ID: 1096058357

View in Genome Browser
Species Human (GRCh38)
Location 12:48674680-48674702
Sequence GTGCACAAGGCCAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 913
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 845}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1096058351_1096058357 -3 Left 1096058351 12:48674660-48674682 CCAGCAAAGGGCCAGGTGTGGTG 0: 1
1: 3
2: 18
3: 138
4: 691
Right 1096058357 12:48674680-48674702 GTGCACAAGGCCAAGGTGGGTGG 0: 1
1: 0
2: 2
3: 65
4: 845

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1096058357 Original CRISPR GTGCACAAGGCCAAGGTGGG TGG Intronic
900350899 1:2234084-2234106 GTGCAGAAGGCCAGGGTCTGCGG + Intronic
900418094 1:2544156-2544178 GTGCACACGGCCCAGTGGGGAGG + Intergenic
900524726 1:3122992-3123014 GTGCAAGGGGCCAAGGTGGGTGG + Intronic
900643593 1:3698697-3698719 TTGCACCAGGCCACAGTGGGCGG + Intronic
900910506 1:5594014-5594036 GTGCACAAGGCCCAGCTTGGAGG + Intergenic
901375561 1:8835889-8835911 GTTCAGGAGGCCGAGGTGGGTGG - Intergenic
901421131 1:9151873-9151895 ATGCAGGAGGCCGAGGTGGGAGG + Intergenic
901540791 1:9914149-9914171 GTTCAGGAGGCCGAGGTGGGTGG - Intergenic
901849292 1:12005368-12005390 GTTCACAAGGCCAGGGCCGGTGG - Intronic
901948425 1:12722081-12722103 CAGCACGAGGCCAAGGTGGGTGG + Intronic
902422148 1:16289293-16289315 ATGCAGGAGGCCGAGGTGGGAGG + Intronic
903085543 1:20854448-20854470 ACGCAGGAGGCCAAGGTGGGAGG + Intronic
903118835 1:21200524-21200546 CTTCAGAAGGCCAAGGTGGGTGG + Intergenic
903347576 1:22697183-22697205 GTGGTGGAGGCCAAGGTGGGTGG - Intergenic
903416185 1:23184813-23184835 GTGCAGAAATCAAAGGTGGGTGG - Intergenic
903472206 1:23595107-23595129 GTGCATAAGGGCAGGGTTGGGGG - Intronic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
903730223 1:25488292-25488314 ACTCCCAAGGCCAAGGTGGGAGG - Intronic
903764724 1:25726810-25726832 CTGCGGGAGGCCAAGGTGGGAGG + Intronic
903997608 1:27317399-27317421 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
904080123 1:27867021-27867043 ATGCACCAGGCTTAGGTGGGAGG + Intergenic
904272099 1:29356812-29356834 GTGCGCAGGGCGAGGGTGGGCGG + Intergenic
904493695 1:30875321-30875343 GTGCACAGGGCCCAGGTTGCTGG - Intronic
904790013 1:33012651-33012673 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
904962791 1:34347842-34347864 GTGGGCAAGGCCATGGGGGGGGG + Intergenic
904999216 1:34655175-34655197 GGGCCCAAGCTCAAGGTGGGAGG + Intergenic
905312842 1:37062448-37062470 ATGAACCAGGCCAGGGTGGGTGG - Intergenic
905371793 1:37486376-37486398 GAGCCCAAGGGCAAGGTTGGGGG - Intergenic
905561744 1:38932701-38932723 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
905716209 1:40152335-40152357 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
905718369 1:40173756-40173778 CTTCGGAAGGCCAAGGTGGGCGG - Intronic
906637222 1:47417353-47417375 GTGCTCCAAGCCAGGGTGGGGGG - Exonic
906966213 1:50459215-50459237 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
907568276 1:55457701-55457723 GTGCAAAATGCCAGGTTGGGTGG + Intergenic
908191031 1:61703997-61704019 GTTGAGGAGGCCAAGGTGGGTGG - Intronic
908197118 1:61756034-61756056 GTTTGGAAGGCCAAGGTGGGTGG - Intronic
909070176 1:70984469-70984491 CTCTGCAAGGCCAAGGTGGGAGG + Intronic
909119445 1:71582771-71582793 GTGCAAATGGCCAATTTGGGAGG - Intronic
909375722 1:74939524-74939546 ACCCAGAAGGCCAAGGTGGGAGG + Intergenic
909385120 1:75046072-75046094 GCTCAAAAGGCTAAGGTGGGAGG + Intergenic
910970347 1:92849897-92849919 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
911739263 1:101369433-101369455 GAGGCCAAGGCCAAGGCGGGAGG - Intergenic
912326422 1:108767622-108767644 CTGCACATGCGCAAGGTGGGCGG + Intronic
912432826 1:109638427-109638449 GTGCGCAGGCCCAAGGTGGTAGG - Intergenic
912856706 1:113175587-113175609 TTTCAGGAGGCCAAGGTGGGAGG + Intergenic
913294163 1:117302779-117302801 ATGCACAAGGCAATGGTGAGTGG - Intergenic
913587026 1:120285651-120285673 CTTCGCAAGGCCAAGGTGGGAGG + Intergenic
913621159 1:120612719-120612741 CTTCGCAAGGCCAAGGTGGGAGG - Intergenic
914002555 1:143704370-143704392 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
914569040 1:148897536-148897558 CTTCGCAAGGCCAAGGTGGGAGG + Intronic
914603787 1:149232720-149232742 CTTCGCAAGGCCAAGGTGGGAGG - Intergenic
914923501 1:151863801-151863823 GGCCAGGAGGCCAAGGTGGGAGG - Intergenic
915288865 1:154869659-154869681 GTGCAGCAGGCCAGGGTGGACGG + Exonic
915308638 1:154995542-154995564 TGGGACAAGGCCGAGGTGGGTGG + Intergenic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
915387719 1:155511745-155511767 GTTTAGGAGGCCAAGGTGGGTGG - Intronic
915527661 1:156486089-156486111 GAGCACGAGGTCGAGGTGGGTGG - Intronic
915931147 1:160061741-160061763 GTGCAAAAGGGAAAGGGGGGTGG + Intronic
916013826 1:160730544-160730566 ATCCACGAGGCTAAGGTGGGAGG + Intergenic
916555165 1:165888530-165888552 GTTTAAGAGGCCAAGGTGGGTGG - Intronic
916701248 1:167297874-167297896 GAGCAAGAGGCCAAGGTGGGTGG + Intronic
916806124 1:168263094-168263116 CTTCAGAAGGCCAAGGCGGGAGG - Intergenic
917236682 1:172900224-172900246 CTGCTGAAGGCCGAGGTGGGTGG - Intergenic
