ID: 1095992216

View in Genome Browser
Species Human (GRCh38)
Location 12:48043097-48043119
Sequence CTGTATTTGGACCAGGTCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095992209_1095992216 24 Left 1095992209 12:48043050-48043072 CCTGCTCTTGTTGGCTAGCTCAG 0: 1
1: 0
2: 1
3: 17
4: 106
Right 1095992216 12:48043097-48043119 CTGTATTTGGACCAGGTCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 153
1095992212_1095992216 -10 Left 1095992212 12:48043084-48043106 CCACTGTGTAAGTCTGTATTTGG 0: 1
1: 0
2: 0
3: 15
4: 225
Right 1095992216 12:48043097-48043119 CTGTATTTGGACCAGGTCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095992216 Original CRISPR CTGTATTTGGACCAGGTCCA GGG Exonic
901540353 1:9911103-9911125 CTGTATTTGGAGAGGGTACAGGG + Intergenic
902414612 1:16231484-16231506 CTTTCTGTGGACCAGGCCCAGGG - Intergenic
902680298 1:18039020-18039042 CTGAATATGAACCAGGTCCTGGG - Intergenic
905091833 1:35436280-35436302 CTGTACATGGACAAGGTCCTTGG - Intronic
906812672 1:48845059-48845081 TTGTATTAGGACCAGTCCCAAGG + Intronic
907457353 1:54584226-54584248 CTGTATTAGGAACAGTTCCCTGG + Intronic
907855326 1:58297867-58297889 CTGCATTTGGACAAGGTGCTTGG + Intronic
908256034 1:62304480-62304502 CTGGATTGGAAGCAGGTCCAGGG - Intronic
908878103 1:68700605-68700627 CTGGATTTGGATCAGCTCCCAGG - Intergenic
910527451 1:88197324-88197346 CTGTATTTTGAGCTAGTCCAGGG - Intergenic
911492273 1:98585140-98585162 CTGCATTTGTACCAGTACCATGG - Intergenic
913236801 1:116792159-116792181 GTGTCTCAGGACCAGGTCCAAGG + Intergenic
915457213 1:156048744-156048766 CTGTATCAGGATCAGGACCAGGG + Intronic
915986014 1:160465478-160465500 TTGTATTTTTAGCAGGTCCAGGG - Intergenic
917251384 1:173065623-173065645 CTGTTTTTGTACCAGTACCATGG - Intergenic
917540667 1:175910693-175910715 CTCTATTTGGAAAAGGGCCAAGG + Intergenic
921068600 1:211640479-211640501 CTGTATTGGGACAAGGGCTAGGG + Intergenic
1066331897 10:34432598-34432620 CTATATATGGCCCAGATCCATGG + Intronic
1067170515 10:43902393-43902415 CTCTATGTGACCCAGGTCCATGG - Intergenic
1068192526 10:53669777-53669799 CTGTATTTGTACCAGTACCATGG - Intergenic
1068801436 10:61145074-61145096 CTGTATCTGGACCCTGTTCAGGG + Intergenic
1069694394 10:70376169-70376191 CTGTATTTTCACCTGGTCCAAGG + Intronic
1069907833 10:71742217-71742239 CTGTATTGGGGCCTGGCCCAGGG + Intronic
1070306882 10:75245023-75245045 CTCTATTTGCCCCAGGGCCAGGG + Intergenic
1070494098 10:77005604-77005626 TTGTTATTGGACCAGGGCCATGG + Intronic
1073008493 10:100342249-100342271 ATGTCTTAGGACCAGGACCAGGG - Intergenic
1073262750 10:102202952-102202974 CTGCATTTGGGCCTGGTCCCTGG + Intergenic
1074189923 10:111126866-111126888 CTGCATTTTGACAAGGTCCCAGG + Intergenic
1077493835 11:2875322-2875344 CTGGATTTGTCCCAGGTGCATGG + Intergenic
1078299330 11:10110032-10110054 CTGAATTTGGATCATCTCCATGG + Intronic
1078338313 11:10481391-10481413 CTGTTTTTGTACCAGGCCCATGG - Intronic
1081429813 11:42964327-42964349 CTGTTTTTGTACCAGTACCATGG - Intergenic
1083641744 11:64149400-64149422 CTCCATTTGCACCAGGGCCAGGG - Intronic
1084303932 11:68269491-68269513 CTGTGTTGGGAGCAGGCCCATGG - Intronic
