ID: 1096000135

View in Genome Browser
Species Human (GRCh38)
Location 12:48122508-48122530
Sequence CTGATCCCTCCCACCCCAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096000135_1096000140 5 Left 1096000135 12:48122508-48122530 CCAATTGGGGTGGGAGGGATCAG 0: 1
1: 1
2: 1
3: 12
4: 217
Right 1096000140 12:48122536-48122558 AATTAGGACCTTAGTAGTCTTGG 0: 1
1: 0
2: 1
3: 12
4: 91
1096000135_1096000141 6 Left 1096000135 12:48122508-48122530 CCAATTGGGGTGGGAGGGATCAG 0: 1
1: 1
2: 1
3: 12
4: 217
Right 1096000141 12:48122537-48122559 ATTAGGACCTTAGTAGTCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096000135 Original CRISPR CTGATCCCTCCCACCCCAAT TGG (reversed) Intronic
901875049 1:12162643-12162665 CTGACATCTCCCACCCCAGTAGG - Intergenic
902696762 1:18145492-18145514 CTGATACCTGCCGCCCCAACTGG + Intronic
903064342 1:20690335-20690357 CTGGTCCCTCCCACCCCCCCAGG - Exonic
904318711 1:29682663-29682685 CTGCTCCCTCTGACCCCACTGGG + Intergenic
906511703 1:46413773-46413795 CTGATCCCTCCACCCCCATGTGG + Exonic
906681526 1:47729218-47729240 CTGTTCCCTCCCACAACAAGTGG - Intergenic
909096226 1:71291724-71291746 CAGATCCCTCCCACAACAGTGGG - Intergenic
909180338 1:72415844-72415866 CAGGTCCCTCCCACAACAATGGG - Intergenic
910764894 1:90771911-90771933 CTGATCCCTCCCACAACATGTGG - Intergenic
915570449 1:156742708-156742730 CTCAACACTCCCACCCAAATGGG + Intronic
917472699 1:175339446-175339468 CTGATCCCACCTACCCCTAGAGG + Intronic
918311035 1:183285437-183285459 CAGATCCCTCTCAGCCAAATAGG - Intronic
919581037 1:199373250-199373272 CTGATCCCTCCCACGACACATGG - Intergenic
921399339 1:214703408-214703430 CTGATCCCTCCCACAACACATGG - Intergenic
922055203 1:222036013-222036035 TTCATCCCTCCCTCCCCTATTGG - Intergenic
1065398441 10:25267454-25267476 CTGATCCCTCCCACGACATGTGG + Intronic
1065405208 10:25356489-25356511 CTGGTCCCTCCCACAACAAGTGG - Intronic
1065938248 10:30540713-30540735 CTGAAACCTCCCATCCCACTGGG - Intergenic
1067179550 10:43974278-43974300 CTGCTCCCTGCCACACCAAGAGG - Intergenic
1067723076 10:48744181-48744203 ATTTTCCCTCCCACCCCAAGTGG - Intronic
1067894244 10:50162277-50162299 CCGATCCCTCCCACACCACGGGG - Intergenic
1067954597 10:50777984-50778006 CCGATCCCTCCCACACCACGGGG + Intronic
1071549937 10:86559169-86559191 CTGGTCCCTCCCACCACATATGG + Intergenic
1075681311 10:124334829-124334851 CGGATCCCTCTCACCACAAGTGG + Intergenic
1076270763 10:129150321-129150343 CTGATCACTCCCACATCAACTGG - Intergenic
1079580346 11:22055871-22055893 CTGATCCATCCCTCCTCACTGGG - Intergenic
1079671092 11:23172124-23172146 CTGATCCCTCCCACAGCACATGG + Intergenic
1080531223 11:33178577-33178599 CAGATCCCTCCCACCACACGTGG - Intergenic
1081806767 11:45895139-45895161 ATCATCCCTCCCGCCCCACTTGG - Intronic
1083252214 11:61475646-61475668 CTGAGCCCTCCCAGCCCAGGAGG - Intronic