917594787 1:176518061-176518083 TTGAAACAGGCCAAGGTGGGAGG + Intronic
918047505 1:180950423-180950445 GTGAACGGGGCCAAGGTGGCAGG + Exonic
918096686 1:181341902-181341924 GTGAACAAGATAAAGGTGGGAGG + Intergenic
918200873 1:182265660-182265682 GCTCAGCAGGCCAAGGTGGGAGG + Intergenic
918456911 1:184730336-184730358 CTTCAGAAGGCCAAGGTGGGAGG + Intronic
919725071 1:200876631-200876653 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
920024540 1:202984244-202984266 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
920382328 1:205542479-205542501 GAGCAGCATGCCAAGGTGGGCGG - Intergenic
921055558 1:211540043-211540065 GTTTAGGAGGCCAAGGTGGGTGG - Intergenic
921443848 1:215221130-215221152 GAGGCCAAGGCCAAGGTGGGTGG + Intronic
921665110 1:217859648-217859670 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
921858690 1:220016660-220016682 GTTCAGAAGGCCAAGGTAGGAGG - Intronic
921894762 1:220388526-220388548 TTGCACAAGGCCAGAGTGTGTGG + Intergenic
922504441 1:226118509-226118531 GAGCAGCAGGCCAAGGTGGGAGG - Intergenic
922523946 1:226283062-226283084 ACTCACAAGACCAAGGTGGGAGG - Intronic
922740759 1:228013154-228013176 ACTCACAAGGCCAAGATGGGAGG - Intronic
923018556 1:230145647-230145669 TGGCACTATGCCAAGGTGGGTGG - Intronic
923280577 1:232439293-232439315 GTGCACAGGGCCGAGGATGGTGG + Exonic
923727968 1:236523795-236523817 GTGCAGGAGGCCGAGCTGGGTGG + Intronic
924036020 1:239938751-239938773 CTTCGGAAGGCCAAGGTGGGCGG + Intergenic
924223707 1:241903537-241903559 GCGCACGAGGCTGAGGTGGGAGG + Intergenic
924832744 1:247614955-247614977 GTGCCCAAGGCCATGGTGGACGG + Intergenic
1062911750 10:1216261-1216283 GGGCATCAGGCCAAGGTAGGGGG + Intronic
1063547013 10:6991236-6991258 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1063619050 10:7628082-7628104 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1063650040 10:7925974-7925996 GAGGCCAAGGCCAAGGTGGGAGG + Intronic
1064221639 10:13445838-13445860 GTGCAGATGGCCAGGGTGGGAGG + Intronic
1065019223 10:21489245-21489267 ATTCACAAGGCTGAGGTGGGAGG - Intergenic
1065225080 10:23535398-23535420 CTGCAGGAGGCCAAGGTGGTAGG - Intergenic
1065349069 10:24779255-24779277 ATGCAGGAGGCTAAGGTGGGAGG + Intergenic
1065408158 10:25391204-25391226 GTGCAGAAGGAAAATGTGGGTGG + Intronic
1066074326 10:31857958-31857980 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1066145884 10:32557934-32557956 TTTCAGGAGGCCAAGGTGGGAGG - Intronic
1066424163 10:35290716-35290738 CTTTCCAAGGCCAAGGTGGGAGG + Intronic
1066468158 10:35671296-35671318 ATTCAGGAGGCCAAGGTGGGAGG - Intergenic
1067295184 10:44971575-44971597 CTGCACATGGCCCTGGTGGGGGG - Intronic
1068222033 10:54057259-54057281 GTGCAGAAGGGAAATGTGGGTGG - Intronic
1068512742 10:57986559-57986581 GTTCAAAAGGCTGAGGTGGGAGG + Intergenic
1068603449 10:58979395-58979417 GCTCAGGAGGCCAAGGTGGGAGG + Intergenic
1068778304 10:60891589-60891611 TTTCAGGAGGCCAAGGTGGGAGG - Intronic
1068891832 10:62156061-62156083 GTTTAGGAGGCCAAGGTGGGTGG - Intergenic
1068977505 10:63025523-63025545 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1068997721 10:63226467-63226489 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1069463219 10:68614835-68614857 GTTTAGGAGGCCAAGGTGGGCGG - Intronic
1069974559 10:72202221-72202243 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1070340492 10:75493995-75494017 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1070825222 10:79386795-79386817 GTGCACATGGCCAGGGTGCCAGG - Intronic
1071565557 10:86669769-86669791 GGGCACAAGGCCAGAGGGGGAGG + Intronic
1071581960 10:86780012-86780034 GTTCGGGAGGCCAAGGTGGGAGG - Intronic
1071752205 10:88492660-88492682 CTCTAGAAGGCCAAGGTGGGTGG - Intronic
1071795024 10:88995575-88995597 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
1071959482 10:90796171-90796193 ATGCACTTGGCCAAGGAGGGAGG + Intronic
1072113439 10:92345801-92345823 GTGCAGGAGGCTGAGGTGGGAGG - Intronic
1072211893 10:93253881-93253903 CAGCACTAGGCCGAGGTGGGCGG - Intergenic
1072231717 10:93419404-93419426 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
1072537590 10:96375125-96375147 GAGCACTGGGCCAAGGTGGTGGG + Intronic
1072723166 10:97793301-97793323 GTTTGGAAGGCCAAGGTGGGTGG + Intergenic
1072968456 10:99995290-99995312 GTTCAGGAGGCTAAGGTGGGTGG - Intronic
1073192768 10:101663546-101663568 CTTCAGAAGGCCAAGGTGGGAGG + Intronic
1073312534 10:102553848-102553870 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1073472043 10:103728611-103728633 ATCCCCAAGGCCAAGATGGGGGG - Intronic
1074383162 10:112996507-112996529 ATGCTGAAGGCCAAGGTGAGGGG - Intronic
1074553947 10:114471130-114471152 GAGGCCAAGGCCAAGGTGGGTGG - Intronic
1074958495 10:118416474-118416496 GTGAACTAGTCCAGGGTGGGAGG - Intergenic
1076326994 10:129631978-129632000 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1076633200 10:131865366-131865388 CTCCACAAGGCCAAGGGGGCTGG + Intergenic
1076821001 10:132939534-132939556 CTGCTCAATGCCCAGGTGGGAGG + Intronic
1077100824 11:821602-821624 GGGCACAGGGCCAAGGTTAGGGG - Intronic
1077216062 11:1395601-1395623 GTGCCCAGGGCCACAGTGGGTGG - Intronic
