ID: 1096031368

View in Genome Browser
Species Human (GRCh38)
Location 12:48418335-48418357
Sequence GGAGGCTAATGTTGGCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096031362_1096031368 29 Left 1096031362 12:48418283-48418305 CCTCTGTGCTGTCAATAAACGGC No data
Right 1096031368 12:48418335-48418357 GGAGGCTAATGTTGGCTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096031368 Original CRISPR GGAGGCTAATGTTGGCTTGA TGG Intergenic
No off target data available for this crispr