1086283471 11:85218145-85218167 CTGTTTTTGTACCAGTACCAAGG + Intronic
1086525176 11:87716154-87716176 GTGTTTATGGACAAGGTCCATGG + Intergenic
1087376586 11:97350349-97350371 CTGTTTTTGTACCAGAACCATGG + Intergenic
1089335826 11:117723357-117723379 GAGTATTTGGAACAGGTCAAGGG - Intronic
1091179557 11:133591407-133591429 CTGTATGTGGTCAGGGTCCAGGG - Intergenic
1092331794 12:7592023-7592045 CTGCATTTGGGCCTGATCCATGG - Intergenic
1092727195 12:11497951-11497973 CTGTCTTTGTACCAGCTCCCTGG + Intronic
1095992216 12:48043097-48043119 CTGTATTTGGACCAGGTCCAGGG + Exonic
1096801021 12:54110534-54110556 CTGTATTTTAACCAGGTCCCAGG - Intergenic
1100757018 12:97762607-97762629 CAGACTTTGGACCAGGTCCTGGG + Intergenic
1102502003 12:113359176-113359198 CTGCATCTGGATCAGGTCCATGG + Intronic
1103913827 12:124365865-124365887 CTGTGTTTGGACCTGGGTCAGGG - Intronic
1104466398 12:128994221-128994243 CTGTCTCAGGACCAGGTTCAGGG - Intergenic
1107068664 13:36245226-36245248 CTGTATTTAGTACAGGACCAGGG + Intronic
1124211248 15:27766821-27766843 CTCTATTTGGCCCAGAACCAAGG - Intronic
1124222646 15:27863473-27863495 CTGCATTTGGACAAGGTGCCGGG - Intronic
1125506439 15:40270367-40270389 CTGCATTTGAACAAGGTCCCTGG - Intronic
1133929938 16:10223924-10223946 CTGCATTTGTACAAGGTCCCAGG + Intergenic
1136677926 16:31930755-31930777 CTATTTTTGGACCAGTACCATGG - Intergenic
1137298210 16:47118326-47118348 CTGTGTGTGGAACAGATCCAGGG - Intronic
1137521791 16:49201219-49201241 CTGTCTTAGGGCCAGGCCCAGGG - Intergenic
1137770077 16:51009085-51009107 TTTTATTTGGTCTAGGTCCAGGG - Intergenic
1141252079 16:82368276-82368298 CTGTATGTGGTCAATGTCCAGGG - Intergenic
1148436014 17:47685904-47685926 TTGTATTGGGACCAGGTATACGG + Intergenic
1148436077 17:47686639-47686661 TTGTATTGGGACCAGGTATACGG - Intergenic
1148762675 17:50015277-50015299 CTGTATTTTGTCCAGGCCCTAGG - Intergenic
1154371830 18:13770512-13770534 CTGTTTTTGTACCAGCACCATGG - Intergenic
1154395613 18:13985555-13985577 CTGTTTTTGTACCAGTACCATGG - Intergenic
1155613373 18:27694366-27694388 CTGTTTTTGTACCAGTACCATGG + Intergenic
1159033479 18:63254975-63254997 CTGTACTTGGATCTGGTCCTTGG + Intronic
1161146082 19:2678990-2679012 CTGAATTTGGTCCACGCCCATGG + Intronic
1162473884 19:10888347-10888369 CTGTCTTTGGACCAGCTTCTGGG + Intronic
1163751417 19:19080443-19080465 CTTCATTTGGACCAGGCTCAGGG + Intronic
1166757954 19:45205450-45205472 GTGTATTTTGGCCAGGTGCAGGG - Intronic
1168260592 19:55191827-55191849 CTGTCTTTGGACCAGGCTCCTGG - Intronic
925985825 2:9213887-9213909 TTGTGTTGGGACCAGTTCCAGGG + Intronic
926765369 2:16319045-16319067 CTGTGCTTGGAGCAGCTCCATGG - Intergenic
927462480 2:23310988-23311010 CTTTATTTAGACCACGTGCATGG - Intergenic
930024474 2:47021775-47021797 CTGTTTCGGGAACAGGTCCAGGG + Intronic
930334911 2:50033254-50033276 CTGTTTTTGTACCAGTACCATGG - Intronic
931096518 2:58946637-58946659 CTGTATTTGGACAACCTCCATGG + Intergenic
932522556 2:72428421-72428443 CTGCAACTGGACCAGGTGCAAGG - Intronic
932746021 2:74334120-74334142 CTGTTTCTGAACCATGTCCAGGG + Exonic
