ID: 1096057087

View in Genome Browser
Species Human (GRCh38)
Location 12:48662688-48662710
Sequence TAGGCAACTATGGAGTGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096057087 Original CRISPR TAGGCAACTATGGAGTGGAA AGG Intronic
901172183 1:7267088-7267110 TCTTCATCTATGGAGTGGAAAGG + Intronic
903591363 1:24458316-24458338 TAAGCAACTATGCAGAGAAAGGG + Intronic
906478801 1:46187153-46187175 TAGGAAACTAGGGATCGGAAAGG + Intergenic
907266537 1:53265013-53265035 GTGGCATCTATGGAGTGGATGGG + Intronic
908235304 1:62142320-62142342 AAGGCAGTTATGGAATGGAATGG - Intronic
914410124 1:147419427-147419449 TAGGCTCCTAATGAGTGGAAAGG + Intergenic
916638861 1:166704635-166704657 TAGGTATATATGGGGTGGAAAGG + Intergenic
917174119 1:172212971-172212993 AAGGAAACTAAGGACTGGAAAGG + Intronic
917884331 1:179368331-179368353 GAGGCATTTATAGAGTGGAAAGG - Intronic
917997958 1:180460638-180460660 GAGGCAACTACGGACTGGAGTGG + Intronic
918526023 1:185465982-185466004 TAGGCAATTATGCCCTGGAAAGG + Intergenic
918962128 1:191293894-191293916 AAGGAAAAAATGGAGTGGAATGG + Intergenic
919370049 1:196711922-196711944 GAAGAAACTATGGAGTGAAAGGG - Intronic
919383152 1:196883298-196883320 GAAGAAACTATGGAGTGAAAGGG - Intronic
920447958 1:206034240-206034262 GAGGCAACTAGGGAGTAGGATGG - Intergenic
1063398270 10:5714482-5714504 TTGGCAACTATGGAATGTGAGGG + Intronic
1063669154 10:8085843-8085865 TAGGCACTTATGTTGTGGAATGG + Intergenic
1064285986 10:13991505-13991527 CAGGACACAATGGAGTGGAATGG + Intronic
1068848272 10:61705717-61705739 TAGGCAAACATGTAGTGCAAAGG + Intronic
1068867602 10:61911069-61911091 AACTCAACTATGGGGTGGAAGGG - Intronic
1069205299 10:65675330-65675352 TAGGTAACAAGGGAGTGTAAAGG + Intergenic
1071974364 10:90940074-90940096 TAGGCAGCAAGGGAGGGGAAGGG + Intergenic
1073509694 10:104035239-104035261 TAGGGCACTGTGGAGTGGGATGG - Intronic
1074193467 10:111158343-111158365 AAGGCAAATATGGTGTAGAATGG + Intergenic
1076606392 10:131692340-131692362 CTGGCAACCCTGGAGTGGAAGGG - Intergenic
1078033800 11:7781251-7781273 TAGGCAACTAGGGGCTGGAGTGG + Intergenic
1079437615 11:20473954-20473976 GAGGCAACTAGGGTCTGGAATGG - Intronic
1083448274 11:62725636-62725658 TAGGCCACTATGGAGAGTCATGG - Intronic
1083691193 11:64409856-64409878 TAGGCCAGGATGGAGAGGAAGGG - Intergenic
1091856016 12:3741004-3741026 GAGGCAACCATGGAGAAGAAAGG - Intronic
1094852031 12:34386633-34386655 GAGGCACCTGTGGTGTGGAAGGG - Intergenic
1095329027 12:40934993-40935015 TAGAAAAGTATGGAGTTGAAAGG - Intronic
1096057087 12:48662688-48662710 TAGGCAACTATGGAGTGGAAAGG + Intronic
1096792907 12:54056085-54056107 TAGGCAACTATAGAGAAGATGGG - Intergenic
