCGG + Intergenic
904308986 1:29613292-29613314 CTCCTCGGCTCCCAGGCTGGAGG + Intergenic
904364522 1:30001897-30001919 AGTCTCTGCTGCTGGGCTGATGG + Intergenic
905507675 1:38493107-38493129 CTTTTCTGCTCCTGCTCTGTGGG - Intergenic
909806187 1:79876099-79876121 GTTCTGTGGTCCTGAGCTGGAGG - Intergenic
909887558 1:80961898-80961920 ATTCACTGCACCTGGGCTGCAGG - Intergenic
913047428 1:115086388-115086410 TTGCTCTGCTCCTCTGCTGGTGG + Intronic
915681539 1:157586359-157586381 CTTGTCTGCTCCGTGGCTGAAGG - Exonic
915698492 1:157768605-157768627 CTGCTCTGCTCAGTGGCTGGGGG - Exonic
915713727 1:157925137-157925159 CTTGTCTGCTCCGTGGCTGAAGG + Intergenic
916214577 1:162384285-162384307 TTGCTCTGCCCCTGGGGTGGAGG + Intronic
916273890 1:162972670-162972692 CGTCTCTGCTCCTCAGCTGCAGG - Intergenic
917797941 1:178545324-178545346 CTTCTGTGGTTCTGGGGTGGGGG - Intronic
918940005 1:190981582-190981604 CTTCTTTGCTCCTCAGCTTGTGG - Intergenic
920379865 1:205529147-205529169 CCGCTCCGCGCCTGGGCTGGAGG - Intronic
920700405 1:208213918-208213940 CTTCTCTGCTCCAGAGCAGAGGG - Intronic
921185527 1:212666485-212666507 CTTCTCTGCTTTGGGGCGGGTGG + Intergenic
921759725 1:218899099-218899121 CTTCTTTACTCCTTTGCTGGAGG - Intergenic
922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG + Intronic
922532273 1:226353542-226353564 TTTCTCTCTCCCTGGGCTGGAGG - Intergenic
922755720 1:228095815-228095837 CTTCTGTGCTCCATGGGTGGTGG + Intronic
922989918 1:229897690-229897712 TTTCTCTGCTCCAGGCCTGTCGG + Intergenic
923388589 1:233490741-233490763 CTTCTCTGCTCCTGGGAAGAGGG - Intergenic
1062861448 10:813541-813563 CTTCTGTTGTCCTGAGCTGGCGG - Intronic
1062961315 10:1575661-1575683 CCTCTCTGGCCCTGGGGTGGAGG + Intronic
1063467723 10:6258429-6258451 CTTCTCTGTTTCTGGGCCTGAGG + Intergenic
1064783745 10:18871140-18871162 CTTCTCTGCTGCTGTTCTGTAGG + Intergenic
1065822454 10:29538526-29538548 CTGTTCTTCTCCTGGGCCGGTGG + Intronic
1067693615 10:48520034-48520056 CTCCTGTGCTCCTGCCCTGGAGG - Intronic
1067791775 10:49293673-49293695 CTGCTCTGCTTCTGCACTGGAGG + Intergenic
1067809867 10:49418137-49418159 GTCCTCTGCTCCTGGGCCTGGGG - Intergenic
1069752405 10:70752786-70752808 CTTCTGCTCCCCTGGGCTGGGGG + Intronic
1069753823 10:70761362-70761384 CTTCCCAGCTGCAGGGCTGGAGG + Exonic
1069841987 10:71345731-71345753 CTACTCTCCTCCTGGGGTGGCGG - Intronic
1070187396 10:74078252-74078274 CCACTGTGGTCCTGGGCTGGTGG + Intronic
1070571170 10:77639942-77639964 CTTTTCTGGTACTGGGTTGGGGG + Intergenic
1070836863 10:79452986-79453008 CTTCTGTGCCCCTGGGCTGGGGG - Intergenic
1071349352 10:84723982-84724004 ATGCTCTGCTCCTGGGATGATGG + Intergenic
1071700189 10:87923317-87923339 CATCTCAGGTCCTTGGCTGGGGG - Intronic
1073292627 10:102420911-102420933 CTTCTCGGCTACAGGGCTTGAGG - Exonic
1074753627 10:116609330-116609352 CTTCTCCGTGCCTGAGCTGGTGG + Intergenic
1075255925 10:120926107-120926129 CTTAGCTGCTCCTGGGAAGGAGG + Intergenic
1075702909 10:124480870-124480892 CCTGTCAGCTCCAGGGCTGGGGG + Intronic
1075812507 10:125235241-125235263 GGTTTCTGCTCCTGGGGTGGGGG - Intergenic
1076366177 10:129922283-129922305 ATCCTCTGTTCCTTGGCTGGGGG - Intronic
1076473601 10:130737036-130737058 CTTGTATCCTCCTTGGCTGGTGG + Intergenic
1076551770 10:131283359-131283381 CTGGTCTGCTCCTGGGTTGATGG + Intronic
1076925384 10:133481156-133481178 CCACCCTGTTCCTGGGCTGGTGG + Intergenic
1077093360 11:789335-789357 ACTCCCTGCTCCAGGGCTGGAGG - Intronic
1077235293 11:1479198-1479220 CGCCTCTGCTCCTGGGCAGACGG - Intronic
1077247344 11:1546192-1546214 CCGCCCTGCACCTGGGCTGGGGG + Intergenic
1077295913 11:1826278-1826300 CTGGTCTGCCCCTGAGCTGGGGG + Intergenic
1077330631 11:1982501-1982523 CTGCCCAGCTCCTGGGCTGTGGG + Intronic
1077703268 11:4461042-4461064 CTTCACGGGTGCTGGGCTGGGGG + Intergenic
1078904380 11:15670857-15670879 CCTCTCTGCTCCTGGGCCGGCGG - Intergenic
1079225279 11:18599674-18599696 CTGCTCAGCTGCTGGTCTGGGGG + Intergenic
1079291417 11:19191453-19191475 CTTCTCTGCTTCTGTCCAGGAGG - Intronic
1079871292 11:25801439-25801461 CTTCCCTGCTCCTCAGCTTGCGG - Intergenic
1080034704 11:27699829-27699851 CTCGACTACTCCTGGGCTGGGGG + Intronic