1083932354 11:65852959-65852981 GTGAGCCCTCCCACCTCACTGGG + Intronic
1086279752 11:85171871-85171893 CTGATCCCTCCCTCCTCACTGGG + Intronic
1088004849 11:104927470-104927492 CTGACCCATCCCACCTCACTGGG + Intergenic
1089493850 11:118898956-118898978 GTGATCCGGCCCACCCCAACGGG - Exonic
1090451273 11:126808400-126808422 CAGAGCCCTCCCACCACATTGGG - Intronic
1091220767 11:133928700-133928722 CTGACTCCTCCCACCCCCAAGGG - Intronic
1091999274 12:5019282-5019304 CTTATCCCTCCCACCTCATGTGG + Intergenic
1094277051 12:28689316-28689338 CAGATCCCTCCCGCACCATTGGG - Intergenic
1095633288 12:44402483-44402505 CTGATACCTCCAACACCATTGGG - Intergenic
1095730256 12:45498633-45498655 ATGACTCCTCCCACCACAATTGG + Intergenic
1095840314 12:46685180-46685202 CAGCTCCCTTCCTCCCCAATGGG - Intergenic
1096000135 12:48122508-48122530 CTGATCCCTCCCACCCCAATTGG - Intronic
1096463235 12:51834399-51834421 CTGTTACCCCCCACCCCATTGGG + Intergenic
1098610832 12:72455654-72455676 CTGATCTCTACCACCCTAAAGGG - Intronic
1099051595 12:77787667-77787689 CTGATCCCTCCCATGCCACTAGG + Intergenic
1099941540 12:89195034-89195056 CAGGTCCCTCCCACAACAATGGG + Intergenic
1100054614 12:90493546-90493568 CTGATTGCTCCCACCACAAGTGG + Intergenic
1100698462 12:97120527-97120549 CAGATCCCTCCCACACCACATGG - Intergenic
1101565571 12:105901861-105901883 CTGGTCCCTCCCACAACACTTGG - Intergenic
1102826416 12:115951094-115951116 CTGATCCCTCCCACAACAAGTGG + Intergenic
1103575355 12:121873369-121873391 CTGGTCCCTTTCAGCCCAATGGG + Intergenic
1104020442 12:124988810-124988832 ATGATCCATCCCACCCCTCTGGG + Intronic
1104655543 12:130571702-130571724 CTGTGCCGTCCCACCCCACTTGG + Intronic
1106112782 13:26791751-26791773 CTGGTCCCTCCCACAACAGTTGG - Intergenic
1106130241 13:26933699-26933721 CTCAGCCCTCCCACCCCATGAGG + Intergenic
1106826754 13:33531012-33531034 CTGATCCCTCCCACAACATGTGG - Intergenic
1108173971 13:47773233-47773255 CTGATCCATCCCTCCTCACTGGG - Intergenic
1110567137 13:76968021-76968043 CTGATCCATCCCTCCTCACTGGG - Intergenic
1111266033 13:85814710-85814732 CTCTTTCCTCCCACCCCAACAGG + Intergenic
1119450285 14:74703400-74703422 TGGATCCCTCCCACAACAATGGG + Intronic
1120917125 14:89720080-89720102 CAGGTCCCTCCCACCACAAATGG - Intergenic
1121222838 14:92299377-92299399 CTCCTCCCTCCCACCCCCACAGG - Intergenic
1125499429 15:40229947-40229969 CTGATGGCTCCTACCCCAAAGGG + Intergenic
1127159021 15:56160871-56160893 CTTATCCCTGCCACCCCCAGTGG - Intronic
1127216484 15:56828513-56828535 CTGATCCCTCCCTCTCACATTGG - Intronic
1128506082 15:68273773-68273795 CTGAGCCATCCCATGCCAATGGG - Intergenic
1129831964 15:78676503-78676525 CAACTCCCTCCCACCCCAATGGG + Intronic
1130822181 15:87507434-87507456 CTGGTCCCTCCCACCACACATGG + Intergenic
1131771722 15:95745205-95745227 CTGCTCCCTCTCATCTCAATGGG + Intergenic
1132993698 16:2811667-2811689 CTGCTACCTCCCTCCCCAACAGG - Intergenic
