ID: 1096044087

View in Genome Browser
Species Human (GRCh38)
Location 12:48546637-48546659
Sequence TTTGTTACTGATCGTTTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096044083_1096044087 13 Left 1096044083 12:48546601-48546623 CCAAGGACATGAAACAAGACGGA No data
Right 1096044087 12:48546637-48546659 TTTGTTACTGATCGTTTTGCTGG No data
1096044081_1096044087 14 Left 1096044081 12:48546600-48546622 CCCAAGGACATGAAACAAGACGG No data
Right 1096044087 12:48546637-48546659 TTTGTTACTGATCGTTTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096044087 Original CRISPR TTTGTTACTGATCGTTTTGC TGG Intergenic
No off target data available for this crispr