ID: 1096043384

View in Genome Browser
Species Human (GRCh38)
Location 12:48540412-48540434
Sequence CTGGTCATAAGACCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096043384_1096043388 12 Left 1096043384 12:48540412-48540434 CCCACAAAGGGTCTTATGACCAG No data
Right 1096043388 12:48540447-48540469 TTGACTTAGCAAATATGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096043384 Original CRISPR CTGGTCATAAGACCCTTTGT GGG (reversed) Intergenic
No off target data available for this crispr