1080848644 11:36048389-36048411 CTTCTCACCTCCTGGGCAGGGGG - Intronic
1083770392 11:64863902-64863924 CCTGTCGGGTCCTGGGCTGGAGG - Intronic
1083951716 11:65960124-65960146 CTTCTCTGCTCCTGAGGAGTGGG + Intergenic
1084278932 11:68073669-68073691 CCTCTCTGTTTCTGGGCTGTGGG + Intronic
1084313990 11:68333130-68333152 CGTCTCTCCTACTGGGGTGGCGG - Intronic
1084587200 11:70069110-70069132 CATCTCTGAGCATGGGCTGGGGG + Intergenic
1084950553 11:72662929-72662951 GTTCATGGCTCCTGGGCTGGAGG - Intronic
1087264247 11:96043338-96043360 CTTTTCTGTTCCTGGACAGGGGG - Intronic
1087914759 11:103797259-103797281 CCTCTCTGCTCCTGCTCTGTTGG - Intergenic
1088986467 11:114913717-114913739 CATCTCTGCACCTGAGCTGTAGG + Intergenic
1089280522 11:117371165-117371187 GCTGTCTGCACCTGGGCTGGAGG - Exonic
1090196603 11:124821850-124821872 CATCTATGCTGCTGAGCTGGGGG + Intergenic
1090334041 11:125950966-125950988 CTGCTCTGTGCCTGGCCTGGGGG + Intergenic
1090974872 11:131672185-131672207 CTGCTCTGCTCCTGGTGGGGAGG - Intronic
1091238126 11:134035035-134035057 CCTCTCTGCTCCTGGGCACTGGG - Intergenic
1091356435 11:134941291-134941313 CCTCTCTGCTGCTGTCCTGGAGG + Intergenic
1202813609 11_KI270721v1_random:37680-37702 CTGCCCAGCTCCTGGGCTGTGGG + Intergenic
1091373278 12:10733-10755 CCTCTCTGCGCCTGCGCCGGCGG - Intergenic
1091381821 12:66839-66861 CCTGCCTGCGCCTGGGCTGGCGG - Exonic
1092021296 12:5204544-5204566 TTTCTCTGCTCCTCGGCCTGTGG - Intergenic
1092755624 12:11760466-11760488 ATTCTCTACTTCTGGGGTGGGGG + Intronic
1094613240 12:32013514-32013536 CTTCTGCCCTCCTGGGGTGGGGG + Intergenic
1095986053 12:48000559-48000581 CTTCTCTGCTCCTGGGCTGGTGG - Intronic
1096478350 12:51922361-51922383 CTTCTCTGCCCCAGGACTGCAGG + Intronic
1097065134 12:56315386-56315408 CTTCTCTGTTCCAGCGCTTGAGG + Intronic
1097938361 12:65278429-65278451 CTCCTCTGCCCCAGGGCTGCCGG - Intergenic
1098731426 12:74040372-74040394 CTTCCCTGCTCCTCAGCTTGTGG + Intergenic
1098780269 12:74677270-74677292 CTTCTCTGCTGCAGGTCTGCAGG - Intergenic
1099317681 12:81104801-81104823 CTTCTCTGACACTGTGCTGGTGG - Intronic
1100275394 12:93067341-93067363 CTTCTCTGCTCCTTGACTTTGGG - Intergenic
1101778441 12:107814878-107814900 CTTCACTGTCCCTGGCCTGGGGG - Intergenic
1101838405 12:108310958-108310980 CTGCTCATCTCCTGGGCGGGGGG - Intronic
1102231277 12:111264136-111264158 CTTCTGTGCTAATGGGATGGGGG - Intronic
1102600946 12:114029956-114029978 CTTGTCTGCTGCTGGGATGGAGG + Intergenic
1102680035 12:114684931-114684953 CTCCCCTGCGTCTGGGCTGGGGG + Intergenic
1102755445 12:115335782-115335804 CTTCCCTCCTTCTGGGCTGCTGG - Intergenic
1102997854 12:117363285-117363307 CTGCTCTTCCACTGGGCTGGCGG + Intronic
1103914802 12:124370666-124370688 CATCTTTGGTTCTGGGCTGGAGG + Intronic
1103950697 12:124549496-124549518 CTTCTCTGTGCCTGGCCTCGCGG - Intronic
1104067469 12:125317484-125317506 CTTGCCTTTTCCTGGGCTGGGGG + Intronic
1104447285 12:128844700-128844722 CTTCTGTCCTCCAGAGCTGGAGG + Intergenic
1105611925 13:21976301-21976323 AGCCTCTGCTCCTGTGCTGGTGG + Intergenic
1107862052 13:44670434-44670456 CTTTCCTGCTCCTGGGCTGGTGG - Intergenic
1107967432 13:45610048-45610070 CCTCTCTCCTCCTGGCCTGGTGG - Intronic
1109381705 13:61569745-61569767 CTTCACTGCTCCAGAGCTGGGGG - Intergenic
1112369843 13:98784910-98784932 CTGCTCTCCTCCTGAGCTGATGG + Intergenic
1113649334 13:112024609-112024631 TTTTTCTGCTACTGGGCGGGGGG - Intergenic
1113694670 13:112335981-112336003 CTCCTCTGGTGCTTGGCTGGAGG - Intergenic
1113748967 13:112765354-112765376 GTTTTCTGGTCCTGGCCTGGGGG + Intronic
1113801089 13:113086547-113086569 CTTGTCTTCTCCTGGGGAGGAGG + Intronic
1114073160 14:19131682-19131704 CTCCTCAGCTGCTGGGGTGGCGG + Intergenic
1114089106 14:19268301-19268323 CTCCTCAGCTGCTGGGGTGGCGG - Intergenic
1114342049 14:21754960-21754982 CTTCTCTGCTCCGGGTCTGCTGG - Intergenic
1114415286 14:22538826-22538848 CTTCTCTGCTGATGGGAAGGTGG + Intergenic
1114472339 14:22972514-22972536 TTGCTCTTCTCCTTGGCTGGGGG - Exonic
1120523254 14:85548901-85548923 CTGCTCTGCTGCTCTGCTGGTGG - Intronic
1121582932 14:95044531-95044553 CCTCCCTCCTCCTTGGCTGGAGG - Intergenic
