ID: 1096044081

View in Genome Browser
Species Human (GRCh38)
Location 12:48546600-48546622
Sequence CCGTCTTGTTTCATGTCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096044081_1096044087 14 Left 1096044081 12:48546600-48546622 CCCAAGGACATGAAACAAGACGG No data
Right 1096044087 12:48546637-48546659 TTTGTTACTGATCGTTTTGCTGG No data
1096044081_1096044088 15 Left 1096044081 12:48546600-48546622 CCCAAGGACATGAAACAAGACGG No data
Right 1096044088 12:48546638-48546660 TTGTTACTGATCGTTTTGCTGGG No data
1096044081_1096044089 19 Left 1096044081 12:48546600-48546622 CCCAAGGACATGAAACAAGACGG No data
Right 1096044089 12:48546642-48546664 TACTGATCGTTTTGCTGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096044081 Original CRISPR CCGTCTTGTTTCATGTCCTT GGG (reversed) Intergenic
No off target data available for this crispr