ID: 1096031630

View in Genome Browser
Species Human (GRCh38)
Location 12:48421352-48421374
Sequence TAGCAATGACAACTCCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096031629_1096031630 0 Left 1096031629 12:48421329-48421351 CCACACATTTTTCAACAATAAAG No data
Right 1096031630 12:48421352-48421374 TAGCAATGACAACTCCAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096031630 Original CRISPR TAGCAATGACAACTCCAAAG AGG Intergenic
No off target data available for this crispr