1121731861 14:96192941-96192963 CTTTTCTGCACCTGGGGTGCAGG + Intergenic
1122320958 14:100855509-100855531 CTTCTCCGCTCATGGGTGGGAGG - Intergenic
1122584250 14:102793699-102793721 CTTCCCTGATCCTGCACTGGTGG - Intronic
1122655718 14:103258257-103258279 CTTCTCTGTCCCTGGGCTCCTGG + Intergenic
1122834502 14:104424248-104424270 CTTCTCTGCACATGGCTTGGGGG - Intergenic
1122859481 14:104576132-104576154 CTGCTCTGCACAGGGGCTGGTGG - Intronic
1122909772 14:104821754-104821776 CTTTGCTGTTCCTTGGCTGGTGG + Intergenic
1122946676 14:105014184-105014206 CCCTTCTGCTCCTGGGCTGTGGG + Intronic
1123047497 14:105526205-105526227 CCTGTCAGCTCCTGGGCCGGTGG + Intergenic
1123218957 14:106839243-106839265 GTCCTCTGGTCCTGGGCTGCCGG + Intergenic
1124109439 15:26772905-26772927 CTTCTCGGCCCCGGTGCTGGTGG - Exonic
1127299339 15:57637424-57637446 TTTCACTGATCCTGGGCTGATGG + Intronic
1127807874 15:62537770-62537792 CTTCTCTGCTCCTGTGCTCTGGG + Intronic
1127983882 15:64053323-64053345 CTGCTGTGCCCCTGGGCTGTCGG - Intronic
1128104062 15:65029927-65029949 CCTCACTGCTCCTGGGCTCAAGG + Intergenic
1128177695 15:65570800-65570822 CTTCTCAGCTCCAGGTTTGGTGG + Intronic
1128306382 15:66601474-66601496 CTGCTCTGCTGATGGGGTGGGGG + Intronic
1128391423 15:67185312-67185334 CTTCTCTCTACCTGGGCTGCTGG - Intronic
1128660927 15:69500487-69500509 CTGCACTGCTCCTTGGCTTGAGG + Intergenic
1129596916 15:76972798-76972820 CTTATCTACTCCCGGGCCGGCGG + Intergenic
1131027668 15:89158449-89158471 CTTCTCTGCTCTTCAGCTGCTGG - Intronic
1131411162 15:92209409-92209431 CTTCTTTCCTTCTGGGCAGGGGG - Intergenic
1131825746 15:96321792-96321814 GTTCCCTGCTCGTGGGCAGGTGG - Intergenic
1132841391 16:1979945-1979967 CTCCTCTGCTCCTGGACCCGAGG - Exonic
1132871386 16:2117191-2117213 CTGCTGTGAGCCTGGGCTGGTGG - Intronic
1134521142 16:14919703-14919725 CTGCTGTGAGCCTGGGCTGGTGG + Intronic
1134708818 16:16318354-16318376 CTGCTGTGAGCCTGGGCTGGTGG + Intergenic
1134716029 16:16358388-16358410 CTGCTGTGAGCCTGGGCTGGTGG + Intergenic
1134950787 16:18350291-18350313 CTGCTGTGAGCCTGGGCTGGTGG - Intergenic
1134958727 16:18393771-18393793 CTGCTGTGAGCCTGGGCTGGTGG - Intergenic
1137594050 16:49712208-49712230 CTTCTCTGCTCCTCACTTGGAGG + Intronic
1138272073 16:55702517-55702539 CTTCTGTGCATCTGGCCTGGGGG + Intronic
1138579588 16:57932077-57932099 TTTCGTGGCTCCTGGGCTGGTGG - Intronic
1139353237 16:66351059-66351081 CTACTCTGTTCTTGGACTGGAGG - Intergenic
1140218853 16:73029064-73029086 CTTCTCTGCTGCTGGGCTTGAGG - Intronic
1140969636 16:80000704-80000726 CTTCCCTTCTCCAGTGCTGGTGG - Intergenic
1141604221 16:85143824-85143846 CAAGTCTCCTCCTGGGCTGGGGG - Intergenic
1142007814 16:87698198-87698220 CTTCTCGCCGCCTGGTCTGGTGG + Intronic
1142079566 16:88141792-88141814 CTTCTGTGTTCCTGGGCTCATGG - Intergenic
1143733939 17:8897248-8897270 CCTCTCTGCTCCTGGACTCCCGG - Intronic
1143778131 17:9212764-9212786 CCGCTCTGCTTCTGGGCTGTCGG - Intronic
1143799592 17:9367629-9367651 CTTCTGTGTTCCTGGTTTGGGGG - Intronic
1144434026 17:15223362-15223384 CTTCTCTGCTGCAGGTCTGCTGG + Intergenic
1144470441 17:15535471-15535493 CTTTTCAGCTACTGGCCTGGAGG - Intronic
1144758779 17:17695308-17695330 GGCCTGTGCTCCTGGGCTGGAGG - Intronic
1144925900 17:18808201-18808223 CTTTTCAGCTACTGGCCTGGAGG + Intergenic
1145009674 17:19360784-19360806 CTTCTCTACTCATGGTCTAGAGG - Intronic
1145258090 17:21338538-21338560 CTTCTGTGTTCCTGGGATGCTGG + Intergenic
1145863330 17:28225530-28225552 CCTCTCTCCTACTGGGCAGGTGG + Intergenic
1147258389 17:39195393-39195415 CTGCTCTGCTCCTGCGGAGGGGG - Intronic
1147454104 17:40524432-40524454 CTTCTCTGTGCCTCTGCTGGTGG - Intergenic
1147577225 17:41609813-41609835 CTCCCCTGCTCCTCTGCTGGTGG - Exonic
1147585352 17:41651335-41651357 CTGCTCTGCTCCTGGAATGGAGG - Intergenic
1147927619 17:43955188-43955210 CCTTTCTCCTCCTGGGCAGGTGG - Intronic
1147970875 17:44218804-44218826 CCGCTCCGCTCCGGGGCTGGCGG - Intronic
1148126830 17:45241623-45241645 CTCCTGCGCACCTGGGCTGGGGG - Exonic
1148155044 17:45418816-45418838 CTCCTCAGCTCCTGGGCTCAAGG - Intronic
1148483935 17:47978489-47978511 CTTCTCTGCTGTTGGGGCGGGGG - Intronic