936560396 2:113533422-113533444 CTGTATTGGGACCATTTGCAGGG + Intergenic
938032206 2:128004645-128004667 GAGCATTTGGACCAGTTCCAAGG + Intronic
940195033 2:151084538-151084560 CTGAATGTGTACCAGGTGCAAGG + Intergenic
940842299 2:158598213-158598235 CTGAATTAGGACAAGATCCAAGG - Intronic
941621766 2:167787067-167787089 CTGTATTTTGACCAGCTAGAAGG + Intergenic
944373691 2:199014676-199014698 CTGTATTTGGTCCATGTGGATGG - Intergenic
945698675 2:213142358-213142380 CTGTATATTGCACAGGTCCAGGG - Intronic
1171795635 20:29564136-29564158 CTGTATTTTAACCAGGTCCCAGG + Intergenic
1172525534 20:35598963-35598985 CTGTACTTGGGCCAACTCCAGGG - Intergenic
1172988051 20:39008974-39008996 CTGTTTCTGGTCCAGGTCCCAGG + Intronic
1174719106 20:52792248-52792270 CTGTATGAGTGCCAGGTCCAAGG - Intergenic
1175691932 20:61071780-61071802 CTGTCTGGGGAACAGGTCCATGG - Intergenic
1180008821 21:45035989-45036011 CTGAATTTTGAAGAGGTCCATGG + Intergenic
1182116141 22:27757617-27757639 CTTTATTTGGACCTGGTGCGGGG + Intronic
1184432238 22:44448282-44448304 CTGGCTTTGGACCAGGCACAGGG + Intergenic
1185156965 22:49198866-49198888 CTGACCTTGGACCAGGGCCAGGG + Intergenic
950041709 3:9923967-9923989 CTGTACTGGAATCAGGTCCAGGG + Exonic
953257367 3:41304882-41304904 CTGCATTTGGCCCAGCTGCAGGG + Intronic
953731507 3:45453634-45453656 CTGAATTTGGACTGAGTCCAGGG - Intronic
954345314 3:49992283-49992305 CTTTATTTGCACCAGGGCTAAGG + Intronic
955655208 3:61238402-61238424 CTGCATAAGGACCAGGTGCAGGG + Intronic
957325884 3:78693882-78693904 CTGTATTTTAACCAGCTCCCAGG - Intronic
957669430 3:83281285-83281307 GTTTTTTTGGGCCAGGTCCAGGG - Intergenic
959154809 3:102653817-102653839 CTGTATTTTGATCATGCCCAGGG + Intergenic
959340831 3:105128371-105128393 CTGTTTTTGTACCAGGACAATGG + Intergenic
962971342 3:140404554-140404576 CTGTATATGGACCACGGCCCTGG - Exonic
963518307 3:146335340-146335362 CTGCATTTGGGCCTGGTCCCTGG - Intergenic
964982673 3:162704978-162705000 CTGTCCTAGGACCAGGTACAAGG - Intergenic
968977400 4:3829143-3829165 CTGCATTTGAACCAGGTCCAGGG + Intergenic
976404526 4:84647994-84648016 CTGTCTTTGAACAAAGTCCACGG + Intronic
979405746 4:120308957-120308979 CTGACTTTGGACCAGGCACAAGG - Intergenic
979725895 4:123960285-123960307 CTGTTTTTGTACCAGTACCATGG - Intergenic
982504968 4:156205756-156205778 GTGGATCTGGGCCAGGTCCAGGG - Intergenic
983383833 4:167031886-167031908 TTGTATCTGGACCACGTACAGGG + Intronic
984569038 4:181368080-181368102 CTGTAATTGTACTAGGTGCATGG - Intergenic
986031829 5:3901945-3901967 CTGTATTTTGACCAACTCCCTGG + Intergenic
988185035 5:27849085-27849107 CTGTATTTGTACCCGTACCATGG + Intergenic
994490031 5:100429856-100429878 CTGTACTTGGAGCAGCTCTATGG - Intergenic
997064837 5:130548228-130548250 CTGCATTTGGGCCTGGTCCCTGG + Intergenic
997852506 5:137345499-137345521 CTGTATTTTGACCAAGCCCTAGG - Intronic
999396862 5:151235078-151235100 CTGTCCTTGGACCCTGTCCAGGG - Intronic
1000742986 5:164993817-164993839 CTGTATTGGGACTAGGTTGAAGG + Intergenic
1004403672 6:15311877-15311899 CCACATTTGGACCAGGTCCCTGG + Intronic
1004527383 6:16421983-16422005 CTATCTTTGCACCAGGTCCTGGG - Intronic
