ID: 1096041767

View in Genome Browser
Species Human (GRCh38)
Location 12:48523543-48523565
Sequence CTTCTCTCCAACTTGGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 266}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096041767_1096041772 4 Left 1096041767 12:48523543-48523565 CCTGCAGCCAAGTTGGAGAGAAG 0: 1
1: 0
2: 2
3: 22
4: 266
Right 1096041772 12:48523570-48523592 CCGTACTGGACAGGATGTACAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1096041767_1096041777 26 Left 1096041767 12:48523543-48523565 CCTGCAGCCAAGTTGGAGAGAAG 0: 1
1: 0
2: 2
3: 22
4: 266
Right 1096041777 12:48523592-48523614 GCAATCTGTATTTGGGGCATGGG 0: 1
1: 0
2: 0
3: 9
4: 119
1096041767_1096041769 -10 Left 1096041767 12:48523543-48523565 CCTGCAGCCAAGTTGGAGAGAAG 0: 1
1: 0
2: 2
3: 22
4: 266
Right 1096041769 12:48523556-48523578 TGGAGAGAAGATTGCCGTACTGG 0: 1
1: 0
2: 0
3: 3
4: 99
1096041767_1096041775 20 Left 1096041767 12:48523543-48523565 CCTGCAGCCAAGTTGGAGAGAAG 0: 1
1: 0
2: 2
3: 22
4: 266
Right 1096041775 12:48523586-48523608 GTACAGGCAATCTGTATTTGGGG 0: 1
1: 0
2: 0
3: 10
4: 105
1096041767_1096041778 30 Left 1096041767 12:48523543-48523565 CCTGCAGCCAAGTTGGAGAGAAG 0: 1
1: 0
2: 2
3: 22
4: 266
Right 1096041778 12:48523596-48523618 TCTGTATTTGGGGCATGGGAAGG 0: 1
1: 0
2: 2
3: 25
4: 297
1096041767_1096041776 25 Left 1096041767 12:48523543-48523565 CCTGCAGCCAAGTTGGAGAGAAG 0: 1
1: 0
2: 2
3: 22
4: 266
Right 1096041776 12:48523591-48523613 GGCAATCTGTATTTGGGGCATGG 0: 1
1: 0
2: 0
3: 8
4: 136
1096041767_1096041770 -5 Left 1096041767 12:48523543-48523565 CCTGCAGCCAAGTTGGAGAGAAG 0: 1
1: 0
2: 2
3: 22
4: 266
Right 1096041770 12:48523561-48523583 AGAAGATTGCCGTACTGGACAGG 0: 1
1: 0
2: 0
3: 0
4: 44
1096041767_1096041774 19 Left 1096041767 12:48523543-48523565 CCTGCAGCCAAGTTGGAGAGAAG 0: 1
1: 0
2: 2
3: 22
4: 266
Right 1096041774 12:48523585-48523607 TGTACAGGCAATCTGTATTTGGG 0: 1
1: 0
2: 0
3: 14
4: 119
1096041767_1096041773 18 Left 1096041767 12:48523543-48523565 CCTGCAGCCAAGTTGGAGAGAAG 0: 1
1: 0
2: 2
3: 22
4: 266
Right 1096041773 12:48523584-48523606 ATGTACAGGCAATCTGTATTTGG 0: 1
1: 0
2: 0
3: 13
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096041767 Original CRISPR CTTCTCTCCAACTTGGCTGC AGG (reversed) Intronic
901242272 1:7702407-7702429 CTTCTCTTTAACTGGGCTTCAGG + Intronic
902684136 1:18064864-18064886 AGTCTCTCCACCCTGGCTGCAGG + Intergenic
902704163 1:18192993-18193015 CTTCACTCCAAATGGGCAGCAGG + Intronic
904644816 1:31957760-31957782 CTTCTCTCTTCCTTGGTTGCTGG + Intergenic
905277176 1:36825776-36825798 CTTCTCTCGAACATGGGTGATGG + Exonic
905552239 1:38851443-38851465 TTTCTCTGGAAGTTGGCTGCTGG - Intronic
907138626 1:52163447-52163469 CTCCACTCCCACTTGGTTGCAGG + Intronic
907528638 1:55070545-55070567 CTTCTCTCCAACTCAGCAGTTGG - Intronic