1077621362 11:3727616-3727638 CTTCAGGAGGCCAAGGTGGGGGG + Intronic
1077847665 11:6043108-6043130 CTTCAGAAGGCCGAGGTGGGTGG + Intergenic
1078076289 11:8164530-8164552 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1078183873 11:9034735-9034757 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
1078223992 11:9375425-9375447 TTTCAAAAGGCCAAGGTGGGAGG + Intergenic
1079123575 11:17702451-17702473 TTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1080451603 11:32382783-32382805 GTGCATAAGGCCAACGTGCCTGG + Intergenic
1080495329 11:32812274-32812296 CTTTGCAAGGCCAAGGTGGGAGG + Intergenic
1080623103 11:34004022-34004044 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1081466150 11:43319654-43319676 CTTCAGAAGGCCAAGGTGGGAGG - Intronic
1081883823 11:46477579-46477601 GCACAGTAGGCCAAGGTGGGAGG - Intronic
1081974589 11:47224491-47224513 CTTCAGGAGGCCAAGGTGGGCGG - Intronic
1082224512 11:49688412-49688434 CTGTAGGAGGCCAAGGTGGGTGG + Intergenic
1083098987 11:60283308-60283330 GTATAGGAGGCCAAGGTGGGAGG - Intronic
1083230955 11:61318953-61318975 CTTCAGAAGGCCAAGGCGGGAGG + Intronic
1083411749 11:62498513-62498535 CTTTAGAAGGCCAAGGTGGGAGG + Intronic
1083473688 11:62901576-62901598 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
1084684021 11:70683219-70683241 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1085043172 11:73338710-73338732 GTGCACCAGGCCAGGGGAGGTGG + Intronic
1085285601 11:75358112-75358134 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1085581486 11:77654874-77654896 GTTCGGGAGGCCAAGGTGGGAGG - Intergenic
1086302995 11:85449882-85449904 CTTTGCAAGGCCAAGGTGGGTGG + Intronic
1086381941 11:86263622-86263644 CTTCAGAAGGCCAAGATGGGAGG - Intronic
1087429785 11:98038365-98038387 GTGCACAAGGGGAAGGGGGAAGG + Intergenic
1087571628 11:99934639-99934661 CAGCACAAGGCCATGGTGGGTGG + Intronic
1087756867 11:102063582-102063604 CTTCAAGAGGCCAAGGTGGGAGG + Intronic
1088138884 11:106591810-106591832 CTACAGGAGGCCAAGGTGGGTGG - Intergenic
1089464561 11:118676362-118676384 ATTCAGGAGGCCAAGGTGGGAGG + Intronic
1090556340 11:127880439-127880461 CTTCAAGAGGCCAAGGTGGGAGG - Intergenic
1091337339 11:134782248-134782270 GTGCACAATGCCAAGGATTGGGG - Intergenic
1092494214 12:8975803-8975825 CTTCAGGAGGCCAAGGTGGGCGG - Intronic
1092815507 12:12309364-12309386 GCTCACAAGGCCAAGATGGGAGG + Intergenic
1092816380 12:12315793-12315815 GCACAAGAGGCCAAGGTGGGAGG - Intergenic
1092986863 12:13854266-13854288 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
1093447040 12:19272493-19272515 ATGTAGGAGGCCAAGGTGGGAGG + Intronic
1094762127 12:33546169-33546191 GTGCAAAGGGACCAGGTGGGAGG - Intergenic
1094850004 12:34378122-34378144 GGGGACAAGCCCAAGGTGGCAGG - Intergenic
1095256798 12:40047143-40047165 CTTCAGGAGGCCAAGGTGGGCGG - Intronic
1095360003 12:41326090-41326112 ATTCAGGAGGCCAAGGTGGGAGG - Intronic
1096058357 12:48674680-48674702 GTGCACAAGGCCAAGGTGGGTGG + Intronic
1096161592 12:49382946-49382968 GTTTGAAAGGCCAAGGTGGGTGG - Intronic
1096335634 12:50753781-50753803 CTTCAGGAGGCCAAGGTGGGCGG + Intergenic
1096612058 12:52808678-52808700 CTGTACCAGACCAAGGTGGGTGG - Exonic
1096664022 12:53150195-53150217 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1096824485 12:54264262-54264284 GCTCAGAAGGCCAAGGTGAGAGG - Intronic
1097171197 12:57114231-57114253 GTGAAAATGGCCAAGGAGGGAGG - Intronic
1097292547 12:57930513-57930535 CTTCGAAAGGCCAAGGTGGGTGG - Intergenic
1098262138 12:68682549-68682571 GTTTGGAAGGCCAAGGTGGGCGG - Intergenic
1098267397 12:68736658-68736680 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1100089566 12:90954075-90954097 GCGCAGAAGGCCACGGTGAGCGG - Exonic
1100255411 12:92878155-92878177 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1100268593 12:93002104-93002126 ATTCAGGAGGCCAAGGTGGGAGG + Intergenic
1100361453 12:93883572-93883594 CTTTAGAAGGCCAAGGTGGGAGG + Intronic
1100512288 12:95287426-95287448 GTGCCTAAGGCTGAGGTGGGAGG - Intronic
1100725250 12:97401370-97401392 ACTCACAAGGCTAAGGTGGGAGG + Intergenic
1100972401 12:100084248-100084270 TTGCGGAGGGCCAAGGTGGGAGG + Intronic
1100975182 12:100115160-100115182 CTTCGGAAGGCCAAGGTGGGTGG + Intronic
1101879511 12:108616854-108616876 CTGTGGAAGGCCAAGGTGGGCGG - Intergenic
1101909925 12:108853678-108853700 CTGCAGGAGGCCGAGGTGGGCGG + Intronic
1101917145 12:108904516-108904538 GTTTGGAAGGCCAAGGTGGGTGG - Intergenic
1102010049 12:109612678-109612700 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1102114883 12:110395421-110395443 ACTCAGAAGGCCAAGGTGGGAGG - Intronic
1102135648 12:110572200-110572222 GTTTAGGAGGCCAAGGTGGGTGG + Intronic
1102192704 12:111001055-111001077 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1102287500 12:111670731-111670753 CTTTAGAAGGCCAAGGTGGGCGG - Intronic
1102388352 12:112529386-112529408 CTTCACGAGGTCAAGGTGGGCGG + Intergenic
1102457832 12:113081894-113081916 GGGTACAAGGCCAGGTTGGGTGG + Intronic
1102753880 12:115320991-115321013 GTGGGGAAGGCAAAGGTGGGAGG + Intergenic