1134027678 16:10966813-10966835 CTGATCCCTCCCACAACACGTGG + Intronic
1135895245 16:26395247-26395269 CTCACCCCTCTCACCCCACTTGG - Intergenic
1135927490 16:26708362-26708384 CTGCCCTCTCCCACCCCATTGGG + Intergenic
1136367159 16:29814121-29814143 CATATCCCTCCCACCCAAAGGGG - Intronic
1137583019 16:49645724-49645746 CAGGTCCCTCCCACCACAAGTGG - Intronic
1140810174 16:78569137-78569159 TTCTTCCCTCCCACCCCAACAGG - Intronic
1142232738 16:88907363-88907385 CTGACCCCACCCACCCCAGCAGG - Intronic
1143249923 17:5515472-5515494 CTGATCCCTCCAGCCCGCATAGG - Exonic
1147210063 17:38867893-38867915 CTGAGCCCTCATACCCCAAGTGG + Intergenic
1147553315 17:41460413-41460435 CTGATCTCCCCAACCCCACTTGG + Intronic
1147976141 17:44249286-44249308 CTGCTGTCTCCTACCCCAATTGG + Exonic
1148547934 17:48531072-48531094 GTGATCTCTCCCAGGCCAATGGG + Intergenic
1148985743 17:51619474-51619496 CTCACCCCTCCCACCCAAGTTGG - Intergenic
1149317655 17:55453696-55453718 CTGTTCCCTCCCACCCCTGCAGG + Intergenic
1149999949 17:61427984-61428006 CTGATCCCTCCCACAACACGTGG - Intergenic
1150978132 17:70111671-70111693 CTGGTCCCTCCCACACACATGGG - Intronic
1151039308 17:70840153-70840175 CAGGTCCCTCACACCACAATGGG + Intergenic
1153506470 18:5804259-5804281 CAGATCCCTCCCACAACATTGGG - Intergenic
1153523890 18:5977386-5977408 CAGCTCCCTCCCTCCCCAAGGGG + Intronic
1156162364 18:34374509-34374531 CTGCTACCTCCCACCTCCATGGG - Intergenic
1157539393 18:48488976-48488998 CTGAACCATTCCACCCCAAAGGG - Intergenic
1160478524 18:79216911-79216933 CTGAGTCCTCCCCTCCCAATAGG + Intronic
1161047331 19:2142712-2142734 CCGGTCCCCCTCACCCCAATGGG + Intronic
1163633456 19:18428238-18428260 CACAGCCCTCCCACCCCCATTGG + Intronic
1164909398 19:31993156-31993178 CTGCTCCCTCCCACCCCTATGGG + Intergenic
1166046283 19:40232898-40232920 CAGAGGCCCCCCACCCCAATAGG + Exonic
1166999389 19:46736973-46736995 CTCACCCCTCCAACCCAAATCGG + Intronic
925115867 2:1377932-1377954 CAGGTCCCTCCCACCACAAGTGG - Intronic
925669912 2:6300536-6300558 CAGGTCCCTCCCACAACAATGGG - Intergenic
925701749 2:6645888-6645910 CTGATCCCTCCCACCACATGTGG - Intergenic
926792397 2:16587644-16587666 CTGGTCCCTCCCACAACAAGTGG - Intronic
927413814 2:22856008-22856030 CTCATCCCTCCCAACACACTTGG + Intergenic
928194119 2:29202069-29202091 CCCATCCCTTCCACCCCTATTGG + Intronic
930741286 2:54835301-54835323 CTGATGCCTCCCACCCACTTAGG + Intronic
931330583 2:61277776-61277798 CAGGTCCCTCCCACAACAATGGG - Intronic
932436475 2:71705028-71705050 ATGCTCCCTCCCACCCCCACAGG - Intergenic
932625243 2:73292028-73292050 CTACTCCCTCCCTCCCCACTAGG + Exonic
934575903 2:95401508-95401530 CTGATCACAGCCACCCCCATAGG + Intergenic
934638025 2:96009065-96009087 CTGATCACAGCCACCCCCATAGG + Intergenic
934795629 2:97096348-97096370 CTGATCACAGCCACCCCCATAGG - Intergenic
936846745 2:116843543-116843565 CAGATCCCTCCCACACCATGTGG + Intergenic