909419705 1:75450277-75450299 CCTCTCCCCAACTTAGCTCCAGG - Intronic
910932136 1:92453183-92453205 CTGCACTCCAGCTTGGCGGCAGG - Intergenic
913542297 1:119833198-119833220 CTTGTCTCCACCTTGGCTTTTGG - Intergenic
913581187 1:120228638-120228660 CTTCTCTCCAACTTGTTTCTGGG - Intergenic
913626990 1:120669762-120669784 CTTCTCTCCAACTTGTTTCTGGG + Intergenic
914563118 1:148840075-148840097 CTTCTCTCCAACTTGTTTCTGGG - Intronic
914609709 1:149290148-149290170 CTTCTCTCCAACTTGTTTCTGGG + Intergenic
916039634 1:160951010-160951032 CTTCTCTCCTACTTGGGTGAGGG - Intronic
917441577 1:175073583-175073605 CTTCCCTCCAGCTTCTCTGCAGG - Intronic
920067700 1:203280757-203280779 CTTCTATCCCACTTTGCTGCTGG + Intergenic
920100486 1:203514115-203514137 CTTCCCTCTAGCTTGGCGGCGGG + Intergenic
920512002 1:206558366-206558388 CCACTCTCCTAGTTGGCTGCAGG + Intronic
921213125 1:212916610-212916632 CCTCTCTCCACCGTGGCTCCCGG + Intergenic
922444695 1:225687272-225687294 CTGCACTCCAACTTGAGTGCTGG - Intergenic
922526537 1:226308796-226308818 CTTCCCTCCACCTCGGCTGGGGG + Intronic
923210873 1:231803220-231803242 CTTCCTTACAACATGGCTGCTGG + Intronic
923702394 1:236312422-236312444 CTGCACTCCAACTTGGGTGACGG + Intergenic
924780208 1:247140888-247140910 CTTCTCTCCCACTTGAATGCTGG + Intronic
1063724774 10:8624774-8624796 CTTAGCTCCTACTTGGATGCTGG - Intergenic
1064487603 10:15811976-15811998 CTTCACTCCAACCTGGGTGAAGG - Intronic
1064701100 10:18023049-18023071 CTCCTCTCCTACTTGAGTGCTGG + Intronic
1065530768 10:26668006-26668028 CTCCTCTCCACTTAGGCTGCAGG - Intergenic
1068770166 10:60811849-60811871 CTTCTCCCCAACTTTCCCGCAGG - Intergenic
1070765223 10:79052593-79052615 GAGCTCTCCAACCTGGCTGCTGG + Intergenic
1071484224 10:86087759-86087781 ATTCTCTACCACATGGCTGCTGG + Intronic
1072374937 10:94804555-94804577 CCTCTCCCCACCTTAGCTGCAGG + Intronic
1075180303 10:120205005-120205027 CCTCTCTCCAAGTTCGCTCCAGG + Intergenic
1075351155 10:121726175-121726197 CTGCTCTCCACATTGGCTCCAGG + Intergenic
1075649714 10:124119488-124119510 CTGCTCTTCACCCTGGCTGCTGG + Intergenic
1075898134 10:126016088-126016110 TCTTTTTCCAACTTGGCTGCAGG - Exonic
1076234190 10:128851116-128851138 CCTCTCTCCATCTTGGGGGCTGG - Intergenic
1076385232 10:130050904-130050926 CTTGTCTCCAACATGGATGATGG + Intergenic
1078337050 11:10472965-10472987 CTGCTCTCCAGCCTGGCTGAGGG + Intronic
1078642923 11:13113278-13113300 CCTCCCTCCAACAGGGCTGCGGG - Intergenic
1078682066 11:13486474-13486496 CTCCTCTCCTCCTTGGCTACTGG + Intergenic
1078915301 11:15773204-15773226 ATTCTCTACAATTTGGCTCCAGG - Intergenic
1079164665 11:18028642-18028664 CTTTCCTCTACCTTGGCTGCAGG + Intronic
1082057118 11:47827325-47827347 CTGCACTCCAACTTGGGTGACGG + Intronic
1083158178 11:60838343-60838365 CTTCTCTCAGAGTTGGCTTCTGG + Intergenic
1085815222 11:79730329-79730351 CTTATGTCCAACTTGGTAGCTGG - Intergenic