1152007797 17:77693457-77693479 CTCCTCTGTTCCTGTTCTGGAGG - Intergenic
1152114773 17:78378794-78378816 CCTCTCACCTCCTGCGCTGGCGG - Exonic
1152134798 17:78497563-78497585 CAGCTCTGCTCCTGTGCTGGGGG + Intronic
1152151130 17:78602090-78602112 CTTGTGAGGTCCTGGGCTGGGGG + Intergenic
1152201914 17:78952316-78952338 TTTCTCTTCTCCTGGGCCTGGGG + Intergenic
1152250342 17:79209236-79209258 CTGGCCTGCTCCTGGGATGGGGG - Intronic
1152575667 17:81139779-81139801 CTCCTCTGCAACTGGGCTGGAGG + Intronic
1153399395 18:4666806-4666828 CATCACAGCTCCTGTGCTGGTGG + Intergenic
1153523983 18:5977846-5977868 CTTACCTCCTCCTGGGCTGAGGG - Intronic
1154327374 18:13401215-13401237 CCTGTCTGCTCCTGGGCATGTGG - Intronic
1154498214 18:14978014-14978036 CCTCTCTGCTGCTGTCCTGGAGG - Intergenic
1154954793 18:21242827-21242849 CCTCACTGCCCCTGGGCTCGGGG - Intronic
1157544687 18:48539457-48539479 CATCCCTGCTCCTGGGCCAGCGG + Intronic
1157932007 18:51833503-51833525 CTGCTTTGATCCTGGACTGGGGG - Intergenic
1158509031 18:58074049-58074071 CTTCCCTGTTCCTGGGTTGAGGG + Intronic
1160335980 18:78040007-78040029 CTTCTATGCTGCTGGCCTTGAGG - Intergenic
1160381303 18:78458262-78458284 CTTCTCTGAACCTGGGAAGGAGG + Intergenic
1160406481 18:78649785-78649807 GGGCTCTGCTCCTGGGCTTGGGG - Intergenic
1160763144 19:795869-795891 GTTTTCTGCTGCTGGGATGGTGG + Intergenic
1161307961 19:3577840-3577862 CTGCGCCGCTCCTGCGCTGGCGG + Intronic
1162018397 19:7857738-7857760 CTTCTCTAGTCCTGGGCTCTGGG - Intronic
1162497372 19:11030804-11030826 CTGCTCAGCACCCGGGCTGGGGG + Exonic
1162576006 19:11499194-11499216 CTTCTCTGCTCCCTGACTGTGGG - Intronic
1162872942 19:13599757-13599779 ATTCTTTCCTCCTGGCCTGGGGG + Intronic
1163124778 19:15238970-15238992 CCTCTCGGCTCCTGGGCAGAGGG + Exonic
1163176393 19:15566689-15566711 CTTCTCTCCTCTCGGGGTGGGGG + Intergenic
1163196931 19:15728476-15728498 GTGGGCTGCTCCTGGGCTGGTGG + Exonic
1163204761 19:15794481-15794503 GTGGGCTGCTCCTGGGCTGGTGG + Exonic
1163206541 19:15807583-15807605 GTGGGCTGCTCCTGGGCTGGTGG - Exonic
1163734800 19:18973092-18973114 CTTATCTGCTTCTGGGCCAGTGG - Intergenic
1164615678 19:29665615-29665637 CTTGGCGGCTCCTGGGCCGGCGG + Intronic
1164767193 19:30781139-30781161 CTTGTCTGCTTTTGTGCTGGGGG + Intergenic
1166333250 19:42090725-42090747 CTTCGCTGGCCCAGGGCTGGGGG + Exonic
1166704917 19:44903308-44903330 CTCCTCAGCTGCTGGGGTGGCGG - Exonic
1166783230 19:45352966-45352988 CCTCTGTGCACCTAGGCTGGGGG + Intronic
1166950962 19:46427897-46427919 GTGCTCTGTGCCTGGGCTGGGGG - Intergenic
1167866187 19:52330336-52330358 CTTTTCTGCTCCCAGGATGGTGG + Intergenic
1167916239 19:52742285-52742307 CTTCACTGGTGTTGGGCTGGGGG + Intergenic
1168235880 19:55062906-55062928 CTTCCCGGCCCCTGCGCTGGGGG + Intronic
1168443529 19:56392151-56392173 CTTCTATGCTCCCTGGCTTGAGG - Intronic
925030076 2:643465-643487 CTTCTCTGGCTCTGGGCTGTGGG + Intergenic
925036391 2:690086-690108 CTCCTCTGCCCCGGGGCTGCCGG + Intergenic
925497927 2:4472985-4473007 CTTCCCTGCTCCTCAGCTTGGGG - Intergenic
925556534 2:5136920-5136942 CTTCTCTGCCCTTTGGCTGCAGG + Intergenic
925731989 2:6925675-6925697 CTTCTCTGTCTCTGCGCTGGGGG + Intronic
926251337 2:11156861-11156883 CCTCTCTGCTCCCAGCCTGGTGG - Intronic
926949111 2:18222006-18222028 CTCCTCTCCTCTTGAGCTGGTGG + Intronic
927882803 2:26700490-26700512 CTCCAGTTCTCCTGGGCTGGTGG + Intronic
929454024 2:42053986-42054008 CTGCTTTTCTCCTGGGTTGGGGG - Intronic
929779720 2:44949807-44949829 CATCTCAGCTCCAGCGCTGGGGG - Intergenic
930022803 2:47011708-47011730 CTACTCTGCTGCTGGGCAGGTGG - Intronic
930152305 2:48070985-48071007 CTCCGCAGCTCCTGGCCTGGAGG + Intergenic
931515001 2:63045214-63045236 CTTCTCGGCCCCTCGGCAGGTGG - Intronic
932511706 2:72299793-72299815 CCTCTCTGCTGCAGGTCTGGTGG + Intronic
932580511 2:72990136-72990158 CTGCGCTGCCCCGGGGCTGGCGG - Intronic
933593548 2:84260097-84260119 CTTCTTTGATCTTGAGCTGGGGG - Intergenic
933832500 2:86222258-86222280 CATCACTCCTACTGGGCTGGAGG - Intronic
934871918 2:97873635-97873657 CTCCTCTGCTGCTGGTCTGCTGG - Intronic
934976866 2:98808898-98808920 CTTATCTGCTCCTGGGAGGTGGG + Intronic
