ID: 1095988613

View in Genome Browser
Species Human (GRCh38)
Location 12:48017643-48017665
Sequence GTACAGCCCAGACAATAGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095988613_1095988614 16 Left 1095988613 12:48017643-48017665 CCGCACTATTGTCTGGGCTGTAC 0: 1
1: 0
2: 0
3: 7
4: 106
Right 1095988614 12:48017682-48017704 AATGTTCTCTCATTCTTCAGTGG 0: 1
1: 0
2: 3
3: 30
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095988613 Original CRISPR GTACAGCCCAGACAATAGTG CGG (reversed) Intergenic
901514680 1:9737039-9737061 CTCCAGCCCAGACAACAGAGCGG + Intronic
903086060 1:20860269-20860291 GAACAGCCCAAAGAATAGAGTGG - Intronic
905803392 1:40860127-40860149 GTACAGCCAGGACAATAGACCGG - Intergenic
906803499 1:48757926-48757948 ATAGAGCCCAGTCAATATTGAGG - Intronic
907301704 1:53490883-53490905 GAACAGCCCATGCAAAAGTGTGG - Intergenic
909487446 1:76189420-76189442 GTTCAGCCCAGACCAATGTGGGG - Intronic
912000784 1:104832312-104832334 GTACAGCCTACAGAATGGTGAGG - Intergenic
914987170 1:152471094-152471116 GCACAGCCCAGACACTTGTGAGG + Intergenic
915505978 1:156356877-156356899 GCACAGCCCAGCCAAGAGAGTGG + Intronic
919736777 1:200957571-200957593 GTACAGCACAGACAGGAGTTGGG + Intergenic
920390789 1:205599424-205599446 GTCCAGCGCAGACAATCGTATGG - Intronic
923295705 1:232593009-232593031 GTTCAGCCCAGATAAAAATGTGG - Intergenic
923671791 1:236047633-236047655 GTAAAGCCCAGACTCTAGTTGGG - Intronic
1064227160 10:13497172-13497194 GAACAGCTCTGACAATAGGGAGG - Intronic
1064619161 10:17197034-17197056 GCACTGCCCACACTATAGTGTGG - Intronic
1066302212 10:34107228-34107250 GGACAGCCCTGTCAATTGTGGGG + Intergenic
1067466520 10:46503169-46503191 GTACAGCACATACAAAGGTGTGG - Intergenic
1067620668 10:47881436-47881458 GTACAGCACATACAAAGGTGTGG + Intergenic
1067792616 10:49299455-49299477 GTACAGCCCAGACACTTGTCTGG + Intronic
1070036974 10:72735469-72735491 ATAGAGCCCAGATAATACTGTGG - Intronic
1071203221 10:83244449-83244471 ATACAGCCAAGACAATAGTAAGG + Intergenic
1079177507 11:18156600-18156622 CTAGAACTCAGACAATAGTGTGG + Intronic
1090517802 11:127447345-127447367 GTATAGCACAGACATTTGTGGGG - Intergenic
1095362126 12:41354986-41355008 GCAAAGCACAGAGAATAGTGGGG + Intronic
1095988613 12:48017643-48017665 GTACAGCCCAGACAATAGTGCGG - Intergenic
1097483105 12:60157010-60157032 GTGGAGCCCAGACAATATTCTGG + Intergenic
1098188521 12:67923804-67923826 CTACAGCACAGAGAAAAGTGTGG - Intergenic
1100657555 12:96662717-96662739 GAACAGCTCACACAACAGTGCGG - Intronic
1101487809 12:105183584-105183606 CTACAACCCAGAAAAGAGTGGGG - Intronic
1105244126 13:18632667-18632689 CTACAGGCCAGAAAAGAGTGGGG + Intergenic
1105531813 13:21227598-21227620 GTACAGCCCACACTAAAGGGTGG + Intergenic
1106319028 13:28621176-28621198 GTGCAGCCCACACAGTACTGAGG - Intergenic
1108237030 13:48418195-48418217 CTACAGGCCAGAAAAGAGTGGGG + Intronic