1086070228 11:82791421-82791443 CTTCTCTGCAAGTGGGCTACAGG - Intergenic
1087068344 11:94048767-94048789 CTTCTCTCTATCCTGTCTGCAGG + Intronic
1087605048 11:100366877-100366899 CCTCTCTCCAAGTTGGCTCCAGG + Intergenic
1090441988 11:126731960-126731982 CTTCTCTCTCTCTTTGCTGCTGG - Intronic
1091038382 11:132254292-132254314 CTTCTCGCCCACTTGTCTCCTGG + Intronic
1092020976 12:5201974-5201996 CTTCACTCTAATATGGCTGCTGG + Intergenic
1092587823 12:9919111-9919133 TTTCTCTCCCACTTGAGTGCTGG + Intronic
1093189885 12:16061686-16061708 CCTCTCTCCAAATTGGTTCCTGG - Intergenic
1093240027 12:16659022-16659044 CTCCTCTCCCACTTGAGTGCTGG + Intergenic
1094151073 12:27284214-27284236 CTGATATCCAACTTTGCTGCAGG + Intronic
1095779907 12:46048241-46048263 CCTCTCCCCAAGTTAGCTGCAGG - Intergenic
1095982144 12:47979854-47979876 CCTCTCTCCCACCTGGCTGTGGG + Intronic
1096041767 12:48523543-48523565 CTTCTCTCCAACTTGGCTGCAGG - Intronic
1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG + Intergenic
1098190073 12:67938612-67938634 CTACTCTCACCCTTGGCTGCTGG - Intergenic
1098641247 12:72840111-72840133 CTCCTCTCCCACTTCACTGCTGG - Intergenic
1099184969 12:79505899-79505921 CTCCTCTCCCACTTGAGTGCTGG - Intergenic
1099657784 12:85517135-85517157 CTTCCCTCCATCATGGCTACTGG - Intergenic
1100572771 12:95858660-95858682 CTTCTCCCCAACTTGGCTAATGG - Intergenic
1100692848 12:97057287-97057309 TTCCTCTCCAACATGGCAGCTGG - Intergenic
1101197681 12:102402140-102402162 CCTCTCTGAATCTTGGCTGCTGG - Intronic
1101245889 12:102884207-102884229 CTGCTCTCCAACATGACAGCTGG - Intronic
1101430639 12:104624040-104624062 CTTCCCTCCATCAAGGCTGCAGG - Intronic
1102755445 12:115335782-115335804 CTTCCCTCCTTCTGGGCTGCTGG - Intergenic
1104398842 12:128459129-128459151 ATTCTCTCCAAAGGGGCTGCTGG - Intronic
1104960230 12:132485085-132485107 CTGCTTTCCAACATGCCTGCTGG + Intergenic
1106112108 13:26786199-26786221 CTCTTCTCCAATTTGCCTGCAGG - Intergenic
1107175749 13:37395755-37395777 CTCCTCTCCCACTTGAGTGCTGG - Intergenic
1107499989 13:40963867-40963889 CTGCACTCCAACTTGGGTGACGG + Intronic
1109351017 13:61181234-61181256 CCTCTCTCCACCTTGTCTCCAGG + Intergenic
1112993458 13:105542788-105542810 CTGCTCTCCATCTTGGATGTTGG - Intergenic
1113029591 13:105978386-105978408 CTTCTCTGGAAATTGGCTGTAGG + Intergenic
1113335094 13:109369879-109369901 CTCCTCTCCCTCTTGGGTGCAGG - Intergenic
1114498098 14:23147882-23147904 CATCTCTCCTGCTTGGCAGCTGG - Intronic
1115911358 14:38259787-38259809 CTTCTCCCCTACTTGAGTGCTGG - Intergenic
1116402284 14:44522500-44522522 CTGCTCTCCAGCTTGGCTGATGG + Intergenic
1117086101 14:52203006-52203028 CAGCTATCTAACTTGGCTGCTGG + Intergenic
1118789012 14:69071891-69071913 CTACTCTTCAACATGGCTTCAGG - Intronic
1120300924 14:82705768-82705790 CTCTTCTCCCACTTGACTGCTGG + Intergenic
1122413154 14:101536161-101536183 CTTCTCTTCAACATGTCTGTGGG + Intergenic
