ID: 1095991534

View in Genome Browser
Species Human (GRCh38)
Location 12:48037835-48037857
Sequence TCCCCAGGTCATCCCCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095991533_1095991534 -9 Left 1095991533 12:48037821-48037843 CCTACAAGTATAGGTCCCCAGGT No data
Right 1095991534 12:48037835-48037857 TCCCCAGGTCATCCCCAGAGAGG No data
1095991531_1095991534 -2 Left 1095991531 12:48037814-48037836 CCAAATTCCTACAAGTATAGGTC No data
Right 1095991534 12:48037835-48037857 TCCCCAGGTCATCCCCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095991534 Original CRISPR TCCCCAGGTCATCCCCAGAG AGG Intergenic
No off target data available for this crispr