ID: 1096025607

View in Genome Browser
Species Human (GRCh38)
Location 12:48358528-48358550
Sequence ACTGAGATGTCCAATGATGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096025607_1096025610 8 Left 1096025607 12:48358528-48358550 CCGTCATCATTGGACATCTCAGT No data
Right 1096025610 12:48358559-48358581 TCCACTTGGGTACATGTGACTGG No data
1096025607_1096025609 -5 Left 1096025607 12:48358528-48358550 CCGTCATCATTGGACATCTCAGT No data
Right 1096025609 12:48358546-48358568 TCAGTAGTTTGATTCCACTTGGG No data
1096025607_1096025608 -6 Left 1096025607 12:48358528-48358550 CCGTCATCATTGGACATCTCAGT No data
Right 1096025608 12:48358545-48358567 CTCAGTAGTTTGATTCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096025607 Original CRISPR ACTGAGATGTCCAATGATGA CGG (reversed) Intergenic
No off target data available for this crispr