935014647 2:99169124-99169146 CTTCTCTGTTACTTGGCTGCGGG - Intronic
936043878 2:109171488-109171510 CCTCACTGCTGCTGGGCTCGCGG + Intronic
937121075 2:119440274-119440296 GTCCTCTCCTCCTGGGCTGATGG - Intronic
937163327 2:119787152-119787174 CAAATCTTCTCCTGGGCTGGTGG + Intronic
938307430 2:130265257-130265279 CTTCCCTGCTCCCGTCCTGGTGG + Intergenic
938447903 2:131391585-131391607 CTTCCCTGCTCCCGTCCTGGTGG - Intergenic
939625699 2:144474248-144474270 GTCCTCTTCTCCTGGCCTGGAGG + Intronic
941175744 2:162195503-162195525 CTTCTCTTCTCCCGGGTTGGGGG + Intronic
942732352 2:179074296-179074318 CTTCTTTGCTCCTCAGCTTGCGG + Intergenic
944509611 2:200451650-200451672 CTCCTCTGCTCCTGGCCTCCAGG - Intronic
944872330 2:203926507-203926529 CTGCTCATCCCCTGGGCTGGAGG + Intergenic
944913922 2:204338094-204338116 CTTCTCAGATCTTGAGCTGGAGG - Intergenic
945048007 2:205798865-205798887 CTGCTCTGCTGCTCTGCTGGTGG + Intergenic
945125957 2:206509899-206509921 CTTCTCTCCTCCTGAGCCCGTGG + Intronic
945553361 2:211248994-211249016 CTTCTGTGATCCTGGGCTTAAGG - Intergenic
946219978 2:218217619-218217641 TTTCTCTCCTCCAGGTCTGGGGG - Intronic
947442322 2:230133936-230133958 CGTCTCTGCTGCTGGCCTGGAGG + Intergenic
948228567 2:236332984-236333006 CTACTCTGCTCCTGCCTTGGTGG + Intronic
948476838 2:238226054-238226076 CTTTTCTGCTGTTTGGCTGGAGG - Intronic
948523392 2:238556406-238556428 CTTCTCTGCTCTTTGGCTTCTGG + Intergenic
948528314 2:238587146-238587168 ATTCTCTGCTCCCTGCCTGGGGG - Intergenic
948579930 2:238979876-238979898 TTTCTCTGCACGTGGGGTGGTGG + Intergenic
948720345 2:239895289-239895311 CATCTGTGCTCCTGGTCTGCTGG + Intronic
948958583 2:241315060-241315082 CGTCGCTGCTCGTGGGCTCGCGG + Intronic
948988343 2:241539718-241539740 CTGCTCTGGGCCTAGGCTGGAGG + Intergenic
949051838 2:241901859-241901881 CCTCTCGGCTCCAGGGCAGGTGG - Intronic
1169005969 20:2207494-2207516 CGTCACTTCTCGTGGGCTGGCGG - Intergenic
1169055458 20:2617081-2617103 CTTCTATGCTCCAGGCCTGGTGG + Exonic
1169208322 20:3752286-3752308 CTTATCTCCCCCGGGGCTGGAGG - Exonic
1169515627 20:6312831-6312853 CTTCTCAGCTCCAAGGATGGTGG - Intergenic
1170646705 20:18203036-18203058 CTTCTCTGCTCATGTGCCTGAGG - Intergenic
1171543906 20:25986556-25986578 CTCCTCTGCTCCTGGGTGGACGG + Intergenic
1172302485 20:33859904-33859926 CTTCCCTGCTGCTGTGGTGGGGG + Intergenic
1172579695 20:36037104-36037126 CTGCTCAGCCCCTGGGGTGGGGG - Intergenic
1172604647 20:36206515-36206537 TTTCTCTCCTCCAGGGGTGGAGG - Intronic
1172765278 20:37347324-37347346 CTTCTCAGCCCCCTGGCTGGGGG + Intronic
1172889385 20:38253155-38253177 CTTCTCTGACCTTGGGCTGCAGG - Intronic
1173165350 20:40683613-40683635 GTTCTCTTTTCCTGGGCTTGTGG + Intergenic
1173863869 20:46301926-46301948 CTTCTGGGCTCCTGGACAGGAGG + Intronic
1175298213 20:57923831-57923853 CTCGCCTGTTCCTGGGCTGGCGG + Intergenic
1175766909 20:61598399-61598421 CTGCTGAGGTCCTGGGCTGGGGG - Intronic
1175812136 20:61864154-61864176 CTTGGGTGCTCCTGGGCTTGTGG - Intronic
1176052863 20:63129798-63129820 CTGCCCTGCTCCTGGGGTGTGGG + Intergenic
1176151284 20:63592422-63592444 CTTCTGTGCTGCTGGGTTGGAGG - Intronic
1176185533 20:63776265-63776287 CTGCTCTGCTCCAGGGCCGAGGG + Intronic
1176231522 20:64035679-64035701 CCTCACTCCTCCTGGGCTGAGGG - Intronic
1176302503 21:5105261-5105283 CTTCCGTGCTTCTTGGCTGGCGG - Intergenic
1178840286 21:36133038-36133060 CTTGTCCCCTCCTGGGCTGGTGG + Intergenic
1179854524 21:44156662-44156684 CTTCCGTGCTTCTTGGCTGGCGG + Intergenic
1180091475 21:45535749-45535771 CTTATCTGCTGCTTTGCTGGAGG - Intronic
1180091971 21:45537930-45537952 CTTCTCCACCGCTGGGCTGGAGG + Exonic
1180228266 21:46411396-46411418 CTGCTCTGCTCCCAGGCCGGGGG + Exonic
1180491601 22:15854035-15854057 CTCCTCAGCTGCTGGGGTGGCGG + Intergenic
1180763056 22:18223542-18223564 CCTCTCAGCTCCCGGGCTGGGGG - Intergenic
1180772587 22:18401005-18401027 CCTCTCAGCTCCCGGGCTGGGGG + Intergenic
1180803967 22:18650621-18650643 CCTCTCAGCTCCCGGGCTGGGGG + Intergenic
1180806796 22:18718828-18718850 CCTCTCAGCTCCCGGGCTGGGGG - Intergenic
1180931957 22:19598322-19598344 GTTCTCTGCTGCTGGGGTGCAGG + Intergenic