1122846432 14:104502459-104502481 CTTCTCTCCATTCTGGCTGGTGG + Intronic
1124460770 15:29889628-29889650 CATCTCTGCAGCCTGGCTGCTGG - Intronic
1125089726 15:35776104-35776126 CTTCTCCCTGACTTTGCTGCAGG + Intergenic
1126644103 15:50857998-50858020 CTTCTCTCCAGAATGGCTGCAGG - Intergenic
1127393219 15:58523194-58523216 ATTCTCTGCACCTTGGCTTCCGG + Intronic
1127421795 15:58813457-58813479 CTTCTCTCCAGCCTGGGTGATGG + Intronic
1127827348 15:62716360-62716382 CTTCTCTCAGCCTTTGCTGCTGG - Exonic
1128151837 15:65368203-65368225 CTTCTCTCCAGAGTGCCTGCAGG - Intronic
1128261115 15:66233691-66233713 CTTCTCTCCAACATGACTCAGGG + Intronic
1128391423 15:67185312-67185334 CTTCTCTCTACCTGGGCTGCTGG - Intronic
1129447148 15:75626271-75626293 CTTCTTTCCCACTCGGCTGCGGG + Intronic
1137391229 16:48082899-48082921 TTTCTCTCCAACCTGGAGGCTGG - Intergenic
1137496354 16:48972055-48972077 CTTCTCTCCATCTAGGGAGCTGG + Intergenic
1138292698 16:55861510-55861532 CTTCTCTACAAAATAGCTGCAGG - Exonic
1139375848 16:66495743-66495765 CAGCTCTCCAGCTTGGCTGTGGG - Intronic
1142497269 17:312872-312894 CTTCCCTCCTCCCTGGCTGCAGG - Intronic
1143852592 17:9823887-9823909 CATGTATCCCACTTGGCTGCAGG + Intronic
1143856691 17:9856351-9856373 CTTCTCTCTAACTAGACTGGGGG - Intronic
1145064336 17:19751953-19751975 CTGCACTCCAACTTGGATGAGGG + Intergenic
1145984322 17:29034911-29034933 CTCCTCTCTCACCTGGCTGCTGG - Intronic
1146251205 17:31345655-31345677 CATCTCACCAACTTCGGTGCTGG - Intronic
1147978228 17:44259917-44259939 CAGCTCTCCAGCGTGGCTGCAGG + Exonic
1148345084 17:46897848-46897870 CTTCTCTCCTACCTGGGTCCTGG + Intergenic
1148431958 17:47650026-47650048 CCTCCCTCCAAATGGGCTGCTGG - Exonic
1151365083 17:73611825-73611847 ACTCCCTCCAGCTTGGCTGCAGG - Intronic
1151403740 17:73873463-73873485 CTTCCCACCATCATGGCTGCTGG + Intergenic
1152575667 17:81139779-81139801 CTCCTCTGCAACTGGGCTGGAGG + Intronic
1153290139 18:3492966-3492988 CTTCTCTGCAGCCTGGCCGCTGG - Intergenic
1154028023 18:10725720-10725742 CTTCTCTCCACAGTGGCGGCAGG + Intronic
1154059540 18:11046814-11046836 CTTCTCTATAGCCTGGCTGCCGG - Intronic
1156347378 18:36269858-36269880 CTGCTCTCCAACTGAGCAGCAGG - Exonic
1157500924 18:48190103-48190125 CTTCTCTCTGCCTTGGGTGCGGG + Intronic
1159110160 18:64045775-64045797 CTTGTCTGCTACTTGGATGCTGG - Intergenic
1159133674 18:64310390-64310412 CTTCTGTCCAATTTTGGTGCAGG + Intergenic
1160440172 18:78883666-78883688 CCTCTCTCCAAGTTAGCTGTTGG - Intergenic
1161579890 19:5075037-5075059 CTGCTCCCCAACAGGGCTGCCGG - Intronic
1162117644 19:8441026-8441048 CTGCTCTCCAACCTGGGTGATGG - Intronic
1163798541 19:19351077-19351099 CTGCGCTCCAACTTGGGTGACGG - Intronic
1164430601 19:28185217-28185239 TCTCTCTCAAACTTGGCTGCAGG - Intergenic
1166272153 19:41721116-41721138 TTTGTCTCTAACTTGGCTACTGG + Exonic
1167780717 19:51597163-51597185 CCTCTCTCCTAGATGGCTGCAGG - Intergenic
