ID: 1096033505

View in Genome Browser
Species Human (GRCh38)
Location 12:48442547-48442569
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096033503_1096033505 -2 Left 1096033503 12:48442526-48442548 CCTGAACACAGCTGTCTGTTCAT No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033498_1096033505 8 Left 1096033498 12:48442516-48442538 CCCCACCAGCCCTGAACACAGCT No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033502_1096033505 -1 Left 1096033502 12:48442525-48442547 CCCTGAACACAGCTGTCTGTTCA No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033501_1096033505 3 Left 1096033501 12:48442521-48442543 CCAGCCCTGAACACAGCTGTCTG No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033495_1096033505 17 Left 1096033495 12:48442507-48442529 CCATGAGCCCCCCACCAGCCCTG No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033500_1096033505 6 Left 1096033500 12:48442518-48442540 CCACCAGCCCTGAACACAGCTGT No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033497_1096033505 9 Left 1096033497 12:48442515-48442537 CCCCCACCAGCCCTGAACACAGC No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033494_1096033505 18 Left 1096033494 12:48442506-48442528 CCCATGAGCCCCCCACCAGCCCT No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033492_1096033505 24 Left 1096033492 12:48442500-48442522 CCAAGCCCCATGAGCCCCCCACC No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033496_1096033505 10 Left 1096033496 12:48442514-48442536 CCCCCCACCAGCCCTGAACACAG No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033493_1096033505 19 Left 1096033493 12:48442505-48442527 CCCCATGAGCCCCCCACCAGCCC No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data
1096033499_1096033505 7 Left 1096033499 12:48442517-48442539 CCCACCAGCCCTGAACACAGCTG No data
Right 1096033505 12:48442547-48442569 ATCACTTGGCCATAGAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096033505 Original CRISPR ATCACTTGGCCATAGAGCAA AGG Intergenic
No off target data available for this crispr