1181048156 22:20226382-20226404 CTGCACTGCTGCTGTGCTGGGGG - Intergenic
1181217752 22:21344638-21344660 CCTCTCAGCTCCCGGGCTGGGGG - Intergenic
1181260398 22:21593237-21593259 CTTCCCTGCGCCTGGCCTGATGG + Intronic
1181329296 22:22076728-22076750 CTTTCCTGCACCTGGGCTGAAGG + Intergenic
1181788302 22:25243499-25243521 TGTCTCTGGTGCTGGGCTGGCGG + Intergenic
1181820043 22:25468513-25468535 TGTCTCTGGTGCTGGGCTGGAGG + Intergenic
1182067430 22:27440714-27440736 CTTCTTTCCTCCTGGTCTGGAGG - Intergenic
1183015842 22:34985934-34985956 CTGCTCTCCTCTTGGGGTGGGGG - Intergenic
1183464559 22:37973187-37973209 CTTCTCAGGTCCTGGGATAGAGG + Exonic
1183782153 22:40005898-40005920 ATGCTCTGCTGCTGGGGTGGGGG + Intronic
1183989563 22:41589148-41589170 CCTCTCTGCTCCACGACTGGGGG + Intronic
1184534574 22:45077770-45077792 CTTCTCTGCTCCTGGTGATGTGG - Intergenic
1184781583 22:46652303-46652325 CTCCTGTGCTCCTTGGCTTGCGG - Intronic
1184942947 22:47782257-47782279 CTTCTCCTCTCCTGCTCTGGAGG - Intergenic
1185316078 22:50179665-50179687 CTTCCCTGGCTCTGGGCTGGGGG - Exonic
1203234425 22_KI270731v1_random:141993-142015 CCTCTCAGCTCCCGGGCTGGGGG + Intergenic
949173094 3:1026366-1026388 CTTCTGTGTTCCTGCACTGGGGG - Intergenic
949731947 3:7123866-7123888 CTTCTCCGCTCCTGAGTTTGGGG + Intronic
950313549 3:11979933-11979955 CTTTTCAGCTCCTGTGTTGGAGG + Intergenic
950507842 3:13406769-13406791 CTTCTCTGCACCTCAGCAGGTGG + Intronic
950580871 3:13861291-13861313 TTCCTCTGCTCCTGGGCAGGAGG - Intronic
950597347 3:13996535-13996557 CCCCTCTGCTCCAGGTCTGGTGG + Intronic
950799157 3:15535320-15535342 CTTCCCTACTCCTGTGCTGGTGG + Intergenic
952960100 3:38583591-38583613 CCTCTGGGCTCATGGGCTGGTGG + Intronic
953186862 3:40646127-40646149 CTGGCCTCCTCCTGGGCTGGTGG - Intergenic
953848754 3:46449449-46449471 CTTCTCTACTGGGGGGCTGGGGG - Intronic
955203541 3:56874758-56874780 CTTCTCCTCTCCTGTCCTGGAGG + Intronic
957617582 3:82551191-82551213 GTACTCTGCTCCTGTTCTGGAGG + Intergenic
959025755 3:101237603-101237625 CTTCTCTGCTGCAGGTCTGCTGG - Intronic
960254256 3:115494803-115494825 CTCCTCTGGTTCTGGGGTGGAGG + Intergenic
960519226 3:118636363-118636385 CGTCTCAGCTCATGGGCTGGTGG - Intergenic
960913921 3:122678750-122678772 CTTCTCAGGGCCTGGGGTGGGGG - Intergenic
960994781 3:123333585-123333607 CTGCCTTCCTCCTGGGCTGGGGG - Intronic
961108277 3:124260683-124260705 CATCTTGGCTCCTGGGGTGGAGG + Intronic
961207021 3:125092363-125092385 TTTCTCAGATCCTTGGCTGGTGG - Intronic
961306240 3:125960281-125960303 CATCTCTCCTCCTGGCGTGGCGG - Intergenic
961574681 3:127824567-127824589 CTCCTCTGCTCCAGGCCTCGTGG - Intergenic
961920097 3:130416611-130416633 CTTCTCTCCTCCTGGGTGGCTGG + Intronic
962254200 3:133859409-133859431 CTTTTCTATTCCTGGGTTGGGGG + Intronic
962835532 3:139185506-139185528 CTGCTCTGCTCTTGGCCTAGAGG + Intronic
964102048 3:152998689-152998711 ATTTTCTGCTGCTGGGCTGTAGG + Intergenic
968003764 3:195225459-195225481 CTTCTGGTCTGCTGGGCTGGAGG + Intronic
968505859 4:971237-971259 CTCCTGGGCTCCTGGGCTGCAGG - Intronic
968547407 4:1206096-1206118 CTCCCCTGGTACTGGGCTGGGGG + Intronic
968554998 4:1242378-1242400 CTGCCATGCTGCTGGGCTGGTGG - Intronic
968575919 4:1366103-1366125 CTGCACTGCCCCTGTGCTGGGGG - Intronic
968610994 4:1556885-1556907 CTCCTCTTCTCCGGGGCGGGCGG + Intergenic
968901204 4:3432757-3432779 CTCCTCAGCCCCTGGGCAGGTGG + Intronic
969321675 4:6416686-6416708 CATCTGTGGTCCCGGGCTGGAGG - Intronic
969557996 4:7926541-7926563 CTTCTCTCCTCCTTGGGTAGAGG - Intronic
969703981 4:8782256-8782278 CTGCTCTGTCCCGGGGCTGGGGG - Intergenic
969874227 4:10124101-10124123 CATCTCTGCTCCTTGGCCTGTGG + Intergenic
970378540 4:15482511-15482533 CTTCTCTGTGCCTGCACTGGGGG + Intronic
973644834 4:52940040-52940062 CTTCTGTCCTCCTGAGTTGGGGG - Intronic
977753327 4:100635260-100635282 CTTCTCTGCTCCTCAAGTGGAGG - Intronic
981592228 4:146376478-146376500 CTGCTCTGCTCCTGTGCCAGTGG - Intronic
982000179 4:151015226-151015248 TCTCGCTGCTCCTGGGCGGGGGG - Intronic
985851505 5:2391902-2391924 CTTCTGTGCTCCTGGCCCCGTGG + Intergenic
