ID: 1095987865

View in Genome Browser
Species Human (GRCh38)
Location 12:48011534-48011556
Sequence CTGGCTAAGGATTCCAGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095987865_1095987871 4 Left 1095987865 12:48011534-48011556 CCGACTCTGGAATCCTTAGCCAG No data
Right 1095987871 12:48011561-48011583 ATATGAGCTTCTTTCTCATGGGG No data
1095987865_1095987870 3 Left 1095987865 12:48011534-48011556 CCGACTCTGGAATCCTTAGCCAG No data
Right 1095987870 12:48011560-48011582 TATATGAGCTTCTTTCTCATGGG No data
1095987865_1095987869 2 Left 1095987865 12:48011534-48011556 CCGACTCTGGAATCCTTAGCCAG No data
Right 1095987869 12:48011559-48011581 GTATATGAGCTTCTTTCTCATGG No data
1095987865_1095987873 10 Left 1095987865 12:48011534-48011556 CCGACTCTGGAATCCTTAGCCAG No data
Right 1095987873 12:48011567-48011589 GCTTCTTTCTCATGGGGGATAGG No data
1095987865_1095987874 13 Left 1095987865 12:48011534-48011556 CCGACTCTGGAATCCTTAGCCAG No data
Right 1095987874 12:48011570-48011592 TCTTTCTCATGGGGGATAGGAGG No data
1095987865_1095987872 5 Left 1095987865 12:48011534-48011556 CCGACTCTGGAATCCTTAGCCAG No data
Right 1095987872 12:48011562-48011584 TATGAGCTTCTTTCTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095987865 Original CRISPR CTGGCTAAGGATTCCAGAGT CGG (reversed) Intergenic
No off target data available for this crispr