925556534 2:5136920-5136942 CTTCTCTGCCCTTTGGCTGCAGG + Intergenic
925647029 2:6045646-6045668 CTCCTCTCCCACTTGAGTGCTGG - Intergenic
925955071 2:8955294-8955316 CCTCTCCCCAAGTTGGCTCCAGG + Intronic
926938638 2:18112811-18112833 GTTCAGTCCAACTTTGCTGCTGG - Intronic
927997947 2:27499385-27499407 CTCCTCTCCTAGGTGGCTGCCGG + Exonic
928229506 2:29485028-29485050 GTTCACTCCAACTAGGCAGCAGG - Intronic
928296382 2:30087570-30087592 CTTCTCTCAGAGTTTGCTGCAGG + Intergenic
930508161 2:52310825-52310847 CTTTTCTCCAAATTGCCTGATGG - Intergenic
933269826 2:80221396-80221418 TTTCTTTCCAACTTGCCAGCTGG - Intronic
933473036 2:82751599-82751621 CTTATCTCCAACATGGCACCAGG + Intergenic
933491514 2:82990955-82990977 CTTCTCTCAGACATGGCTGTGGG - Intergenic
934157892 2:89220132-89220154 CTAATCTCCAACGTGGCTGTAGG - Intergenic
934209370 2:89962290-89962312 CTAATCTCCAACGTGGCTGTAGG + Intergenic
934623148 2:95828641-95828663 CTTCTCTCCTCCTTGAGTGCTGG + Intergenic
934785396 2:97001619-97001641 CTCCTCTCAAACTTGGCTTGTGG - Intronic
934810614 2:97273446-97273468 CTTCTCTCCCCCTTGAGTGCTGG - Intergenic
934827078 2:97434493-97434515 CTTCTCTCCCCCTTGAGTGCTGG + Intergenic
935014647 2:99169124-99169146 CTTCTCTGTTACTTGGCTGCGGG - Intronic
935542796 2:104369407-104369429 CCTCTCTCCAGCTCTGCTGCTGG - Intergenic
936053237 2:109241561-109241583 CTTCCCTCCCACTTGGCCTCAGG + Intronic
936075384 2:109398369-109398391 CCTCTCTCCATCATGGCTCCTGG + Intronic
936399666 2:112155805-112155827 CTTGTCTTCTACTTGGCCGCTGG - Intronic
937116461 2:119408366-119408388 CTTCTCACCATCTAGGCAGCTGG + Intergenic
937234897 2:120424940-120424962 CTTCCCACCAACGTGGCTGTTGG - Intergenic
937440193 2:121908659-121908681 CTTCTCTCCATCTTGGAAGCGGG - Intergenic
938032449 2:128006741-128006763 CTGTTCTCCAACCTGGCTGGCGG + Intronic
938900377 2:135794456-135794478 CTTCTCTCCCTCTTGCTTGCTGG + Intronic
942616697 2:177798555-177798577 CTTCTCTGCAAATAGTCTGCAGG - Intronic
943341047 2:186682595-186682617 CTTTTTGCCAACATGGCTGCCGG - Intergenic
943923603 2:193742116-193742138 CTCCTCTCCCACTTGAGTGCTGG - Intergenic
944660366 2:201916579-201916601 CTTCTCTTCCCCTTGGCAGCAGG - Intergenic
944679212 2:202061677-202061699 CTGCACTCCAACTTGGGTGACGG - Intergenic
945347844 2:208739627-208739649 CTTCTCTCCAGGTTAGCTCCAGG + Intronic
945495073 2:210499672-210499694 CCTCTCTCCAAGTTAGCTCCAGG + Intronic
946601062 2:221360851-221360873 CTTCGTTCCTACTTGGCTACTGG - Intergenic
946739849 2:222790556-222790578 CTCCTCTCCAACATGGCCTCTGG - Intergenic
947263870 2:228254376-228254398 CTTCTCCCCAAGTTAGCTCCAGG + Intergenic
948689548 2:239693396-239693418 CTGCTTTCCAAAGTGGCTGCAGG + Intergenic
1169204667 20:3732926-3732948 CCTCTCTGCAGCGTGGCTGCGGG + Intronic
1169720286 20:8668522-8668544 CTTCTTTCAAAGTTGGCTTCTGG - Intronic
