ID: 1096044083

View in Genome Browser
Species Human (GRCh38)
Location 12:48546601-48546623
Sequence TCCGTCTTGTTTCATGTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096044083_1096044088 14 Left 1096044083 12:48546601-48546623 CCAAGGACATGAAACAAGACGGA No data
Right 1096044088 12:48546638-48546660 TTGTTACTGATCGTTTTGCTGGG No data
1096044083_1096044089 18 Left 1096044083 12:48546601-48546623 CCAAGGACATGAAACAAGACGGA No data
Right 1096044089 12:48546642-48546664 TACTGATCGTTTTGCTGGGCTGG No data
1096044083_1096044087 13 Left 1096044083 12:48546601-48546623 CCAAGGACATGAAACAAGACGGA No data
Right 1096044087 12:48546637-48546659 TTTGTTACTGATCGTTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096044083 Original CRISPR TCCGTCTTGTTTCATGTCCT TGG (reversed) Intergenic
No off target data available for this crispr