ID: 1095997976

View in Genome Browser
Species Human (GRCh38)
Location 12:48105712-48105734
Sequence CCCCAAGTACGGCTGGGCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1095997968_1095997976 -1 Left 1095997968 12:48105690-48105712 CCCGGAATCGCAACCGGCCTTTC 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1095997976 12:48105712-48105734 CCCCAAGTACGGCTGGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1095997959_1095997976 30 Left 1095997959 12:48105659-48105681 CCCAGAGAAGACCCAGCTCTGGC 0: 1
1: 1
2: 3
3: 24
4: 239
Right 1095997976 12:48105712-48105734 CCCCAAGTACGGCTGGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1095997964_1095997976 18 Left 1095997964 12:48105671-48105693 CCAGCTCTGGCGGGAAAGCCCCG 0: 1
1: 0
2: 0
3: 10
4: 85
Right 1095997976 12:48105712-48105734 CCCCAAGTACGGCTGGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1095997960_1095997976 29 Left 1095997960 12:48105660-48105682 CCAGAGAAGACCCAGCTCTGGCG 0: 1
1: 0
2: 0
3: 13
4: 146
Right 1095997976 12:48105712-48105734 CCCCAAGTACGGCTGGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1095997967_1095997976 0 Left 1095997967 12:48105689-48105711 CCCCGGAATCGCAACCGGCCTTT 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1095997976 12:48105712-48105734 CCCCAAGTACGGCTGGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1095997963_1095997976 19 Left 1095997963 12:48105670-48105692 CCCAGCTCTGGCGGGAAAGCCCC 0: 1
1: 0
2: 2
3: 7
4: 138
Right 1095997976 12:48105712-48105734 CCCCAAGTACGGCTGGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1095997969_1095997976 -2 Left 1095997969 12:48105691-48105713 CCGGAATCGCAACCGGCCTTTCC 0: 1
1: 0
2: 0
3: 0
4: 40
Right 1095997976 12:48105712-48105734 CCCCAAGTACGGCTGGGCGCTGG 0: 1
1: 0
2: 0
3: 4
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1095997976 Original CRISPR CCCCAAGTACGGCTGGGCGC TGG Exonic
900405286 1:2490262-2490284 CACCAAGTCTGGCTGGACGCTGG + Intronic
900436502 1:2633620-2633642 CCGCAAGCAGGGCTGGGTGCAGG - Intergenic
900524960 1:3124091-3124113 CCCCAAGAACTGCTGGGACCCGG + Intronic
900652528 1:3736939-3736961 CACCAAGGAGGGCTGGGCGGTGG + Intergenic
901927348 1:12574729-12574751 CCTCAAGCACGTCTGTGCGCAGG + Intronic
903419261 1:23206714-23206736 CCCCAAGCCCGGCTTGGCTCAGG + Intergenic
903475006 1:23613451-23613473 CCCCATGTCCAGCTGGGCCCAGG - Intronic
920111866 1:203592584-203592606 CCCTAAGTAAGGCTGGGGGATGG + Intergenic
1071068952 10:81669598-81669620 CCCCAAGTATGGCTGAGTTCAGG - Intergenic
1072199338 10:93144599-93144621 CCCCTCGTATGGCTGGGCCCAGG - Intergenic
1074377898 10:112953261-112953283 TCCCAAGCATGTCTGGGCGCCGG - Intronic
1074562635 10:114547633-114547655 CAGCAAGTAAGGCTGGGCGCGGG - Exonic
1076499419 10:130924551-130924573 CCCCACGGAGGGCTGGGTGCTGG - Intergenic
1077886350 11:6390634-6390656 CCCCAGGTCCGGCCGGGAGCAGG + Exonic
1081651037 11:44824370-44824392 CCCCAACTGGGGCTGGGGGCAGG + Intronic
1085703412 11:78764844-78764866 CCCCAACTCAGGCTGGGGGCTGG + Intronic
1088883131 11:113987159-113987181 CCCCAAGTAAGGCAGGGCATGGG - Intronic
1094842605 12:34348374-34348396 CCCCCAGAGCGGCTGGGCCCCGG - Intergenic
1095997976 12:48105712-48105734 CCCCAAGTACGGCTGGGCGCTGG + Exonic
1097266992 12:57751854-57751876 CCCCAAGGAAGACTGGGAGCGGG - Intronic
1099941353 12:89192956-89192978 CCCCAAGTACAGCTAAGGGCAGG + Intergenic
1102046572 12:109833349-109833371 CCTCCGGGACGGCTGGGCGCCGG + Intronic
1106432255 13:29692447-29692469 CCCCATGTACCACTGGGCTCTGG + Intergenic
1110602144 13:77387307-77387329 CCCCAAGGATGACTGGTCGCAGG - Intergenic
1118137666 14:63046219-63046241 CCCCCAGGACCGCTGAGCGCAGG + Intronic
1118708703 14:68502488-68502510 CCCCAAGCACTGCTGGGAGAGGG + Intronic
1122209224 14:100164220-100164242 AGACAAGGACGGCTGGGCGCGGG - Intergenic
1122640311 14:103155726-103155748 CCCCAAGACAGGCTGGGCTCAGG + Intergenic
