ID: 1096028113

View in Genome Browser
Species Human (GRCh38)
Location 12:48385994-48386016
Sequence ATTTTTTCTTGGGGCACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096028113_1096028118 19 Left 1096028113 12:48385994-48386016 CCATTGGTGCCCCAAGAAAAAAT No data
Right 1096028118 12:48386036-48386058 ATATAACCCCACACCAAGATAGG No data
1096028113_1096028117 -6 Left 1096028113 12:48385994-48386016 CCATTGGTGCCCCAAGAAAAAAT No data
Right 1096028117 12:48386011-48386033 AAAAATGAAAAAGAAACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096028113 Original CRISPR ATTTTTTCTTGGGGCACCAA TGG (reversed) Intergenic
No off target data available for this crispr