1103108742 12:118255334-118255356 CTTTGCAAGGCCAAGGTGGGAGG - Intronic
1103223885 12:119270045-119270067 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1103537832 12:121645516-121645538 GTTCGGGAGGCCAAGGTGGGAGG - Intergenic
1103565861 12:121814916-121814938 GAGCGGATGGCCAAGGTGGGTGG + Exonic
1103757715 12:123222691-123222713 GGGCAGGAGGCCGAGGTGGGTGG + Intronic
1103849058 12:123919316-123919338 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
1104621196 12:130313935-130313957 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
1105005089 12:132716630-132716652 GGACACAAGGACAAGGTGGAAGG - Intronic
1105028134 12:132863262-132863284 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
1105269230 13:18855297-18855319 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1106471790 13:30062487-30062509 CTTCAGGAGGCCAAGGTGGGCGG - Intergenic
1106866354 13:33968369-33968391 CTGCAGGAGGCCGAGGTGGGAGG - Intergenic
1107136835 13:36954194-36954216 GTTCAGGAGGCAAAGGTGGGAGG - Intronic
1107508281 13:41057508-41057530 ATTCAGGAGGCCAAGGTGGGAGG - Intronic
1108115445 13:47122465-47122487 GTGGGCAAGCCTAAGGTGGGAGG + Intergenic
1108439423 13:50435508-50435530 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1109161465 13:58980473-58980495 GTGCACAGGGTGAAGGTGGGAGG - Intergenic
1109277406 13:60317861-60317883 GGGAACAAGACCAAGGTGTGAGG + Intergenic
1109289427 13:60455822-60455844 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1109377963 13:61523106-61523128 GGGCACAGGCCCAAGGAGGGAGG + Intergenic
1110211480 13:72978949-72978971 CTCAAAAAGGCCAAGGTGGGAGG + Intronic
1110225388 13:73114211-73114233 CTTTTCAAGGCCAAGGTGGGTGG - Intergenic
1110657627 13:78019017-78019039 GTAGACAAGGTCAGGGTGGGAGG + Intergenic
1110835289 13:80075562-80075584 CTTTAAAAGGCCAAGGTGGGTGG - Intergenic
1111874012 13:93870378-93870400 GTGCACAAGGCAATTGTGGTTGG - Intronic
1111940845 13:94604816-94604838 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1113206952 13:107927804-107927826 GTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1113602059 13:111576836-111576858 ATTCAGGAGGCCAAGGTGGGAGG - Intergenic
1113743918 13:112729606-112729628 GTCCGCAATGCCGAGGTGGGGGG - Intronic
1113794481 13:113049170-113049192 GGCCACAAGGCCAAGGAGGCAGG + Intronic
1113976940 13:114234898-114234920 GTGCACGGGGCCTGGGTGGGGGG + Exonic
1114302379 14:21389989-21390011 CTTCAGAAGGCCAAGGCGGGTGG + Intronic
1114894169 14:26965085-26965107 TAGCACAAGGGCAAGGTAGGTGG + Intergenic
1114981102 14:28165882-28165904 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1115254221 14:31381437-31381459 ACTCAGAAGGCCAAGGTGGGAGG + Intronic
1115817182 14:37176137-37176159 TTTTAGAAGGCCAAGGTGGGAGG - Intergenic
1116604140 14:46968129-46968151 GTGCAGCTGGCCAAGGTGGAGGG + Intronic
1116859053 14:49979148-49979170 ATGCACAAGGGCAGGGAGGGAGG - Intergenic
1116959922 14:50958347-50958369 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
1117043582 14:51790412-51790434 GTTCAGAAGGCTGAGGTGGGAGG + Intergenic
1117230835 14:53717188-53717210 ATTCAGGAGGCCAAGGTGGGTGG + Intergenic
1117252480 14:53951202-53951224 GGACACAAAGCCAAGGTGGGGGG - Intronic
1117820361 14:59643119-59643141 GAACACAAGGCCAAGGATGGTGG + Intronic
1117976899 14:61307943-61307965 GTTCAGAAGGCTGAGGTGGGAGG - Intronic
1118202922 14:63693839-63693861 ATTTGCAAGGCCAAGGTGGGAGG - Intronic
1118336218 14:64855581-64855603 TTTCAGGAGGCCAAGGTGGGAGG - Intronic
1118389495 14:65284215-65284237 GTTTGGAAGGCCAAGGTGGGAGG + Intergenic
1118778379 14:68988900-68988922 CTGGCCAAGGCCAAGGTGTGGGG - Intergenic
1118841532 14:69517016-69517038 GTGCAAAGAGCCCAGGTGGGAGG + Intronic
1119277715 14:73374261-73374283 TTTAAAAAGGCCAAGGTGGGAGG - Intronic
1119290050 14:73488511-73488533 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
1119371139 14:74144368-74144390 TTTCGGAAGGCCAAGGTGGGAGG - Intronic
1119722489 14:76900650-76900672 GTGCACCAGGGCAAGGGGTGGGG - Intergenic
1119831079 14:77703224-77703246 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
1120050990 14:79865879-79865901 TTTTGCAAGGCCAAGGTGGGTGG - Intronic
1120786210 14:88539489-88539511 GTTCGGGAGGCCAAGGTGGGCGG - Intronic
1121024221 14:90602590-90602612 GCTCAAGAGGCCAAGGTGGGAGG + Intronic
1121079119 14:91093560-91093582 TTGCTTGAGGCCAAGGTGGGTGG + Intronic
1122407487 14:101509015-101509037 GTGACCCAGGCCAAGGTGGAGGG - Intergenic
1202830080 14_GL000009v2_random:18699-18721 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1123415953 15:20095658-20095680 CTTCAGGAGGCCAAGGTGGGCGG - Intergenic
1123702792 15:22928140-22928162 ATGCAGGAGGCCAAGGCGGGCGG + Intronic
1124102840 15:26712078-26712100 GAGCACAGGGCCTAAGTGGGAGG + Intronic
1125202253 15:37110499-37110521 CTGGGCAGGGCCAAGGTGGGAGG - Intergenic
1125613382 15:40988475-40988497 ATTCACAAGGCTGAGGTGGGAGG + Intronic
1125644499 15:41260636-41260658 CTTCAAGAGGCCAAGGTGGGTGG - Intronic
1126461464 15:48919407-48919429 ATGCTATAGGCCAAGGTGGGAGG - Intronic
1126806064 15:52350557-52350579 GTGCACAAGGGCAGGGAGGCAGG + Intronic