1097800675 12:63910682-63910704 AAGGCAAATATGGAGTAGAGAGG + Intronic
1100133935 12:91531092-91531114 CAGGAAAGTATTGAGTGGAATGG + Intergenic
1100352496 12:93797841-93797863 CAGGCAAGTATGGCGTAGAAAGG + Intronic
1101821516 12:108187899-108187921 TGGGCCACTATGGACAGGAATGG - Intronic
1105720578 13:23109874-23109896 TAGAGAACCATGGAGTGCAAAGG + Intergenic
1105904485 13:24792870-24792892 TAGAAAAATATGGAGTAGAATGG + Intronic
1106008019 13:25789516-25789538 TAGGTAACTAGGGAGGTGAAAGG + Intronic
1109938502 13:69327099-69327121 AAGGCAACTATGAAAGGGAAGGG + Intergenic
1110764441 13:79266654-79266676 TAGGTAAGTAGGGAATGGAAAGG + Intergenic
1112363556 13:98738751-98738773 TAGGGCAGTATGGAGGGGAAAGG + Intronic
1115015051 14:28600977-28600999 TAAGCAACTTTGGAAAGGAATGG - Intergenic
1115195210 14:30791133-30791155 AAGGCAACTAGTGACTGGAAGGG + Intergenic
1116027903 14:39536925-39536947 GAGGCAACTAAGGACTGGAGGGG + Intergenic
1118744006 14:68761240-68761262 TCAGTAACTATTGAGTGGAATGG + Intergenic
1119130161 14:72164617-72164639 CAGACAACTATGAAGTGGCAGGG + Intronic
1202873875 14_GL000225v1_random:190539-190561 TAAACACCAATGGAGTGGAATGG + Intergenic
1125242607 15:37593321-37593343 TGGGCAACTGGGGAGTGAAAAGG - Intergenic
1130260750 15:82352647-82352669 TGGACAACTATGGAGAGGACTGG - Intergenic
1130280487 15:82516360-82516382 TGGACAACTATGGAGAGGACTGG + Intergenic
1130471858 15:84232543-84232565 TGGACAACTATGGAGAGGACTGG + Intergenic
1130479352 15:84347114-84347136 TGGACAACTATGGAGAGGACTGG + Intergenic
1130492418 15:84441015-84441037 TGGACAACTATGGAGAGGACTGG - Intergenic
1130594156 15:85237180-85237202 TGGACAACTATGGAGAGGACTGG + Intergenic
1131319797 15:91376403-91376425 TAGGCATCCATGGAGTCGCAGGG - Intergenic
1133399271 16:5472840-5472862 TAGGTAACTTTGGCGTAGAAGGG + Intergenic
1134217675 16:12328801-12328823 TAGGCAAAGATGGAGTTGATTGG + Intronic
1138067283 16:53955406-53955428 TAGGCAATTGGGGAGGGGAATGG + Intronic
1139363189 16:66416220-66416242 CAGGCAACTAGGGAGGGGACTGG - Intergenic
1139642230 16:68300340-68300362 AAGGCAGCTATGGTTTGGAAAGG + Exonic
1143979503 17:10856236-10856258 AATGAAACTTTGGAGTGGAAAGG + Intergenic
1144100478 17:11938074-11938096 AAGGGAATTATGGAGTAGAAAGG + Intronic
1147454027 17:40523661-40523683 TAGTCTAGTATGGAGTGGGAAGG + Intergenic
1148775732 17:50094965-50094987 TAGACAACTCTGGAAAGGAAGGG + Intronic
1148824097 17:50379418-50379440 AAAGCAACGATGGACTGGAAGGG - Intronic
1149523182 17:57334011-57334033 GAGACAACAATGGAGTGAAACGG - Intronic
1150328391 17:64274916-64274938 TGGGCAAGTCTGGAGTGTAAGGG - Intergenic
