ID: 1096044057

View in Genome Browser
Species Human (GRCh38)
Location 12:48546302-48546324
Sequence CTGGATCTCAGTCTTTTTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096044057_1096044061 5 Left 1096044057 12:48546302-48546324 CCATTAAAAAGACTGAGATCCAG No data
Right 1096044061 12:48546330-48546352 TGTAACAGCATGGATGGAACTGG No data
1096044057_1096044060 -1 Left 1096044057 12:48546302-48546324 CCATTAAAAAGACTGAGATCCAG No data
Right 1096044060 12:48546324-48546346 GTCATTTGTAACAGCATGGATGG No data
1096044057_1096044058 -5 Left 1096044057 12:48546302-48546324 CCATTAAAAAGACTGAGATCCAG No data
Right 1096044058 12:48546320-48546342 TCCAGTCATTTGTAACAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096044057 Original CRISPR CTGGATCTCAGTCTTTTTAA TGG (reversed) Intergenic
No off target data available for this crispr