1126839331 15:52701234-52701256 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1127432957 15:58929667-58929689 TCCCAAAAGGCCAAGGTGGGAGG - Intronic
1127481830 15:59384964-59384986 ATGCAGGAGGCCGAGGTGGGAGG - Intronic
1127893203 15:63272840-63272862 GCATATAAGGCCAAGGTGGGAGG - Intergenic
1127927869 15:63564910-63564932 CTGCACAATGCCCAGGTGTGAGG + Intronic
1128034627 15:64513846-64513868 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1128561324 15:68669811-68669833 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
1129011288 15:72419925-72419947 ACGCAGGAGGCCAAGGTGGGAGG + Intergenic
1129058271 15:72837726-72837748 CTTCGGAAGGCCAAGGTGGGTGG + Intergenic
1129076002 15:72996620-72996642 GTTTGGAAGGCCAAGGTGGGTGG + Intergenic
1129716683 15:77856228-77856250 ACTCACAAGGCTAAGGTGGGAGG + Intergenic
1130010166 15:80146018-80146040 ATGCAGAAGACTAAGGTGGGAGG + Intergenic
1130310832 15:82752657-82752679 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1130475412 15:84261983-84262005 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1130482829 15:84376037-84376059 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1131102113 15:89700798-89700820 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1132159463 15:99525156-99525178 CTGCGGGAGGCCAAGGTGGGAGG - Intergenic
1132673315 16:1111228-1111250 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
1133100073 16:3474094-3474116 GGGCACAAGGGCGGGGTGGGGGG + Intronic
1133102938 16:3490020-3490042 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1133314945 16:4877088-4877110 GTGGCCAAGGCCATGGTGGAAGG - Exonic
1133326026 16:4942996-4943018 GTTTGGAAGGCCAAGGTGGGAGG - Intronic
1134050040 16:11131120-11131142 GTGCGCCTGGCCAAGGAGGGGGG + Intronic
1134215816 16:12316299-12316321 GATCACAAGGCCGAGGTGGGTGG + Intronic
1134408783 16:13985775-13985797 GTGTGGGAGGCCAAGGTGGGAGG - Intergenic
1134539019 16:15049270-15049292 CTGTAGGAGGCCAAGGTGGGTGG - Intronic
1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG + Intronic
1135062114 16:19279884-19279906 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1135102369 16:19617110-19617132 CTTTGCAAGGCCAAGGTGGGAGG + Intronic
1135111653 16:19695041-19695063 GAGCCCAAGGCCAAGGTGGGCGG - Intronic
1135116540 16:19728491-19728513 CTTTACGAGGCCAAGGTGGGTGG - Intronic
1135331428 16:21563163-21563185 GTTTGGAAGGCCAAGGTGGGAGG + Intergenic
1135409067 16:22219385-22219407 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1135459627 16:22630305-22630327 CTTTACGAGGCCAAGGTGGGAGG + Intergenic
1135666106 16:24336921-24336943 GCTCAGAAAGCCAAGGTGGGAGG - Intronic
1136040700 16:27576530-27576552 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1136069087 16:27777547-27777569 CTGCCCAAGGTCAACGTGGGAGG + Intronic
1136093038 16:27934298-27934320 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1136684098 16:31983982-31984004 GGGCAGGAGGCCAGGGTGGGTGG + Intergenic
1136784723 16:32927534-32927556 GGGCAGGAGGCCAGGGTGGGTGG + Intergenic
1136885060 16:33926272-33926294 GGGCAGGAGGCCAGGGTGGGTGG - Intergenic
1137218806 16:46427340-46427362 CTGCAAAAAGCCAAGGTGGTGGG + Intergenic
1137285087 16:47009212-47009234 CTTCAAGAGGCCAAGGTGGGCGG - Intergenic
1137575207 16:49595040-49595062 GTGAAAATGGCCAAGGTGGTGGG - Intronic
1137975170 16:53025124-53025146 GAGGCCAAGGCCAAGGTGGAAGG + Intergenic
1137985133 16:53100701-53100723 AAGGCCAAGGCCAAGGTGGGTGG - Intronic
1138053622 16:53809696-53809718 CTGTAGGAGGCCAAGGTGGGAGG + Intronic
1138238122 16:55402766-55402788 GGCCAAGAGGCCAAGGTGGGAGG - Intronic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1139134489 16:64185428-64185450 CTTCAGAAGGCCAAGGCGGGTGG + Intergenic
1139445290 16:66994452-66994474 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
1139532818 16:67551423-67551445 CTTTAGAAGGCCAAGGTGGGAGG - Intergenic
1139635126 16:68253930-68253952 ATTTGCAAGGCCAAGGTGGGAGG - Intronic
1139648554 16:68349648-68349670 CTTCGGAAGGCCAAGGTGGGAGG + Intronic
1139783967 16:69375453-69375475 CTTCAGAAGGCCAAGGTAGGAGG + Intronic
1140578919 16:76205624-76205646 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1141620170 16:85233089-85233111 GAGGACAAGGCCCAGCTGGGGGG - Intergenic
1141991362 16:87612366-87612388 CTTCAGGAGGCCAAGGTGGGCGG - Intronic
1142010067 16:87709418-87709440 GTGGACACGGCCCAGGTGCGGGG + Exonic
1142173671 16:88635232-88635254 GGGCACTAGGCCGAGGTGGGGGG + Intergenic
1142254177 16:89006097-89006119 GAGCAGAAGGCCAACGCGGGTGG + Intergenic
1203087381 16_KI270728v1_random:1191540-1191562 GGGCAGGAGGCCAGGGTGGGTGG + Intergenic
1142513996 17:415129-415151 TTGTGGAAGGCCAAGGTGGGAGG - Intronic
1142517172 17:439779-439801 CTTCACAAGGCCAAGGCTGGAGG - Intergenic
1142581768 17:947487-947509 ATGCAGGAGGCCGAGGTGGGCGG + Intronic
1142664076 17:1451733-1451755 AAACACAAGGCCGAGGTGGGCGG + Intronic
1143113598 17:4568068-4568090 CTTTAGAAGGCCAAGGTGGGCGG - Intergenic
1143570007 17:7751334-7751356 TTTTAGAAGGCCAAGGTGGGTGG - Intronic
1143709425 17:8724124-8724146 GTTCTAGAGGCCAAGGTGGGTGG - Intergenic
1144458940 17:15442047-15442069 GTGGACAGGCCCAAGTTGGGTGG - Intronic
1144547227 17:16208605-16208627 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1144762960 17:17717669-17717691 GTTCAGAGGGCCCAGGTGGGGGG - Intronic
1144790591 17:17856431-17856453 GGGCACCAGCCCAAGCTGGGTGG + Intronic
1145299150 17:21618759-21618781 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1145351129 17:22084524-22084546 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1146188025 17:30738246-30738268 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
1146357601 17:32147286-32147308 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1147682452 17:42259541-42259563 GTTTGGAAGGCCAAGGTGGGTGG + Intronic
1147685803 17:42286350-42286372 GGGCACAGGGTCAGGGTGGGAGG + Intergenic
1147739796 17:42664966-42664988 AATCCCAAGGCCAAGGTGGGAGG - Intronic
1148399796 17:47347013-47347035 CTGCGGAAGGCCAATGTGGGAGG + Intronic
1148482174 17:47967174-47967196 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1148580769 17:48742060-48742082 CTTCAAAAGGCCAAGGTTGGAGG - Intergenic
1148784492 17:50139424-50139446 GTGCACAAGTTCAAGGAGGTGGG - Exonic
1149336060 17:55637415-55637437 GTTTGGAAGGCCAAGGTGGGAGG + Intergenic
1149433015 17:56609561-56609583 ATGGAAAAGGCCAAGGTGGGTGG - Intergenic
1149613565 17:57977368-57977390 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1150438226 17:65170527-65170549 GTGCACAGGGCTAAGGTGCAGGG - Intronic
1150553483 17:66232384-66232406 GTTCAGGAGGCCGAGGTGGGTGG + Intronic
1150581561 17:66478495-66478517 CTTCAGAAGGCCAAGGTGGGTGG - Intronic
1150783878 17:68146946-68146968 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1151265349 17:72951016-72951038 CTTCTGAAGGCCAAGGTGGGAGG + Intronic
1151648840 17:75452895-75452917 CTTCGGAAGGCCAAGGTGGGTGG + Intronic
1151745067 17:76007548-76007570 GTGCACAAGGCGATGGAGAGGGG - Exonic
1152430522 17:80246216-80246238 GGGCACAAGGGGAAGATGGGGGG - Intronic
1152444279 17:80331827-80331849 GTTAACAAGGCCAAGCGGGGAGG + Intronic
1152657139 17:81525009-81525031 GCTCAGGAGGCCAAGGTGGGAGG + Intergenic
1152661973 17:81546692-81546714 GTCCACAGGCCCGAGGTGGGTGG + Intronic
1152975065 18:207568-207590 GTTCAGAAGGCTAAGGTGGGAGG + Intronic
1153553287 18:6284761-6284783 GTGCAACAGAGCAAGGTGGGAGG + Intronic
1153733983 18:8045237-8045259 ACTCAAAAGGCCAAGGTGGGAGG + Intronic
1154418802 18:14204688-14204710 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1155300875 18:24427428-24427450 GTACACAAGGACTAGATGGGTGG - Intronic
1155816292 18:30315519-30315541 CTTTGCAAGGCCAAGGTGGGAGG + Intergenic
1156007890 18:32465132-32465154 GTACACATGGCCAGGGTGGGGGG - Intronic
1156209912 18:34928429-34928451 GTGCAGAAACCCACGGTGGGAGG - Intergenic
1156871583 18:41951888-41951910 GTTCAGGAGGCTAAGGTGGGAGG + Intergenic
1157130879 18:45006193-45006215 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1157790370 18:50525721-50525743 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1157831569 18:50861233-50861255 GTTCAGGAGGCTAAGGTGGGAGG + Intergenic
1158069671 18:53456077-53456099 GTGATCAATGCCAAGGTGAGTGG + Intronic
1158805468 18:60966691-60966713 CTTTGCAAGGCCAAGGTGGGAGG + Intergenic
1159123593 18:64197704-64197726 CTTCCCAAGGCCAAAGTGGGAGG + Intergenic
1160759848 19:778069-778091 GTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1160882552 19:1328056-1328078 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
1160905864 19:1451530-1451552 GTGCCCAAGGGCAGGGTGGGAGG - Exonic
1160945599 19:1641934-1641956 GCTCACAAGGCTGAGGTGGGAGG + Intronic
1161173996 19:2829113-2829135 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
1161215002 19:3090140-3090162 ATTCAGGAGGCCAAGGTGGGAGG - Intergenic
1161294728 19:3513820-3513842 GTCCACTGGGCCAGGGTGGGGGG + Intronic
1161391096 19:4020842-4020864 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1161564579 19:4993853-4993875 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1161669294 19:5596019-5596041 TTTCAGGAGGCCAAGGTGGGCGG + Intronic
1161684505 19:5696241-5696263 GTGGACTTGTCCAAGGTGGGGGG - Exonic
1161734029 19:5979207-5979229 CTGCGGGAGGCCAAGGTGGGAGG + Intergenic
1162010582 19:7811428-7811450 CTTCAGAAGGCCGAGGTGGGTGG - Intergenic
1162086179 19:8250696-8250718 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1162230795 19:9264366-9264388 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1162479170 19:10918628-10918650 GTGCAGGAGGGCAAGGTGGGCGG - Intronic
1162627036 19:11893076-11893098 CTTCAGGAGGCCAAGGTGGGCGG - Intronic
1162629822 19:11918590-11918612 GGGCAGAAAGCCGAGGTGGGAGG - Intergenic
1163461130 19:17438329-17438351 GTTTGGAAGGCCAAGGTGGGCGG - Intronic
1163721407 19:18899865-18899887 GAGTACCAGGCCAAGGTGAGTGG - Exonic
1164145214 19:22508803-22508825 GAGTTTAAGGCCAAGGTGGGTGG + Intronic
1165095890 19:33409816-33409838 GGGCACCAGGCCCAGGTGTGAGG - Intronic
1165151054 19:33760424-33760446 GCTCAGAAGGCTAAGGTGGGAGG - Intronic
1165241507 19:34472111-34472133 CTTGGCAAGGCCAAGGTGGGAGG - Intergenic
