ID: 1096046663

View in Genome Browser
Species Human (GRCh38)
Location 12:48568466-48568488
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3526
Summary {0: 1, 1: 0, 2: 22, 3: 348, 4: 3155}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096046651_1096046663 15 Left 1096046651 12:48568428-48568450 CCAAGAGATAGGGTAAGAGGAAA 0: 1
1: 0
2: 4
3: 61
4: 468
Right 1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG 0: 1
1: 0
2: 22
3: 348
4: 3155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr