ID: 1096025607 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:48358528-48358550 |
| Sequence | ACTGAGATGTCCAATGATGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1096025607_1096025610 | 8 | Left | 1096025607 | 12:48358528-48358550 | CCGTCATCATTGGACATCTCAGT | No data | ||
| Right | 1096025610 | 12:48358559-48358581 | TCCACTTGGGTACATGTGACTGG | No data | ||||
| 1096025607_1096025609 | -5 | Left | 1096025607 | 12:48358528-48358550 | CCGTCATCATTGGACATCTCAGT | No data | ||
| Right | 1096025609 | 12:48358546-48358568 | TCAGTAGTTTGATTCCACTTGGG | No data | ||||
| 1096025607_1096025608 | -6 | Left | 1096025607 | 12:48358528-48358550 | CCGTCATCATTGGACATCTCAGT | No data | ||
| Right | 1096025608 | 12:48358545-48358567 | CTCAGTAGTTTGATTCCACTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1096025607 | Original CRISPR | ACTGAGATGTCCAATGATGA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||