985851529 5:2392006-2392028 CTTCTGTGCTCCTGGCCCCGGGG + Intergenic
985926819 5:3025648-3025670 CTGCTGTGCTCCTGGGCTCGTGG + Intergenic
988697824 5:33641763-33641785 CTTCTCTCCACATGTGCTGGGGG - Intronic
992350615 5:75925157-75925179 CTTCCCAGCTCCAGGACTGGGGG - Intergenic
993895084 5:93523739-93523761 CTTCTCTGCTACAGGTCTGCTGG - Intergenic
995581406 5:113606677-113606699 TTTCTCCGCCCTTGGGCTGGAGG + Intergenic
996747106 5:126854781-126854803 CCTCACTGCCCCCGGGCTGGGGG + Intergenic
997927002 5:138039904-138039926 CTTCTCTGCTGATGAGCTTGGGG - Intronic
998216344 5:140240883-140240905 AATCTCTGCTCCTGGGCTGTTGG - Intronic
999366596 5:151027610-151027632 CTCCCCTGCTCCTGGGCTCTTGG + Intronic
999699811 5:154218083-154218105 CCTCTCTGCTCTTGGGCGGTGGG - Intronic
1000230855 5:159313923-159313945 CCACTCTGCTCCTGGCCTGGAGG - Intergenic
1001640938 5:173243898-173243920 CTTCTCTGGGCTGGGGCTGGTGG + Intergenic
1002425060 5:179170054-179170076 ATGCTCTGCTCCCTGGCTGGTGG + Intronic
1002460205 5:179369551-179369573 CTTTGCCGTTCCTGGGCTGGGGG + Intergenic
1002707772 5:181174280-181174302 CTTCTCTGCTGGGGCGCTGGTGG - Intergenic
1003387605 6:5683524-5683546 TTTCCCAGCTCCTAGGCTGGTGG - Intronic
1004458665 6:15815749-15815771 ACTCTGTGCTCATGGGCTGGAGG - Intergenic
1005379363 6:25217847-25217869 ATTCCTTGATCCTGGGCTGGTGG - Intergenic
1007073192 6:39050840-39050862 CTTCCCTGCTCCTGAACTGCTGG - Intronic
1007655149 6:43447234-43447256 CTTCTCTCCCCCAGGGCTGGTGG + Exonic
1007829805 6:44629617-44629639 CTGGTCTGCCCCTGGCCTGGAGG - Intergenic
1008651591 6:53569472-53569494 CTTCTCACCTCCTGTGATGGTGG + Intronic
1008714581 6:54273461-54273483 CTTCCCTGATTCAGGGCTGGGGG + Intergenic
1008838437 6:55867323-55867345 CTTCACTACTCCTGGGCAGGGGG - Intronic
1010010631 6:71044064-71044086 ATTCTCTGTTGCTGAGCTGGAGG + Intergenic
1011078778 6:83466641-83466663 ATACTCTGTTGCTGGGCTGGGGG + Intergenic
1011382203 6:86754366-86754388 CTTCTCTGGTCCAGGGCTTAGGG - Intergenic
1011700676 6:89951500-89951522 CTTCTCTGCTACGGGGATGGCGG + Exonic
1012211376 6:96522158-96522180 TTTCGCTGCAGCTGGGCTGGGGG - Intronic
1013978168 6:116100628-116100650 CTTCTGGGCTCCTAGGCTTGCGG + Intergenic
1014113481 6:117646466-117646488 CTTCTCTGCTGCAGGTCTGCTGG - Intergenic
1015550589 6:134408483-134408505 CTTCTCTTCTCATGGACTGTAGG + Intergenic
1017164102 6:151391350-151391372 CTTCCCGGACCCTGGGCTGGGGG + Intronic
1018569538 6:165194643-165194665 CTTCCCTGCTCCTCAGCTTGCGG + Intergenic
1018850110 6:167581592-167581614 ATGCTATGCTCCTGGGCTGGAGG - Intergenic
1019207199 6:170371856-170371878 CTTCTCTGCTCCAAGCCTGAGGG - Intronic
1019314595 7:378743-378765 CTTCCCTGCTCTTGGCCTTGGGG - Intergenic
1019432829 7:1007351-1007373 CACCGCTGCCCCTGGGCTGGGGG + Intronic
1019667173 7:2257706-2257728 CTTGGCTGCTCCTTGGCTGGGGG - Intronic
1020090134 7:5334120-5334142 CTTTTCGGCTCCTGTGCTGGAGG - Intronic
1020129374 7:5550875-5550897 CTTCTCTGGGCCAGGGCTGAGGG - Intronic
1020244899 7:6422421-6422443 GTGCTGTGCTGCTGGGCTGGAGG + Intronic
1026099378 7:67372037-67372059 CCCCTCTGCACCTGGACTGGTGG - Intergenic
1026534357 7:71227933-71227955 TTTCTCTGCTTCTGTGCTGGTGG + Intronic
1026807929 7:73439334-73439356 GTTCTCTTCTCCAGAGCTGGAGG + Intergenic
1027949756 7:84799896-84799918 CTTCTCTGCCCCTTGACTGTAGG - Intergenic
1029367925 7:100128023-100128045 CGGCTCCGCTCCTGGGCTGCGGG - Exonic
1029646418 7:101859223-101859245 CCTCCCTGCACCTGAGCTGGGGG + Intronic
1029714770 7:102319909-102319931 CCTCTAGCCTCCTGGGCTGGGGG + Intronic
1032548054 7:132759757-132759779 CTTCTCTGCTCCTCACCAGGAGG + Intergenic
1033313859 7:140282096-140282118 CCACTCTGCTCCTGGGCTCCTGG + Intergenic
1034443745 7:151101304-151101326 GCTATCTCCTCCTGGGCTGGAGG + Intronic
1034459594 7:151191180-151191202 CTCCTCTCCTCCTGGGTTTGGGG + Intronic
1034968243 7:155404407-155404429 CCTCTCTGTTCCTGGGTTGGCGG - Intergenic
1036219090 8:6905955-6905977 CTTCTGTGCTCATGGGTGGGTGG - Intergenic
1037971561 8:23175291-23175313 TTTCTCTGCTCCTGGTTTTGGGG + Intergenic
1039502841 8:38030743-38030765 CTTGCCGGCTCCTGGGCGGGCGG + Intronic
1040385462 8:46912399-46912421 GTTCTCTGCTGATGGGCTCGCGG + Intergenic