1150471865 17:65444277-65444299 AAAGCAAATATGGAGTGAAATGG - Intergenic
1155543699 18:26892244-26892266 TGGACAGCCATGGAGTGGAATGG + Intergenic
1155707141 18:28830351-28830373 TAAGTAACAATGCAGTGGAAAGG + Intergenic
1155981549 18:32185384-32185406 CAGCCAACTAAGGGGTGGAAGGG - Intronic
1161345910 19:3768610-3768632 TAGGGGACTCTGGAGTGGAGGGG + Intergenic
1164645766 19:29858051-29858073 TCGGCAACTTTGGAGTGGCCAGG + Intergenic
1165587990 19:36937955-36937977 TATGCAACTGTGGAAAGGAAGGG - Intronic
1167888902 19:52524153-52524175 TAGCCCACGCTGGAGTGGAATGG + Intergenic
1167915719 19:52738696-52738718 TAGCCCACGCTGGAGTGGAATGG - Intergenic
931327041 2:61237369-61237391 TAGGCCATTATGGGGTTGAAGGG - Intronic
932390670 2:71388245-71388267 TAGGTAACAAAGGAGTGTAAAGG + Intronic
932391591 2:71395502-71395524 TAGGTAACAAAGGAGTGTAAAGG + Intronic
935834635 2:107037160-107037182 GAGGCAACTAGGGACTGGAGTGG + Intergenic
939352412 2:141056798-141056820 TATACAACTCTGGAGTTGAAGGG - Intronic
942141115 2:172978314-172978336 TTGGCAACTAGTGAGAGGAAAGG - Intronic
942202504 2:173585508-173585530 TAACCATCTAAGGAGTGGAAAGG + Intergenic
943606203 2:189979925-189979947 TTGGCAAGTATGCAGTGAAAAGG + Intronic
946538084 2:220653068-220653090 TAGGCAATTATGGAGCTGGATGG - Intergenic
947965966 2:234281766-234281788 GAGGCAAGTATGGAGTTCAAGGG + Intergenic
1172106696 20:32521477-32521499 CAGGCAACTATGGCTTGGAGAGG + Intronic
1173272209 20:41547563-41547585 AAGGCAACTAGTGACTGGAAGGG + Intronic
1173895958 20:46550910-46550932 CACACAACTATGGAGTGGGAGGG - Intergenic
1175290650 20:57872983-57873005 TAGCCAACAATGGAAAGGAAGGG + Intergenic
1176749145 21:10677111-10677133 TGGACAAGTATGGAATGGAATGG - Intergenic
1177495630 21:21887147-21887169 AAGGTTACTATGCAGTGGAATGG + Intergenic
1203301266 22_KI270736v1_random:78764-78786 TAGACAGCCATGGAATGGAATGG + Intergenic
949703036 3:6780997-6781019 CAGGAAACTAAGGATTGGAAAGG + Intronic
949851458 3:8424984-8425006 TAGGCAAGAGTGGAGTGGAAGGG + Intergenic
949851471 3:8425068-8425090 TAGGCAAGAGTGGAGTGGAAGGG + Intergenic
951168779 3:19513408-19513430 TAGGAATCTGTGGAGTAGAAAGG - Intronic
951408043 3:22325716-22325738 TTGGCCACTCTGGAGTGCAATGG - Intronic
952324356 3:32307538-32307560 TAGGAGACTGTGGAGTGGCAAGG + Intronic
960127818 3:114019639-114019661 TAGGAAACTATGAAATGGCATGG - Intronic
961239886 3:125401476-125401498 TAGGCAATTATGCAGTTGGAAGG - Intergenic
962684391 3:137833065-137833087 GAGACAACTATGGGGTGGAAAGG - Intergenic
963438200 3:145299838-145299860 TAGGCATCTGTTGAGTGGAAGGG + Intergenic
964440241 3:156701119-156701141 TAAGCATCTATGGGTTGGAATGG + Intronic
