ID: 1096033496

View in Genome Browser
Species Human (GRCh38)
Location 12:48442514-48442536
Sequence CTGTGTTCAGGGCTGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096033496_1096033504 -4 Left 1096033496 12:48442514-48442536 CCCCCCACCAGCCCTGAACACAG No data
Right 1096033504 12:48442533-48442555 ACAGCTGTCTGTTCATCACTTGG No data
1096033496_1096033505 10 Left 1096033496 12:48442514-48442536 CCCCCCACCAGCCCTGAACACAG No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033496_1096033507 21 Left 1096033496 12:48442514-48442536 CCCCCCACCAGCCCTGAACACAG No data
Right 1096033507 12:48442558-48442580 ATAGAGCAAAGGAGAGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096033496 Original CRISPR CTGTGTTCAGGGCTGGTGGG GGG (reversed) Intergenic
No off target data available for this crispr