1165505349 19:36224136-36224158 CTTTGCAAGGCCAAGGTGGGTGG + Intronic
1166068211 19:40372548-40372570 GAGGCCAAGGCCAAGATGGGAGG + Intronic
1166640710 19:44492927-44492949 GTCCACAGGGCCCATGTGGGAGG + Intronic
1166971612 19:46572312-46572334 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
1167485231 19:49758808-49758830 CTCCACAAGGTCAAGGTTGGAGG - Intronic
1167593577 19:50416636-50416658 GTGCTCACGGGCAAGGTGGGCGG + Exonic
1167647165 19:50712032-50712054 TTCCACACGGCCATGGTGGGTGG - Exonic
1167667189 19:50829551-50829573 GAGGCCAAGGCCGAGGTGGGTGG + Intronic
1167788163 19:51652686-51652708 GTTCTGAAGGCTAAGGTGGGAGG + Intergenic
1168048155 19:53808980-53809002 AACCTCAAGGCCAAGGTGGGTGG + Intronic
1168125788 19:54281898-54281920 GGGCTCCAGACCAAGGTGGGAGG + Intergenic
1168171479 19:54592833-54592855 GGGCTCCAGACCAAGGTGGGAGG - Intronic
1168176185 19:54629658-54629680 GGGCTCCAGACCAAGGTGGGAGG - Intronic
1168192483 19:54749651-54749673 CTGCAGGAGGCCAAGGTGGGTGG + Intronic
1168194566 19:54764481-54764503 CTGCAGGAGGCCAAGGCGGGTGG + Intronic
1168196813 19:54780928-54780950 CTGCAGGAGGCCAAGGTGGGTGG + Intronic
1168205178 19:54845186-54845208 CTGCAGGAGGCCAAGGCGGGTGG + Intronic
1168549755 19:57282880-57282902 GTGCAGGAGGCTGAGGTGGGAGG + Intronic
1202642609 1_KI270706v1_random:109074-109096 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
925168610 2:1736574-1736596 CTTCAAGAGGCCAAGGTGGGAGG + Intronic
925574943 2:5350663-5350685 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
925932974 2:8724873-8724895 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
926008453 2:9390419-9390441 GTGCACAGGGCCCAGGTGCTAGG - Intronic
926363602 2:12113126-12113148 GAGCAGAAGGCCAAGGTAGCAGG + Intergenic
926367564 2:12146920-12146942 GTTCAAGAGGCCATGGTGGGAGG - Intergenic
926567885 2:14497460-14497482 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
927231722 2:20830523-20830545 ATGCAGAAGGCTGAGGTGGGAGG - Intergenic
927680724 2:25137304-25137326 GGGCAGAAGGCCAGGGTCGGAGG - Intronic
927691722 2:25213203-25213225 GTGCTGATGGCCTAGGTGGGAGG - Intergenic
927902780 2:26833296-26833318 GTTTGAAAGGCCAAGGTGGGAGG + Intergenic
928195479 2:29213738-29213760 TTTCAGGAGGCCAAGGTGGGAGG + Intronic
928491637 2:31790264-31790286 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
928629754 2:33178982-33179004 CTGTAGGAGGCCAAGGTGGGAGG - Intronic
928685247 2:33743059-33743081 GTGTGGAAGGCCGAGGTGGGCGG - Intergenic
929478901 2:42282634-42282656 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
929721510 2:44373878-44373900 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
929856652 2:45643488-45643510 CTTCCCAAGGCCAAGGTTGGAGG - Intergenic
929896298 2:45963550-45963572 CTTCGGAAGGCCAAGGTGGGCGG - Intronic
930130303 2:47842887-47842909 GTTCGAGAGGCCAAGGTGGGAGG - Intronic
930721944 2:54646461-54646483 GAGGAGAAGGCCAAGGTGAGAGG + Exonic
930733245 2:54748804-54748826 TTTTAAAAGGCCAAGGTGGGAGG - Intronic
930777314 2:55186508-55186530 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
931350652 2:61485121-61485143 CTTCAGAAGGCCAAGGCGGGCGG - Intronic
931351374 2:61491789-61491811 ACCCACGAGGCCAAGGTGGGAGG + Intronic
931425362 2:62166057-62166079 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
931920346 2:67008552-67008574 CTGCACAAGGCAGAGGTGGCGGG + Intergenic
931974694 2:67630130-67630152 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
932082586 2:68728607-68728629 GTGCACAAGGCCAGGCATGGTGG + Intronic
932629949 2:73332126-73332148 TTTTAGAAGGCCAAGGTGGGAGG + Intergenic
933049955 2:77590755-77590777 GCGCACAAGCCCACGGCGGGTGG - Intronic
933257970 2:80102302-80102324 TGGGACAAGGCCAAGGTGGAAGG - Intronic
933425679 2:82109490-82109512 CTTTAGAAGGCCAAGGTGGGGGG - Intergenic
933483500 2:82888031-82888053 GTTTGAAAGGCCAAGGTGGGCGG + Intergenic
933797097 2:85928313-85928335 ATGCAGGAGGCCAAAGTGGGCGG + Intergenic
934068142 2:88359065-88359087 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
934899209 2:98143994-98144016 CTTCAAGAGGCCAAGGTGGGGGG - Intronic
934975396 2:98798798-98798820 GCTCAGGAGGCCAAGGTGGGAGG - Intronic
935293617 2:101629662-101629684 CTGCGGGAGGCCAAGGTGGGTGG + Intergenic
935420598 2:102865217-102865239 GTGCACATGGAGAAGGTGGTTGG + Intergenic
935996407 2:108778971-108778993 CTGTGCAAGGCCAAGGTGGCAGG - Intronic
936241592 2:110792544-110792566 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
936841589 2:116776089-116776111 GTTTAGGAGGCCAAGGTGGGTGG + Intergenic
938109426 2:128553993-128554015 GTGCACAAGTTCAGGGTGAGTGG - Intergenic
938819654 2:134943290-134943312 ATTCAGGAGGCCAAGGTGGGAGG + Intronic
939280557 2:140058743-140058765 GTTTACAAGGCAAAAGTGGGAGG + Intergenic
939328814 2:140731524-140731546 TTTTGCAAGGCCAAGGTGGGAGG + Intronic
939601522 2:144197981-144198003 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
939855144 2:147349786-147349808 CTGTAGGAGGCCAAGGTGGGTGG + Intergenic
941168219 2:162106031-162106053 ATTCACAAGGCTGAGGTGGGAGG + Intergenic
941217175 2:162726661-162726683 CTTGACAAGGCCGAGGTGGGCGG - Intronic