1040902237 8:52428833-52428855 CTTCCCTGCCCCAGGGCTGGAGG + Intronic
1042455544 8:68998327-68998349 CTTCTCTGCTCCTAGGCTGAAGG + Intergenic
1044635410 8:94319329-94319351 CATCTCTGGACCTGCGCTGGAGG - Intergenic
1045209617 8:100083162-100083184 CTTGTCAGCTCATGAGCTGGTGG + Intronic
1045320308 8:101077317-101077339 TTTCTCTGACCCTGGGCTGGAGG + Intergenic
1047311544 8:123696644-123696666 CCTCACTGCTCCTGGGTGGGAGG + Intronic
1048294902 8:133206903-133206925 TTTCACTCCTCCTGGGCCGGTGG - Intronic
1049203636 8:141353368-141353390 CGACTCTGGTCCTGGGCTGGTGG - Intergenic
1049519458 8:143080637-143080659 CTTCTCTCCTGCCGGGCTGCAGG - Exonic
1049800720 8:144516344-144516366 CTCCACTGCTGCTGGGCTGGGGG + Exonic
1049804774 8:144533896-144533918 CTGCCTTGCTCCTGAGCTGGGGG + Intronic
1049806722 8:144544324-144544346 CTCCTCCACACCTGGGCTGGGGG + Intronic
1049883033 9:10974-10996 CCTCTCTGCGCCTGCGCCGGGGG - Intergenic
1050409984 9:5353763-5353785 CTTCTCTGCACTTGAGGTGGAGG - Intergenic
1050773067 9:9227730-9227752 CTTCACTGCCTGTGGGCTGGAGG - Intronic
1051376187 9:16405087-16405109 CTTCTCTACTCCTTGACTGGAGG + Intergenic
1051743255 9:20271396-20271418 ATCCTCTGCTGCTGGGCTAGTGG + Intergenic
1052723391 9:32200256-32200278 TTTCTCTATTCCTGGGCTGGAGG + Intergenic
1052978456 9:34429612-34429634 CTTCTCTGCTTGTGGGCTCTGGG + Intronic
1053368303 9:37539643-37539665 CTTCTCTGGTGCTGGTCTGCAGG - Intronic
1056261529 9:84853792-84853814 CTTCTCTGGTCTGGGGGTGGTGG + Intronic
1056678381 9:88696210-88696232 CTTCTCTGTAGCTGGGCTGGTGG + Intergenic
1056858641 9:90158843-90158865 CCTCCCTGCTCCTGGCCTGGAGG + Intergenic
1057187295 9:93063886-93063908 CTTCTCTGCTCATGGACAGTTGG + Intronic
1057583725 9:96310885-96310907 TTTCTCAGATCCTGGGGTGGAGG + Intergenic
1057718361 9:97513507-97513529 CTGTTCTGCTCCAGGGGTGGTGG + Intronic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1058246427 9:102631893-102631915 CTAGTCTGCTCCTGGGCCTGGGG + Intergenic
1058408567 9:104704347-104704369 CTCCTCTGCTCCAGGTCTGCTGG - Intergenic
1058924889 9:109653501-109653523 CTTCTTTGCTTCTGAGCGGGAGG + Intronic
1059723323 9:116982935-116982957 CCTCTGTGCTGCTGGGGTGGAGG - Intronic
1059915147 9:119091218-119091240 CTGCCCTCCTCCTTGGCTGGAGG - Intergenic
1060540725 9:124428536-124428558 AATCTCTGCTCCCAGGCTGGTGG + Intergenic
1060549021 9:124476536-124476558 TTTCTCTGTTCTTGGGCTGAAGG + Intronic
1060863629 9:126977121-126977143 CTTCTCTCATTGTGGGCTGGTGG + Intronic
1060977926 9:127776350-127776372 CCTCTGTGCACCTGGGGTGGGGG + Intronic
1061359693 9:130133128-130133150 CATCTCTTCTCCTGGGCTGTGGG + Intronic
1061588402 9:131583176-131583198 CTTCTCTCCTGCAGGGGTGGGGG + Intronic
1061761810 9:132856711-132856733 TTTCTCAGCTTCTGAGCTGGTGG - Intronic
1061910464 9:133719637-133719659 CCAATCTGCTCCTGGGGTGGGGG - Intronic
1062017227 9:134296957-134296979 CTTCCCTGTTCCAGGGCTCGGGG + Intergenic
1062232123 9:135487533-135487555 CCTCTCCGCTCCCGGGCTGGGGG - Exonic
1062239359 9:135527379-135527401 TTTCTCTGCTCCAGGGCTTAGGG + Intergenic
1062283681 9:135763487-135763509 ATTCTGTCCTCCAGGGCTGGCGG - Intronic
1187124807 X:16445180-16445202 CTTCTCAGCTCCTGGGGTGAGGG + Intergenic
1187377027 X:18764380-18764402 CTCCCCTGCTCCTGGGCCTGAGG + Intronic
1189351882 X:40281638-40281660 TTTCTTTCCTCATGGGCTGGTGG + Intergenic
1189754236 X:44254004-44254026 CTTCTCTGCTGCAGGTCTGCTGG - Intronic
1190452603 X:50596274-50596296 CTACTCTGCCCCAGGGCTTGTGG - Exonic
1191791237 X:64974810-64974832 CTTCTCTGGGCATGGGGTGGTGG + Intronic
1192182261 X:68923382-68923404 CTTCTCATCTCCTGGGCTTGTGG + Intergenic
1193075281 X:77348375-77348397 CCTCTCTGCTGCTGGTCTGCTGG - Intergenic
1194284553 X:91993798-91993820 CTTCCCTTCTCCTTGGCTGCAGG + Intronic
1196538176 X:116872408-116872430 GCTCTCTGCTTCTGGGATGGTGG + Intergenic
1197251207 X:124218003-124218025 CTTCTGTCTTCCGGGGCTGGGGG + Intronic
1200159020 X:153995136-153995158 CTTCTCTGCTCAGCTGCTGGTGG - Intergenic
1200162164 X:154015196-154015218 TTTCTCTGCTCTTGGGGTGAAGG - Intronic
1201576368 Y:15465699-15465721 CTTCTGAGCTCATGGGCTAGGGG + Intergenic