1170762728 20:19265029-19265051 CTTGTCTCAGACTTGGCTGTTGG + Intronic
1170782848 20:19441036-19441058 CTTGTCTGAAACATGGCTGCAGG - Intronic
1171424848 20:25042914-25042936 CTTCTCCTCCACTGGGCTGCTGG - Intronic
1174232442 20:49057488-49057510 CTGCACTCCAACTTGGGTGATGG - Intronic
1174713684 20:52733737-52733759 CTGCTCTCCAGCCTGGGTGCGGG + Intergenic
1175801396 20:61802956-61802978 GCTCTCTCCAACATGGCAGCTGG + Intronic
1176980207 21:15373098-15373120 CTTCTCTCCAATTTTTATGCTGG + Intergenic
1177764447 21:25440734-25440756 CTCCTCTCCCACTTGAGTGCTGG - Intergenic
1178742666 21:35216904-35216926 CTTCTCTCAAAATTTGCTACTGG - Intronic
1181889770 22:26052257-26052279 ATTCCCTCCAACTTGGCTGCAGG + Intergenic
1182226733 22:28804617-28804639 CTGCTCTCCAACCTGGGTGAGGG + Intergenic
1182600751 22:31461731-31461753 CTTCTCTCAAACTTAGTTTCAGG - Intronic
1184176805 22:42793544-42793566 CGTCTGTCCACCTGGGCTGCGGG - Intergenic
1184951068 22:47842916-47842938 CTACTCTCTACCTTGGCTCCTGG + Intergenic
1185266925 22:49909129-49909151 CTTCTCTGCAGCGTGGCTGCAGG - Intronic
950600921 3:14035087-14035109 CTCCTCTCCCACTTGAGTGCTGG + Intronic
950783644 3:15414067-15414089 GTTTTCTCCAAGTTTGCTGCTGG + Exonic
951777517 3:26325934-26325956 CTTCTCCCCAAGTTAGCTCCAGG - Intergenic
951883215 3:27499558-27499580 CTTCTCCCCCACTTGGTTGGAGG - Intergenic
953640348 3:44701214-44701236 CTCCTATCCAAACTGGCTGCAGG - Intergenic
953679077 3:45026223-45026245 ACCCTCCCCAACTTGGCTGCAGG - Exonic
955250746 3:57279659-57279681 CTGCACTCCAGCCTGGCTGCAGG + Intronic
955324571 3:58000292-58000314 CTGATCTCCACCTTGGCTGCTGG + Intergenic
956177112 3:66483521-66483543 CTTTTCTCCCTCTTTGCTGCTGG - Intronic
961351175 3:126305076-126305098 CTTTTCTCCATCTTGGTGGCTGG + Intergenic
962232398 3:133676910-133676932 CTTCCCTCCTTCTTGGCTGCTGG + Intergenic
962968242 3:140373957-140373979 CTTCTCTCCATCTTCTCTGCAGG + Intronic
966867598 3:184268355-184268377 CTGCACTCCAACTTGGGTGATGG - Intronic
967076585 3:186008819-186008841 CTGCTCTCCAACTTCCCTACAGG - Intergenic
967218291 3:187228454-187228476 CTTCTCTCCAACTTCCCTTCAGG + Intronic
973856897 4:55020431-55020453 CCAGTCTCCAACTTGGCTGGTGG + Intergenic
974194067 4:58548097-58548119 CTTATCTTCATCTTGGCTTCTGG + Intergenic
976241342 4:82960468-82960490 CTTCACTCCAACCTGGGTGATGG - Intronic
977713927 4:100159681-100159703 CTTCTCTCCAACATGGAATCTGG + Intergenic
978248685 4:106604801-106604823 CTCCTCTCCAACTTGGAAGGTGG + Intergenic
981922808 4:150104349-150104371 CTGCACTCCAACCTGGGTGCTGG + Intronic
982055046 4:151540310-151540332 CCTCTTCCCAAGTTGGCTGCAGG - Intronic
983011109 4:162548910-162548932 CTTCTCTCTCACTTGTCAGCTGG + Intergenic
988509018 5:31849805-31849827 CTGCCCTCCAACTTGGGTGATGG + Intronic
988622472 5:32837051-32837073 CTTCTCCCCTACTTGGCTTAAGG - Intergenic
989775265 5:45198950-45198972 CTGCTCTCCAGCTTGGCGACGGG + Intergenic