1005843315 6:29758772-29758794 CTGTATTTGAGGCAGGACCATGG - Intergenic
1006068331 6:31478449-31478471 CTGTATTTGAGGCAGGACCATGG + Intergenic
1007973685 6:46078463-46078485 CTGAGTTTGGAGCAGCTCCACGG - Intronic
1008722220 6:54369583-54369605 CTGTATTAGGACTAGGAGCATGG + Intronic
1009683873 6:66931020-66931042 TTGAATTTGAACCAGGTACATGG + Intergenic
1013695630 6:112699585-112699607 CACTATTTGGTCCAGGTCCCAGG + Intergenic
1017173612 6:151480946-151480968 CTGTATTTGAACAAGGTCAAGGG + Intergenic
1018316392 6:162561087-162561109 CTGTAGTTGGACACGCTCCATGG - Intronic
1022370773 7:29769292-29769314 CTGTTTTTGTACCAGGATCATGG - Intergenic
1026801623 7:73403873-73403895 CTGCATTCGGGCCAGCTCCATGG + Intergenic
1027863872 7:83621620-83621642 CTGTTTTTGTACCAGTACCATGG - Intronic
1031851321 7:126867808-126867830 CAGTGTTTGAACCAGGGCCAAGG + Intronic
1039658026 8:39431634-39431656 CTGTTTTTGTACCAGTACCATGG + Intergenic
1044439888 8:92210592-92210614 CTGTATTTGGTCCAGGTCATAGG + Intergenic
1044854682 8:96462994-96463016 GTGTATTTTGTCCAGGCCCAGGG - Intergenic
1047134819 8:122065112-122065134 CTGAATATGTGCCAGGTCCAGGG + Intergenic
1049400037 8:142421319-142421341 CAGGATTTAGACCAGATCCAAGG + Intergenic
1049455127 8:142682774-142682796 CTGTGTCTGGACCAGGGCCCTGG + Intergenic
1049495399 8:142928690-142928712 CTGCATGAAGACCAGGTCCAGGG - Intergenic
1050127438 9:2373392-2373414 CTGTTTTTGTACCAGTACCATGG - Intergenic
1050425290 9:5506791-5506813 CTGTTTTTGTACCAGAACCATGG - Intergenic
1050774619 9:9244414-9244436 CTGTATTGGTACCAGTACCATGG - Intronic
1050790279 9:9459972-9459994 CTATTTTTGTACCAGTTCCATGG - Intronic
1051190438 9:14505730-14505752 CTGTAGGTGGTCCAGCTCCATGG - Intergenic
1053790590 9:41683605-41683627 CTGCATTTTAACCAGGTCCCAGG - Intergenic
1054154571 9:61631196-61631218 CTGTATTTTAACCAGGTCCCAGG + Intergenic
1054178935 9:61895304-61895326 CTGCATTTTAACCAGGTCCCAGG - Intergenic
1054474345 9:65562272-65562294 CTGCATTTTAACCAGGTCCCAGG + Intergenic
1054535906 9:66235091-66235113 TTCCATTTGGACCAGGGCCAGGG + Intergenic
1054658602 9:67685527-67685549 CTGCATTTTAACCAGGTCCCAGG + Intergenic
1054694711 9:68348550-68348572 CTGTATTGGGACCATTTGCAGGG + Intronic
1057485323 9:95478366-95478388 CTGTTTTAGGACAAGGGCCATGG + Intronic
1059244689 9:112839750-112839772 CTGTCTTTGGGACAGGTCTAGGG + Intronic
1060720884 9:125976600-125976622 CTCTGTTTGGGCCATGTCCAGGG + Intergenic
1189379200 X:40489787-40489809 CCCTATTTTGACCAGGACCAAGG + Intergenic
1192035387 X:67557394-67557416 CTGTATGTAGAGCAGGTGCATGG + Intronic
1192942784 X:75930562-75930584 ATGTAGCTGGACCAGGTTCAAGG + Intergenic
1193398513 X:81014129-81014151 CAGTATCTGGGCCAGGTGCATGG - Intergenic
1193866051 X:86731347-86731369 CTCTAGTTTGAGCAGGTCCAAGG + Intronic
1194030754 X:88810516-88810538 CTGTATTTGTACCAGTAACATGG + Intergenic
1194237782 X:91406115-91406137 CTGTTTTTGTACCAGTACCATGG - Intergenic
1200691953 Y:6314763-6314785 CTCCACTTGGACCAGGGCCAGGG + Intergenic
1201043319 Y:9859960-9859982 CTCCACTTGGACCAGGGCCAGGG - Intergenic
1201459027 Y:14201890-14201912 CTGTACTGGGACCAGGTTCGAGG - Intergenic