966002010 3:174960995-174961017 TAGCCCACTCTGGAGTGGAATGG - Intronic
967112752 3:186309240-186309262 AAGGCAGATATGAAGTGGAAAGG + Intronic
971026332 4:22592096-22592118 TGGCCAGCCATGGAGTGGAATGG + Intergenic
974199842 4:58623446-58623468 AAGGCAACTAGTGACTGGAATGG + Intergenic
975022087 4:69502521-69502543 GAGGCAACTAGGGACTGGAGTGG + Intronic
975297691 4:72752255-72752277 GAGGCAACTAGGGTCTGGAATGG + Intergenic
975449842 4:74511534-74511556 TATGTAACTATGGAGGTGAAGGG + Intergenic
976075525 4:81295148-81295170 TATACACCTATGGAGTGGGATGG + Intergenic
976831718 4:89322575-89322597 AAGGCAATTATAGATTGGAATGG - Intergenic
977079164 4:92501228-92501250 TAGCCAACTATTGTGTGGCAAGG + Intronic
980925466 4:139132736-139132758 TAGGTAAATATGTAATGGAACGG - Intronic
981489629 4:145325797-145325819 CAGGCAGCTTTGCAGTGGAAGGG + Intergenic
981582449 4:146263224-146263246 TAGGTAAGCATGGAGTGGAAAGG - Intronic
982420648 4:155192965-155192987 TAGGCAAGAATGGAGTAGTAAGG + Intergenic
983409136 4:167374284-167374306 TTGGCCAATATGGAGTGGCAAGG - Intergenic
985824834 5:2184529-2184551 TAGGAAAATATCGAATGGAAAGG + Intergenic
986116847 5:4783706-4783728 TAGGACACTATGGGTTGGAAAGG + Intergenic
986948485 5:13052897-13052919 TAGGCAACTAGAGAGGGTAAAGG + Intergenic
987251331 5:16104197-16104219 TAGGGAATTATAGAGCGGAAAGG - Intronic
988843174 5:35102949-35102971 GAAGCAACAATAGAGTGGAAGGG - Intronic
989041777 5:37236917-37236939 TTGGCAAGTATGCAGAGGAAAGG + Intronic
989119220 5:37987310-37987332 TAGGCAGATATGAAGAGGAAGGG + Intergenic
990832219 5:59972075-59972097 TATGCCACTATCGAGTGGAAGGG - Intronic
991310884 5:65240428-65240450 GAGGCAACTATTGACTGCAAAGG + Intronic
995428634 5:112050376-112050398 AAGGCAACTACGGACTGGAGTGG + Intergenic
995438516 5:112164011-112164033 AAGTCATCTATGGAGAGGAAAGG + Exonic
995495206 5:112734748-112734770 TAGGTAAAAATGGAATGGAAAGG + Intronic
996483719 5:124005270-124005292 AAGGCAACTATGGAATCAAATGG + Intergenic
997790985 5:136762021-136762043 TAGGAAATTATTGAGTGAAAAGG - Intergenic
999280567 5:150362637-150362659 AAGGCAAAAATGGTGTGGAAGGG + Intronic
999686705 5:154109610-154109632 TAGGGAAATAGGGAGTGGTAGGG - Intronic
1000939653 5:167345084-167345106 TAGGCAAATGTGGAGAGTAAGGG - Intronic
1001759233 5:174193866-174193888 TAGGGAAACATGGACTGGAAGGG + Intronic
1002455472 5:179343879-179343901 GGGGCCACTATGGAGTGGCAGGG - Exonic
1003421219 6:5960180-5960202 GATACAGCTATGGAGTGGAAAGG - Intergenic
1004720032 6:18261020-18261042 TAGGGCAGTGTGGAGTGGAAAGG + Intronic
1007660463 6:43482217-43482239 TAGTAAACTATGGAGTTGCAAGG + Intronic