936948672 2:117954767-117954789 CTGATCCCTCCCACGACACGTGG - Intronic
940076861 2:149751463-149751485 ATGATCCCTCCCACACCTACTGG + Intergenic
941735422 2:168969952-168969974 CCCATCCCTCCCACCCCACAAGG + Intronic
944256894 2:197632291-197632313 CTGATCCCTCCCACAACATGTGG - Intronic
946558569 2:220887306-220887328 CAGATCCCTCCCACAACACTTGG + Intergenic
947689653 2:232123085-232123107 CACAACCCTCCCACCCTAATTGG + Intronic
947809000 2:232988168-232988190 CTGCTCCCTCCCCCACCACTGGG + Intronic
948037127 2:234866704-234866726 CAGATCCCTCCCACAACATTTGG + Intergenic
1172295166 20:33804773-33804795 CAGGTCCCTCCCACAACAATGGG - Intergenic
1172700411 20:36850165-36850187 CTGAGCCCACCCACTCCCATGGG + Intronic
1172716820 20:36970451-36970473 CGGATCCCTCCCACCACATGTGG + Intergenic
1172960036 20:38792424-38792446 TTGGTTCCTCCCACCCCAATGGG + Intergenic
1173404370 20:42752216-42752238 CTGATAAATCCCACCCCTATGGG + Intronic
1173596823 20:44263950-44263972 CTTATCCCTCCCATCCCTCTGGG - Intronic
1173859332 20:46272079-46272101 CTCATCCCTGCACCCCCAATGGG + Intronic
1174077222 20:47946252-47946274 CTGCTCCCTGCCACCCCCACAGG - Intergenic
1174418753 20:50385518-50385540 GTGATCTCTCCCAAACCAATTGG + Intergenic
1175806025 20:61829878-61829900 CTCGTCCCTCCCACCCCAGCAGG - Intronic
1176315870 21:5243200-5243222 TTGCTCCCTCCCACCCTAAGCGG - Intergenic
1177471157 21:21562980-21563002 CTGATCCCTCCCACAACACCTGG + Intergenic
1177834112 21:26170814-26170836 CTGATCCGGCCCACCCCGCTCGG + Intronic
1178384711 21:32139712-32139734 CTGGTCCCTCCCACAACACTTGG - Intergenic
1179477219 21:41654803-41654825 CAGATCCCTCCCACCACATATGG + Intergenic
1180022295 21:45136059-45136081 CTGATCCCTCCCACCCCCATGGG - Intronic
1182227690 22:28812244-28812266 CTGATCCCTCCCTCCCCCTTTGG + Intergenic
1182471983 22:30554522-30554544 CAAATCCCTGCCACCCCATTGGG + Intergenic
950055652 3:10022257-10022279 TTCATCCCTCCCATCCCCATGGG + Intergenic
951610380 3:24485763-24485785 TAGAACCCTCCCACCCCTATGGG + Intronic
951758095 3:26114709-26114731 CAGGTCCCTCCCACAACAATGGG + Intergenic
951952797 3:28219683-28219705 CTGGTCCCTCCCACCACACATGG + Intergenic
952036804 3:29212579-29212601 CTGGTCCCTCCCACAACAAGTGG - Intergenic
956006407 3:64783120-64783142 CTTGTCCCCCACACCCCAATAGG - Intergenic
956379118 3:68647317-68647339 CGGGTCCCTCCCACCACACTTGG - Intergenic
956713768 3:72060706-72060728 CAGATCCCTCCCACACCACGTGG + Intergenic
959033181 3:101327286-101327308 CAGGTCCCTCCCACCACAGTGGG - Intronic
960782396 3:121333950-121333972 CAGGTCCCTCCCACAACAATGGG - Intronic
961441777 3:126957793-126957815 CTGCTCCCACCCAGCCTAATAGG - Intronic
965930976 3:174043163-174043185 CTGATCCCTCCCACGACATGTGG + Intronic
966456567 3:180123230-180123252 CTGATCCCTCCCACAACACTTGG - Intergenic
969088347 4:4673222-4673244 CTGACCACTCCCATCCCTATAGG + Intergenic