989780008 5:45253615-45253637 CTTCTCTCGCACTAGGCTTCAGG + Intergenic
991230557 5:64328571-64328593 CTTTTCTCTAACTTGTATGCTGG + Intronic
991459994 5:66847782-66847804 CTACTCTCCAGCCTGGGTGCTGG + Intronic
992773176 5:80068323-80068345 TTTCTCTCCCTCTTGGCTGGGGG + Intronic
993246324 5:85458236-85458258 GTCCTCTCCAACTTGAGTGCTGG + Intergenic
993413574 5:87600387-87600409 CTCCTCTCCCACTTGACTGCTGG + Intergenic
993450921 5:88070929-88070951 TTCCTCTCCATCTTGACTGCTGG - Intergenic
997281840 5:132653915-132653937 CCTCTCTCCACCCTTGCTGCTGG + Intergenic
1000182448 5:158824647-158824669 CTTTTCTCCAAGTTGGCTGAAGG + Intronic
1001087383 5:168710684-168710706 ATTCTCTCCAAGTTCCCTGCTGG - Intronic
1001799996 5:174534728-174534750 CTTGTCTCACACTTGGCTTCTGG + Intergenic
1001973372 5:175975662-175975684 CTGCACTCCAACTTGGATGATGG + Intronic
1002244065 5:177868121-177868143 CTGCACTCCAACTTGGATGATGG - Intergenic
1003143644 6:3492054-3492076 CTTCTCACAAATTTGGCAGCTGG + Intergenic
1005230084 6:23689828-23689850 TTTCTCTCCTACTTGGTTGAAGG + Intergenic
1009584488 6:65581146-65581168 CTTCTTTGCAACTTTGCTGTGGG + Intronic
1009946372 6:70346603-70346625 CTCCTCTCCCACTTGAGTGCTGG + Intergenic
1011055566 6:83199949-83199971 CTTCTACAAAACTTGGCTGCAGG + Intergenic
1014605384 6:123467450-123467472 CTGCTCTCTAACATGGCTGATGG + Intronic
1015701968 6:136046476-136046498 CTCCTCTCCAAGTTGGCATCTGG + Intronic
1017762717 6:157583697-157583719 CTCCTCTCCCACTTAGGTGCTGG + Intronic
1018147015 6:160900765-160900787 CTCCTCTCCCACTTGAGTGCTGG - Intergenic
1018708277 6:166478672-166478694 TTTCTCTGCCACTTGGCTGTGGG - Intronic
1019574094 7:1727962-1727984 CTTCTCTCCACCCTGTGTGCAGG + Intronic
1021289943 7:18830713-18830735 CTTCTCTCCAAAGTGCTTGCAGG - Intronic
1021793246 7:24227483-24227505 CTTATCTCCAGCTTGGGTTCTGG + Intergenic
1022247798 7:28577282-28577304 CTTCTGCCAAACTTGGCTCCTGG - Intronic
1022381676 7:29866369-29866391 CTTGTCTCCCTATTGGCTGCAGG - Intronic
1026865529 7:73821885-73821907 CTTCTCTCCAACTGAGCAGGGGG - Intronic
1028135892 7:87222501-87222523 CTTCTATCCCACTTGGCTAAAGG - Intergenic
1031039668 7:116826508-116826530 TTTCTCTCCCACTTGATTGCTGG + Intronic
1031912025 7:127527600-127527622 CCTCTCCCCAACTTAGCTCCAGG - Intergenic
1033650448 7:143338748-143338770 CTGCACTCCAGCTTGGGTGCTGG + Intronic
1035286706 7:157811426-157811448 CTCCTCTCCATCGTGGCTGTTGG + Intronic
1035942045 8:3912381-3912403 CTTCTAGCCAATTTGGGTGCAGG + Intronic
1036610547 8:10346349-10346371 GTCCTCTCTAACATGGCTGCTGG + Intronic
1038220879 8:25606430-25606452 CTTCTTGCCAACTTGTGTGCAGG - Intergenic
1038716065 8:29992370-29992392 CTTCACTCCAACTGGGGTGATGG - Intergenic
1039899773 8:41743147-41743169 CTTCTCTCCTACTCTGCTGCAGG - Intronic
1040462420 8:47661679-47661701 CTGCTCCTCAACTTGGGTGCTGG + Intronic
1041465246 8:58151844-58151866 CTTGTCTTCAACTGGGCTGTAGG - Intronic
