ID: 1096028146

View in Genome Browser
Species Human (GRCh38)
Location 12:48386230-48386252
Sequence CAGGAACAGCACAAAGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096028140_1096028146 4 Left 1096028140 12:48386203-48386225 CCCTATCAGGGTCAGGAGATAAA No data
Right 1096028146 12:48386230-48386252 CAGGAACAGCACAAAGAGTGGGG No data
1096028136_1096028146 23 Left 1096028136 12:48386184-48386206 CCAACAGCATCATCAGATTCCCT No data
Right 1096028146 12:48386230-48386252 CAGGAACAGCACAAAGAGTGGGG No data
1096028141_1096028146 3 Left 1096028141 12:48386204-48386226 CCTATCAGGGTCAGGAGATAAAT No data
Right 1096028146 12:48386230-48386252 CAGGAACAGCACAAAGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096028146 Original CRISPR CAGGAACAGCACAAAGAGTG GGG Intergenic
No off target data available for this crispr