969840364 4:9877353-9877375 CAGAGCCCTCCCACCCAACTTGG + Intronic
971436804 4:26635215-26635237 CTGCTGCCTCCCACCCCAAATGG - Intronic
971904436 4:32708401-32708423 CTGATCCCTCCCACAACACATGG + Intergenic
972271497 4:37514756-37514778 CTGATCTCTCCTACCCCACTTGG + Intronic
973284813 4:48403430-48403452 CTGATCCATCCCTCCTCACTGGG - Intronic
975203895 4:71622986-71623008 CGGGTCCCTCCCACAACAATAGG + Intergenic
976375676 4:84342561-84342583 CTGACCCATCCCTCCTCAATGGG + Intergenic
980559819 4:134458942-134458964 TTGGTCCCTCCCACCACAAGTGG - Intergenic
980963078 4:139495680-139495702 CAGATCCCTCCCACCACATATGG + Intergenic
981734734 4:147937063-147937085 ACCATCCCCCCCACCCCAATCGG + Intronic
982187707 4:152819418-152819440 CACTTCCCTCCCACCCCCATCGG + Intronic
983020594 4:162671082-162671104 CTGGTCCCTCCCACCACATGTGG + Intergenic
984492341 4:180450728-180450750 CTGCAACCTCCCACCTCAATGGG - Intergenic
984952963 4:185020062-185020084 CTGACCCCACCCACCCCACCCGG - Intronic
985584623 5:723846-723868 TTGACCCCTCCCATCCCCATGGG - Intronic
985598130 5:808176-808198 TTGACCCCTCCCATCCCCATGGG - Intronic
987726358 5:21704983-21705005 CTGAGCTCTCCCTTCCCAATGGG + Intergenic
991261348 5:64671724-64671746 GAGATCCCTCCCTCACCAATGGG - Intergenic
993019514 5:82574904-82574926 CTGATCCCTCCCACAACACATGG - Intergenic
994151846 5:96456784-96456806 CTGGTCCCTCCCACAACAAGTGG - Intergenic
994167329 5:96621646-96621668 CTGATCCCTCCCTCCACACATGG + Intronic
995220494 5:109642132-109642154 CAGGTCCCTCCCACAACAATGGG - Intergenic
996560184 5:124820132-124820154 CTGATCCCTCCCACAACATGTGG - Intergenic
997786997 5:136722781-136722803 CTGAAACCTCTCACCCCACTGGG + Intergenic
998102623 5:139446841-139446863 CTGATCCCTCCCTCGACATTTGG - Intergenic
998163835 5:139829010-139829032 CCCCTCCCTCCCACCCCATTTGG - Intronic
1003221560 6:4165094-4165116 CTGAACCCTCCCACTCCCAGTGG - Intergenic
1006583600 6:35090797-35090819 CTGAAGTCTCCCACCCGAATGGG - Exonic
1010712955 6:79196380-79196402 CTGGTCCCTCCCACGACACTTGG + Intergenic
1011879557 6:92007658-92007680 CTGATCCCTCCCTCCACACATGG + Intergenic
1013468880 6:110442966-110442988 CTCATCCTCCCCACCCCAAATGG + Intronic
1018545399 6:164930090-164930112 CAGATCCCTCACTCCCCAAATGG - Intergenic
1018788377 6:167126741-167126763 CTGGTCCCTCCCACCACACGTGG - Intronic
1020422607 7:8026387-8026409 TTCATCCCTCCCACCCCCAATGG + Intronic
1022964404 7:35459106-35459128 CAGATCCCTCCCACAACAATGGG + Intergenic
1023388978 7:39689102-39689124 CTGATCCCTCCCCCAGCATTGGG + Intronic
1024300833 7:47886309-47886331 CAGATCCCTCCCCCCCGACTTGG - Intronic
1024620851 7:51156587-51156609 CTGATCCTTCTCACCCCACATGG + Intronic
1027844068 7:83349343-83349365 ATGTTCCCTCCAACCCCAAGTGG - Intergenic
1028048516 7:86153072-86153094 CTGATCCCTTCCACCACACATGG - Intergenic
1028720276 7:94022674-94022696 CTGTTCCCTCCCACCACACATGG - Intergenic