1112645617 13:101328346-101328368 CTACAGCCCAGGCTAGAGTGCGG + Intronic
1113562727 13:111295993-111296015 GTCCAGCCCAGGCACCAGTGTGG - Intronic
1113734364 13:112667131-112667153 GGAAAGCCCAGACCACAGTGAGG + Intronic
1116075404 14:40104389-40104411 GTATAGCCAAGACAATCGTAAGG + Intergenic
1118166660 14:63343081-63343103 GTACAACGCAGCCAATAGTTGGG + Intergenic
1120246159 14:82009605-82009627 GTACAGACCACACAGTATTGCGG - Intergenic
1121946682 14:98129861-98129883 ATACATCCCAGACAATGGTCAGG - Intergenic
1122089826 14:99330821-99330843 GCACAGCCGGGGCAATAGTGGGG - Intergenic
1138183717 16:54960906-54960928 GTGCAGCCCAGACCAGAGTTTGG + Intergenic
1139309012 16:66012596-66012618 ATACAGCCCAGCCAAGAGTGGGG + Intergenic
1139589303 16:67924605-67924627 GTCCAGCCAAGACAAAAGAGGGG - Intronic
1141000127 16:80299982-80300004 GGACAGCCTAGGCAATGGTGTGG + Intergenic
1143178989 17:4972763-4972785 CTCCAGCCCAGACACTGGTGAGG - Exonic
1144738406 17:17567666-17567688 GCACAGCCCAGACAGGAGCGGGG + Intronic
1146554094 17:33808484-33808506 GAACAGCCAACACAATATTGAGG - Intronic
1147506854 17:41026780-41026802 GTGCCGCCCAGACAGTCGTGTGG - Exonic
1150700168 17:67440081-67440103 GCAAAGCCTAGAGAATAGTGAGG + Intronic
1154444816 18:14427234-14427256 CTACAGGCCAGAAAAGAGTGGGG - Intergenic
1155345073 18:24849698-24849720 GTACAGCCAAAACAATAGCAGGG + Intergenic
1161339993 19:3736165-3736187 GTACAGCCCCGACACGCGTGTGG + Exonic
1161353898 19:3808746-3808768 GTCCAGCCCAGGCAGGAGTGCGG - Intronic
1165332756 19:35150548-35150570 ATAAAGCCCAGACACTGGTGAGG + Intronic
928757389 2:34544009-34544031 ATACAACCCAGAAAAGAGTGGGG - Intergenic
928907036 2:36379483-36379505 TTTCAGCCCTGACAACAGTGCGG + Intronic
932969677 2:76525394-76525416 GGATAGCACAGACAACAGTGTGG - Intergenic
933731704 2:85461214-85461236 CTCCAGCCTGGACAATAGTGAGG + Intergenic
935728597 2:106045956-106045978 GTTCTGGCCAGACGATAGTGTGG + Intergenic
939116715 2:138069663-138069685 CTACAAGCCAGAAAATAGTGGGG - Intergenic
942067468 2:172285193-172285215 GTACAGCACAGACAATAGGCTGG + Intergenic
943105587 2:183543167-183543189 GTGCAGCCCATACGATAATGAGG - Intergenic
943148387 2:184076161-184076183 GTATAGCACAGATAATATTGTGG - Intergenic
1169245647 20:4022448-4022470 GAACAGAGTAGACAATAGTGGGG + Intergenic
1173174271 20:40752489-40752511 GGACAGCCAAGAAGATAGTGTGG + Intergenic
1182067487 22:27441101-27441123 GTACTGCCCAGAAAAGAATGCGG - Intergenic
1184087849 22:42276087-42276109 GTGGAGCCCAGACAATGATGTGG - Intronic
1185045844 22:48528383-48528405 GTATAGCCAAGGCCATAGTGAGG + Intronic
956155760 3:66295253-66295275 CTCCAGCCCAGCCAAAAGTGCGG - Intronic
962741968 3:138368528-138368550 ATTCAGCACAGAAAATAGTGGGG + Intronic
966080771 3:175997281-175997303 GTACAAGCCAGAAAATATTGGGG + Intergenic
966443909 3:179978993-179979015 ATATAGCCCAGAGTATAGTGAGG - Intronic
969560239 4:7942117-7942139 GTACATCCCAGAACACAGTGGGG - Intergenic
