ID: 1096024878

View in Genome Browser
Species Human (GRCh38)
Location 12:48351474-48351496
Sequence TTTGCGGGAGCCGTAGCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096024873_1096024878 -4 Left 1096024873 12:48351455-48351477 CCTTGCGGCTGCTGTCCCATTTG 0: 1
1: 0
2: 2
3: 8
4: 160
Right 1096024878 12:48351474-48351496 TTTGCGGGAGCCGTAGCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 47
1096024870_1096024878 30 Left 1096024870 12:48351421-48351443 CCTGAGGGGAAGTCAGGTTGCTA 0: 1
1: 0
2: 1
3: 12
4: 128
Right 1096024878 12:48351474-48351496 TTTGCGGGAGCCGTAGCCGCAGG 0: 1
1: 0
2: 0
3: 1
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096024878 Original CRISPR TTTGCGGGAGCCGTAGCCGC AGG Intergenic
916054758 1:161060848-161060870 TTAGCTGGAGACGTAGCGGCGGG - Intronic
921384021 1:214551702-214551724 GGTGGGGGAGCCGTGGCCGCCGG - Intronic
922831637 1:228557372-228557394 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922832114 1:228609354-228609376 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922832674 1:228611595-228611617 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922833235 1:228613836-228613858 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922833795 1:228616077-228616099 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922834352 1:228618318-228618340 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922834914 1:228620549-228620571 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922835464 1:228622752-228622774 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922836022 1:228624994-228625016 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922836579 1:228627234-228627256 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922837139 1:228629475-228629497 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922837699 1:228631717-228631739 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922838257 1:228633957-228633979 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922838816 1:228636182-228636204 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922839375 1:228638423-228638445 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922839936 1:228640654-228640676 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922840496 1:228642895-228642917 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
922841059 1:228645126-228645148 TTGGCGGGAGCCGTGGCACCGGG + Intergenic
923386906 1:233473779-233473801 TTTGCGGGGGCACTAGCTGCTGG + Intergenic
923506404 1:234609611-234609633 TTTGCGGCCGCCGCCGCCGCTGG - Intergenic
1076545057 10:131239741-131239763 TATGCGGGAGCCTGAGCCGAAGG - Intronic
1076638986 10:131901231-131901253 TTTGCAGGAGCCGGAGGCGGCGG + Exonic
1096024878 12:48351474-48351496 TTTGCGGGAGCCGTAGCCGCAGG + Intergenic
1114657753 14:24326150-24326172 TGTGCAGGAGCCGTACCCCCCGG - Exonic
1119392897 14:74303098-74303120 TATGGGGGCGCTGTAGCCGCCGG - Intronic
1121001625 14:90455308-90455330 CTGGCGGGAGCCGTCGCGGCTGG + Intergenic
1129449125 15:75640170-75640192 ATGGCGGCAGCCGCAGCCGCAGG + Exonic
1135865599 16:26098910-26098932 TTTGCCTGAACCGTATCCGCAGG - Intronic
1138521836 16:57575586-57575608 CTAGCAGGAGCCGTAGCCTCAGG - Exonic
1141571601 16:84937317-84937339 TATGGGGGAGCAGCAGCCGCTGG - Intergenic
1150562011 17:66302641-66302663 GGAGCGGGAGCCGGAGCCGCTGG - Intronic
1159636297 18:70809124-70809146 TTAGCGGCAGCCATAGCAGCAGG + Intergenic
1160767184 19:813828-813850 TTGGCGGGGGCCGGGGCCGCGGG + Exonic
1162095672 19:8308400-8308422 TTTACGGTACGCGTAGCCGCGGG - Intronic
947899528 2:233709219-233709241 TTTGGGGGAGGGGTGGCCGCTGG + Intronic
1181459975 22:23080053-23080075 TTGGAGAGAGCCGTAGCCCCAGG - Intronic
1181932244 22:26411518-26411540 ATGGCGGGAGCCATAGCAGCTGG + Intergenic
1184987795 22:48147192-48147214 TTTTCGGGAGGCGGAGCAGCAGG - Intergenic
986744128 5:10729704-10729726 TTTGCAGGATCCTTAGCCTCAGG + Intronic
1017631210 6:156397711-156397733 TCTGGGGGAGACGTAGCCGGAGG - Intergenic
1018719744 6:166563470-166563492 TCTGGGGGAGCCGCAGCCCCTGG - Intronic
1039020383 8:33198093-33198115 TTTGCGGGGCCAGTAGCTGCGGG - Intergenic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1039741071 8:40383095-40383117 TTTACTGGAGCCATAGCCACAGG - Intergenic
1041292376 8:56319825-56319847 TCTGCGTTAGCCGTAGCCACGGG + Intronic
1061985412 9:134127552-134127574 TCTGGGGGAGCCGGACCCGCAGG - Intergenic
1062428179 9:136515643-136515665 CTTGCAGGAGCCGTAGTGGCAGG + Exonic