1043727429 8:83628917-83628939 CTTCTGTCCAACTTAAGTGCAGG + Intergenic
1046479022 8:114789817-114789839 CTTCTTTTTAACATGGCTGCAGG - Intergenic
1047148886 8:122238312-122238334 AATCTCTCCAACTTTGTTGCTGG - Intergenic
1047711053 8:127552902-127552924 CTTCTTTCCAGCCTGGCTCCAGG - Intergenic
1049160357 8:141093854-141093876 GTTCTCTGCAAATTGGCAGCTGG - Intergenic
1049519458 8:143080637-143080659 CTTCTCTCCTGCCGGGCTGCAGG - Exonic
1050778788 9:9303989-9304011 CTACTCTCCAACTGGGCTCAAGG + Intronic
1051726322 9:20090406-20090428 CTCCTCTCCCACTTGAGTGCTGG - Intergenic
1053447763 9:38166112-38166134 GCTCTCTCAAACTTGGCTGTGGG + Intergenic
1055801957 9:80047562-80047584 CTTCACTCCAACCTGGGTGACGG + Intergenic
1056328960 9:85505852-85505874 CTCCTCTCCATCATGGCTGAGGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1059779002 9:117507442-117507464 CTCCTCTCCTGCTTGACTGCTGG + Intergenic
1060881681 9:127122317-127122339 CTTCCCTCCTGCTTGGCTCCGGG + Exonic
1061291880 9:129655052-129655074 CTGCTCTCCAAATTGTCTCCTGG - Intergenic
1061317516 9:129805588-129805610 CTTCTCACCAACTGCACTGCTGG - Intronic
1061542357 9:131284323-131284345 CTTCTCTCTCACTTGACAGCAGG - Intergenic
1062170709 9:135133285-135133307 CTTCTCTCCAGCTCGCCTGATGG - Intergenic
1062379209 9:136278749-136278771 CTGCTGTCCAACATGGCGGCTGG + Intergenic
1062424572 9:136500181-136500203 CCTCCCTCAACCTTGGCTGCCGG - Intronic
1186641656 X:11462001-11462023 CTTCTCTGCAAGTTGGCAGCTGG - Intronic
1186785329 X:12951626-12951648 CTTCTCTCAAACTTGGGAGTGGG + Intergenic
1188559369 X:31450636-31450658 CTTCTCTTAAACCTGGCTGAAGG - Intronic
1188592757 X:31859214-31859236 CTCCTCTCCAAAATGGCAGCTGG - Intronic
1188941373 X:36241676-36241698 CTCCTCTTCAACTTGAGTGCTGG - Intronic
1190620891 X:52285550-52285572 CTTCTCTCTCACTTGGCTCCTGG - Intergenic
1191019054 X:55841114-55841136 CTTCTCTCCCACCTGATTGCTGG + Intergenic
1193496330 X:82218626-82218648 CTTCTCTCTCACTTGAATGCTGG + Intergenic
1193583793 X:83295487-83295509 CTCCTCTCCCACTTGAGTGCTGG - Intergenic
1193752666 X:85365672-85365694 CTCCTCTCCCACTTGAGTGCTGG + Intronic
1194284553 X:91993798-91993820 CTTCCCTTCTCCTTGGCTGCAGG + Intronic
1194804237 X:98307485-98307507 CTCATCTCCAAGTTGGCTCCTGG + Intergenic
1195208052 X:102624338-102624360 CTCCTCTCCCACTTGAGTGCTGG + Intergenic
1195295369 X:103471261-103471283 CTTCTTTCCATATTGGCTACTGG + Intergenic
1196245027 X:113390827-113390849 CTCCTCTCCCACTTGAGTGCTGG + Intergenic
1197652759 X:129083810-129083832 CTTTTCTACAACTGGGCTGTGGG + Intergenic
1197913679 X:131513165-131513187 CTCCTCTCCCACTTGAGTGCTGG + Intergenic
1199182351 X:144873284-144873306 CTCCTCTCCCACTTGAATGCTGG + Intergenic
1200360867 X:155604635-155604657 CTCCTCTCCCACTTGAGTGCTGG - Intronic
1202579514 Y:26364949-26364971 CTACACACCAACTTGGCAGCAGG - Intergenic