1030836495 7:114293584-114293606 CTGGTCCCTCCCACAACAAGTGG - Intronic
1032950899 7:136911022-136911044 CTGATCTCTTCCACTCAAATAGG + Intronic
1033487544 7:141805748-141805770 CTGGTCCCTCCCACCACATGTGG - Intergenic
1034321779 7:150191003-150191025 CAGGTCCCTCCCACCACACTTGG + Intergenic
1034412945 7:150950712-150950734 CATATACCTCCCACCCCAAAAGG + Intronic
1037421649 8:18709261-18709283 CTGATCCATCCCTCCTCACTGGG + Intronic
1037660144 8:20919385-20919407 CTGGTCCCTCCCACAACACTTGG + Intergenic
1039585158 8:38700959-38700981 ATGATCCCGGCCACCGCAATTGG - Intergenic
1040645137 8:49388782-49388804 CTGGTCCCTCCCACAACAAGTGG - Intergenic
1042333748 8:67609008-67609030 CAGAGTCCTCCCATCCCAATGGG + Intronic
1044029323 8:87214877-87214899 CTGGTCCCTCCCACAACACTTGG + Intronic
1046338890 8:112826066-112826088 CTGACCCATCCCTCCCCACTGGG - Intronic
1046880915 8:119307194-119307216 CAGATGCCTCTCACCCCAGTAGG - Intergenic
1048825004 8:138415810-138415832 CTGATCCTTCACATCCCCATAGG + Intronic
1049275565 8:141718454-141718476 ATGAACCCGCCCACCCCACTCGG - Intergenic
1052267311 9:26589859-26589881 CAGGTCCCTCCCACAACAATTGG + Intergenic
1054775044 9:69118072-69118094 CTGGTCCCTCCCTCCCTTATAGG + Intergenic
1055343333 9:75308700-75308722 CTGTTCCATCCCTCCCCACTGGG - Intergenic
1057878527 9:98775904-98775926 CGGCTCCCTGCCACCCCAACAGG - Intronic
1058071333 9:100603368-100603390 CAGATCCCTCCCACAACATTTGG - Intergenic
1061091263 9:128427904-128427926 CTGATCCCCACCACCCCACCTGG - Intronic
1061329836 9:129885550-129885572 CAGATCCCTGCCTCCCCTATCGG + Intergenic
1061853182 9:133428072-133428094 CTGGCCTCTCCCACCCCATTAGG + Intronic
1061973474 9:134056767-134056789 CTCAGCCCTCCCTCCCCACTGGG - Intronic
1062125410 9:134858090-134858112 CTGCTCACTGCCACCCCACTTGG + Intergenic
1062623173 9:137431644-137431666 CTGGTCACTCGCACCCCAGTGGG - Intronic
1185740280 X:2526478-2526500 CTGGTCCCTCCCACACCACGTGG - Intergenic
1185804903 X:3048097-3048119 CAGGTCCCTCCCACAACAATGGG + Intronic
1186611100 X:11139157-11139179 GTCATCCCTCCCACTCCCATGGG + Exonic
1186679472 X:11856201-11856223 CTGATCCCTCCCACAACATGTGG + Intergenic
1187196239 X:17087497-17087519 CTTAACCCTACCACCCTAATGGG - Intronic
1188114877 X:26231131-26231153 CAGGTCCCTCCCACAACAATGGG + Intergenic
1191701552 X:64047833-64047855 CTGATCCATCCCTCCTCACTGGG + Intergenic
1192960671 X:76127227-76127249 CTAATCCATCCCTCCCCAGTGGG + Intergenic
1193479643 X:82011244-82011266 CTGATCCCCCACCCCCCAACAGG + Intergenic
1196645861 X:118116842-118116864 CTGCCCCCTCCCTCCCCAACTGG - Intronic
1197336958 X:125220334-125220356 GGGATCCCTCCCTCCCCAATGGG + Intergenic
1197489567 X:127100879-127100901 CTGATCCATCCCTCCTCACTGGG + Intergenic
1197926046 X:131647612-131647634 CTCAACACTCCCACCCAAATGGG - Intergenic
1200064507 X:153498016-153498038 CTGATCCCAGCCAGCCCAAGGGG + Intronic