1122801193 14:104230472-104230494 CCCCAAGTCCGGCTGGTGACAGG + Intergenic
1132419517 15:101652977-101652999 CCCCAGGCAGGGCTGGGCTCTGG - Intergenic
1139523225 16:67497271-67497293 CTGCAAGTACGGCTGTGGGCCGG - Intergenic
1142649111 17:1335205-1335227 CGCCAAGAACGGCTGGGCACAGG + Intergenic
1144785219 17:17827645-17827667 CCCCAGGTGCACCTGGGCGCAGG + Intronic
1151610427 17:75170280-75170302 ACCCAAATTAGGCTGGGCGCCGG + Intergenic
1152407705 17:80107214-80107236 CCCCAAGCAAGGCTGGGCAGGGG - Intergenic
1152616468 17:81340192-81340214 TTCCAAGTACGGCTGGGCAGTGG + Intergenic
1153686281 18:7549305-7549327 ACCAAAGTACGGCTGGGACCCGG + Intergenic
1161029289 19:2050543-2050565 CCCCAAGTGAGGCTGGGAGCAGG - Intronic
1161337102 19:3720597-3720619 GCCCAGGCACAGCTGGGCGCAGG + Intronic
1161669187 19:5595284-5595306 CTCCAAGTACAGCTGGGAGAAGG + Intronic
1162320044 19:9966388-9966410 CCCCAACCAGGGCTGCGCGCGGG - Exonic
1166002798 19:39888125-39888147 TCCCAAGCAGGGCTGGGCGGTGG + Intronic
1166005585 19:39904377-39904399 TCCCAAGCAGGGCTGGGCGGTGG + Intronic
929998844 2:46847430-46847452 CTCGCAGTACGGCTGGGCTCAGG - Intronic
948958662 2:241315346-241315368 CGCCGAGTACGACTGGGCGGGGG - Intronic
949027196 2:241771857-241771879 CCCCCAGGACGGCTGGCCCCTGG + Intergenic
1172126078 20:32626132-32626154 CCACAAGTGCGTCTGGGCGTGGG - Intergenic
1174421804 20:50404110-50404132 GCACAAGGACAGCTGGGCGCAGG - Intergenic
1174423307 20:50415127-50415149 CCCCAAGCTCGGCTGGTCTCAGG - Intergenic
1174605590 20:51759120-51759142 GCGCAAGTGCAGCTGGGCGCTGG + Intronic
1180988387 22:19918882-19918904 CCCCAACTATGGCTGGGAGGTGG - Exonic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950334507 3:12182793-12182815 CACTAGGTCCGGCTGGGCGCAGG + Intronic
955392811 3:58533664-58533686 CTGCAAGTACAGCTGGGAGCTGG - Intronic
956560152 3:70566089-70566111 CACCAAGTATGGCTGTGGGCAGG - Intergenic
958884178 3:99707647-99707669 CCCCAAGTTCGGCAGGGCGTGGG - Intronic
959066322 3:101660874-101660896 CTCCCAGTACAGCTGGGGGCAGG - Intronic
961504711 3:127362485-127362507 CCCCCAGCACTGCTGGGAGCTGG - Intergenic
961831824 3:129626980-129627002 CCCCTAGGCCGGCTGGGAGCTGG - Intergenic
964720498 3:159764300-159764322 CCCCAAGGAGGCCTGGGGGCGGG - Intronic
982369600 4:154620412-154620434 ACCTAAGTAGGGCTGGGTGCTGG - Intergenic
984400422 4:179257219-179257241 CCCCCAGTATGGCTGGGTCCAGG + Intergenic
989602788 5:43215384-43215406 CTCCAAGAACTGCTGGGCCCAGG - Intronic
990909949 5:60843559-60843581 CCCCAAGTTCATCTGGCCGCGGG + Intronic
992857162 5:80873993-80874015 CCCCAAGTACGGCAGGGGTGGGG - Intronic
993964832 5:94347492-94347514 CCCCCAGTACAGCTTGGTGCTGG + Intronic
997303108 5:132820641-132820663 TCCCCAGTCCGGCTGGGCGTGGG - Intergenic
1003948228 6:11094202-11094224 CGCCAGGCGCGGCTGGGCGCCGG - Exonic
1009964062 6:70559149-70559171 ACCAAATTTCGGCTGGGCGCAGG + Intronic
1017522412 6:155213787-155213809 CCCAAAGTACAGCAGGGGGCTGG + Intronic
1019122181 6:169812160-169812182 CCCCAAGTCAGGGTGGGCTCGGG + Intergenic
1019275754 7:174652-174674 CCCCCTGTACTGCTGGGCGAGGG + Intergenic
1019343299 7:518455-518477 CCCCAAGCCCGGCGGGGCTCAGG - Intronic
1024557377 7:50615244-50615266 CCCAAAGTACGGTTGGACTCTGG - Intronic
1035233833 7:157483925-157483947 CCCCAAGGACAGCTGTGGGCAGG - Intergenic
1035487409 7:159236929-159236951 CCCCAAGGACCTCAGGGCGCAGG + Intergenic
1049780951 8:144428645-144428667 CCCGAAGTCCGGGCGGGCGCGGG - Intergenic
1058908179 9:109498119-109498141 CCCCAGGGACGGGTGGGGGCGGG + Intronic
1059769747 9:117414480-117414502 CCCTGGGTAAGGCTGGGCGCCGG - Exonic
1061160028 9:128888420-128888442 CCCCAGGAAGGGCTGGGCTCAGG - Intronic
1061994087 9:134175333-134175355 CCCCAAGGACAGCTAGGCGGGGG + Intergenic
1185464210 X:345720-345742 CCCCAAGTCCGCCTGGCTGCGGG + Intronic
1188040689 X:25367254-25367276 CCCAGAGCACGTCTGGGCGCTGG - Intergenic
1197146529 X:123178412-123178434 CCCCAGGTAGGGCTGGGAGGAGG + Intergenic