970917641 4:21353962-21353984 CTACAACCCAGAAGATAGTGGGG + Intronic
971173969 4:24262858-24262880 GTACAGCCCTGAGGACAGTGTGG - Intergenic
975484947 4:74925657-74925679 TTACAGCCCTGACAATATTTCGG - Intergenic
977882408 4:102220193-102220215 GAACATCCCAGAGAGTAGTGTGG + Intergenic
980813682 4:137915926-137915948 CTACAAGCCAGACAAGAGTGGGG + Intergenic
982995235 4:162335936-162335958 CTACAGCCTAGACAAGAATGTGG - Intergenic
983135689 4:164077062-164077084 GTATAGCCCAGACAATCCTAAGG + Intronic
990576211 5:57125865-57125887 GTACAGGAGAGACAATAGGGAGG - Intergenic
991008090 5:61851329-61851351 GAACAGCCAACACAATATTGAGG + Intergenic
991243277 5:64483316-64483338 CTACAAGCCAGACAAGAGTGGGG - Intergenic
991665216 5:68993055-68993077 GAACACCCCAAACAATAGTCTGG - Intergenic
998459774 5:142301358-142301380 TTACAGCCCAGTCAAAACTGTGG + Intergenic
998565743 5:143214543-143214565 CCACTGCCCAGACAAAAGTGAGG - Intronic
999250525 5:150179773-150179795 GGAGAGCCCAGACCATGGTGAGG - Intronic
1001675383 5:173507871-173507893 GTAAATCCGAGAGAATAGTGGGG - Intergenic
1003390841 6:5711393-5711415 GTACAGCCCACACTAAAGCGTGG - Intronic
1004691498 6:17996169-17996191 GAACAGCAGGGACAATAGTGAGG + Intergenic
1009363490 6:62840487-62840509 GTACACCCCCTACAATATTGAGG - Intergenic
1011074359 6:83422220-83422242 GTACCGCCCAGTGGATAGTGTGG - Intronic
1011757790 6:90522333-90522355 GTATATGCCAGTCAATAGTGTGG - Intronic
1014128909 6:117809323-117809345 CTGCAACCCAGAAAATAGTGGGG - Intergenic
1014411486 6:121128056-121128078 GTACTTGCCAGAAAATAGTGTGG - Intronic
1014881390 6:126728057-126728079 CTACAAGCCAGAAAATAGTGGGG + Intergenic
1021813011 7:24422321-24422343 GCAGAGCCCAGACAATAGCAGGG - Intergenic
1025640680 7:63364996-63365018 GTATTGCCCAGACAAAAGTCAGG - Intergenic
1025642019 7:63383090-63383112 GTATTGCCCAGACAAAAGTCAGG + Intergenic
1030427095 7:109392017-109392039 GCAAAGCCCAGACAATAGGGAGG - Intergenic
1030501303 7:110363576-110363598 GTTCAGCCCAGACAGTGGGGTGG + Intergenic
1030736636 7:113056382-113056404 GGATGGCCTAGACAATAGTGGGG - Intergenic
1031689258 7:124766576-124766598 GTACCACCCAGAGCATAGTGAGG + Intergenic
1032810834 7:135415125-135415147 GTCAAGCCCAGACCATAGGGAGG + Intronic
1034991830 7:155552542-155552564 GTCCAGCCCAGACCTGAGTGGGG - Intergenic
1036959763 8:13231082-13231104 ATACAGCACAGACAAAAGTGGGG + Intronic
1037659437 8:20914148-20914170 GTATAGCCCAGACAGCTGTGAGG + Intergenic
1041771944 8:61481374-61481396 GTGCAGCCCACAGAATAGAGTGG + Intronic
1044276489 8:90306174-90306196 ATAGAGCCCAGACAAGGGTGAGG + Intergenic
1188202118 X:27304201-27304223 GTACAGCCAAGACAATCCTAAGG + Intergenic
1192144901 X:68675545-68675567 GACTAGCCCAGACAGTAGTGGGG + Intronic
1198519190 X:137435111-137435133 CTACAGCCCAGAAGAGAGTGGGG + Intergenic
1201464099 Y:14260855-14260877 GAACAGCTCAGACAGGAGTGGGG + Intergenic