1012329489 6:97966689-97966711 TAGGCAAAGATGGAGGAGAAAGG + Intergenic
1017036994 6:150275749-150275771 TAGGCATCGATGAAGTTGAAAGG - Intergenic
1020520223 7:9175947-9175969 TAGGCAACTATGCAAAGCAAAGG + Intergenic
1023675841 7:42629051-42629073 GAGGCAGCTGTGGAGTGGGAAGG - Intergenic
1027879923 7:83821720-83821742 CAGGCAAAGATGGAGTGGGAAGG + Intergenic
1028082892 7:86599903-86599925 GAGGCAACTACGAACTGGAATGG + Intergenic
1029311366 7:99668538-99668560 TAGACAACAATGGAATGGAAAGG + Intronic
1029793578 7:102870993-102871015 TAGTCAAGTGTGGAGTGTAATGG - Intronic
1030594791 7:111525049-111525071 CAGTCAACTATGGAGTGATAAGG + Intronic
1030696328 7:112588754-112588776 TAGGCAACTAGGGTCTGGAGCGG + Intergenic
1033285405 7:140037001-140037023 TAGGCGACTTTGGAGTTGATGGG - Intronic
1033499206 7:141930627-141930649 GAGGCCACTATGGTCTGGAAAGG - Intronic
1039102690 8:33957888-33957910 GAGGCAACTAGGGACTGGAGTGG - Intergenic
1039905400 8:41782455-41782477 GAGGAAACTGGGGAGTGGAATGG - Intronic
1042684332 8:71421305-71421327 TAGAGAACTATGGAGATGAAAGG + Intronic
1043727527 8:83629528-83629550 GAGGCAACTATGGATTGGAGTGG - Intergenic
1043884316 8:85580983-85581005 TAGGCAAACATGGTGTGGAGTGG + Intergenic
1044018266 8:87073587-87073609 AAGGCAACTATGGTCTGGAGTGG - Intronic
1044479440 8:92668175-92668197 TAGGCAAGGATGGAGAGGAGGGG + Intergenic
1046569125 8:115940397-115940419 TAGACAACAATGGAGGGTAAGGG - Intergenic
1047351866 8:124081759-124081781 AAAGCAACAATGGAGGGGAAGGG + Intronic
1057104170 9:92395518-92395540 TAAGTACCTAAGGAGTGGAATGG + Intronic
1059957971 9:119537875-119537897 TAGGCAGTTATGGATTTGAAGGG - Intergenic
1060106298 9:120875692-120875714 TAGGCACCTAGGGTGGGGAACGG + Intronic
1203725014 Un_GL000216v2:42535-42557 TGGGCACATATGGAATGGAATGG - Intergenic
1186140067 X:6562405-6562427 TCAGCAACTGGGGAGTGGAATGG - Intergenic
1191988836 X:67010317-67010339 AAGGCTACTAGGGAATGGAATGG + Intergenic
1193711999 X:84892362-84892384 GAGGCAACTAAGGACTGGAGTGG - Intergenic
1195629591 X:107041040-107041062 TAGGTACCTAAGGGGTGGAATGG - Intergenic
1199320699 X:146434945-146434967 TAGGCAGCAATGGAATTGAAGGG - Intergenic
1199839848 X:151633951-151633973 TGGGCAACTATATTGTGGAATGG - Intronic
1201097400 Y:10631890-10631912 TAGGACACAATGGCGTGGAAAGG - Intergenic
1201106649 Y:10768370-10768392 TGGGAAAGAATGGAGTGGAATGG - Intergenic
1201109078 Y:10785700-10785722 TAGAATATTATGGAGTGGAATGG - Intergenic
1201110474 Y:10795688-10795710 TTGGATACAATGGAGTGGAATGG - Intergenic
1201114407 Y:10824461-10824483 TGGAGAACAATGGAGTGGAATGG - Intergenic
1201196165 Y:11496580-11496602 TGGATAAATATGGAGTGGAATGG + Intergenic