941981779 2:171466105-171466127 CTGCAGGAAGCCAAGGTGGGTGG - Intronic
942175974 2:173335075-173335097 CTGGAGCAGGCCAAGGTGGGAGG - Intergenic
942243783 2:173988705-173988727 GTGCGGGAGGCTAAGGTGGGAGG + Intergenic
943532383 2:189099379-189099401 GAGAATGAGGCCAAGGTGGGTGG + Intronic
943584882 2:189726388-189726410 ATGCAGTAGGCTAAGGTGGGAGG - Intronic
943594313 2:189837370-189837392 ATTCACAAGGCTAAGGTGGGAGG - Intronic
944216177 2:197258364-197258386 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
944239540 2:197472558-197472580 CTTCGCAAGGCCTAGGTGGGTGG + Intronic
944547050 2:200809428-200809450 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
944576119 2:201092545-201092567 CTCCAAGAGGCCAAGGTGGGTGG + Intergenic
944973063 2:205016367-205016389 GTGAAGAAGGCCAGGGTGGCTGG - Intronic
945073697 2:206015977-206015999 GTGCAGAAGGAAAATGTGGGTGG + Intronic
945125813 2:206508267-206508289 CTTCAGGAGGCCAAGGTGGGCGG - Intronic
945929022 2:215836317-215836339 GTAAACAAAACCAAGGTGGGTGG - Intergenic
945971661 2:216237172-216237194 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
946087116 2:217185192-217185214 GCCCACCAGGCCAAGGTGGGCGG - Intergenic
946203185 2:218083504-218083526 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
946578709 2:221103940-221103962 GAGCACAACGCCAAGGAGGCAGG - Intergenic
947329671 2:229015415-229015437 CTTCAGAAGGCCAAGGTGGGAGG + Intronic
947442299 2:230133826-230133848 GTGCAGAAGGGAAATGTGGGTGG - Intergenic
947534112 2:230930060-230930082 GGCCCCAAGGCCCAGGTGGGAGG - Intronic
947621033 2:231591232-231591254 CTTTAAAAGGCCAAGGTGGGAGG - Intergenic
947865488 2:233395411-233395433 CTTCAGAAGGCCAAGGTGGGTGG - Intronic
947873785 2:233454970-233454992 GTGCAGAATGCTAAGGCGGGGGG + Intronic
948024966 2:234769469-234769491 CTTTTCAAGGCCAAGGTGGGAGG + Intergenic
948268659 2:236657075-236657097 GAGCACCAGGCCACAGTGGGTGG - Intergenic
948543378 2:238705597-238705619 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
948830318 2:240595427-240595449 GTGCAACAGCCCAAGGAGGGGGG - Intronic
1168764985 20:375778-375800 GTTTAGGAGGCCAAGGTGGGCGG + Intronic
1168973261 20:1945490-1945512 GGGCAGAAGGCCCAGGTTGGTGG - Intergenic
1169128909 20:3152662-3152684 CTTCAGGAGGCCAAGGTGGGCGG + Intronic
1169355494 20:4901599-4901621 GGGCTCAGGGACAAGGTGGGTGG - Intronic
1171069977 20:22059124-22059146 GAGCACAAGGACAAGAAGGGTGG - Intergenic
1171561376 20:26129501-26129523 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1171889715 20:30699257-30699279 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1171965801 20:31529486-31529508 CTTTACAAGGCCAAGGAGGGTGG - Intronic
1172241501 20:33415863-33415885 CTTCAGGAGGCCAAGGTGGGCGG + Intronic
1172414420 20:34752683-34752705 CTTTAGAAGGCCAAGGTGGGTGG + Intronic
1172453403 20:35045910-35045932 GTTTAGGAGGCCAAGGTGGGAGG - Intronic
1172572728 20:35983103-35983125 CTTTGCAAGGCCAAGGTGGGAGG + Intronic
1172642948 20:36452421-36452443 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
1173479745 20:43389632-43389654 GTTCAGGAGGCCGAGGTGGGTGG + Intergenic
1173780992 20:45757311-45757333 CAGCACAAGGCCAAGGCAGGTGG + Intronic
1174241351 20:49137921-49137943 CTTCAGGAGGCCAAGGTGGGCGG - Intronic
1174436871 20:50514607-50514629 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1174782804 20:53405750-53405772 TTTCAGGAGGCCAAGGTGGGTGG + Intronic
1174822077 20:53735201-53735223 CTTTAGAAGGCCAAGGTGGGAGG + Intergenic
1175052065 20:56165026-56165048 GTGCAGAAGGCTTAGGTGGCTGG - Intergenic
1175071302 20:56336209-56336231 CTTTAAAAGGCCAAGGTGGGTGG + Intergenic
1175101769 20:56584486-56584508 GTGCAGATGGCCAAAGTCGGGGG - Intergenic
1175152738 20:56947766-56947788 ATTCAGAAGGCCAAGGCGGGTGG + Intergenic
1175435545 20:58944981-58945003 TTTCTCAAGGCCAAGGTGAGTGG - Intergenic
1175569846 20:60010296-60010318 GGGCTCAAGCCCAAGGTGGGAGG - Intronic
1176192257 20:63817469-63817491 CTTCAGGAGGCCAAGGTGGGCGG + Intronic
1176609266 21:8863539-8863561 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1176649869 21:9535795-9535817 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1176854502 21:13954588-13954610 TTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1177151393 21:17458782-17458804 ATTCACAAGGCTGAGGTGGGAGG + Intergenic
1177553083 21:22651170-22651192 GTGTTGGAGGCCAAGGTGGGAGG - Intergenic
1178092560 21:29179979-29180001 CTTCATGAGGCCAAGGTGGGCGG + Intergenic
1178412350 21:32375699-32375721 CTACAGGAGGCCAAGGTGGGAGG + Intronic
1178848889 21:36196809-36196831 ATTCAGGAGGCCAAGGTGGGAGG + Intronic
1178855063 21:36243914-36243936 GAGGCCAAGGCCAAGGTAGGAGG - Intronic
1178889245 21:36507518-36507540 CTTCGAAAGGCCAAGGTGGGTGG + Intronic
1178985976 21:37303510-37303532 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1179137403 21:38692339-38692361 CTTCAGGAGGCCAAGGTGGGCGG + Intergenic
1179811515 21:43873619-43873641 TTTTAGAAGGCCAAGGTGGGAGG - Intronic
1180008569 21:45034770-45034792 GTGCAGAAGGTGGAGGTGGGAGG + Intergenic
1180127192 21:45800703-45800725 AGGCACATGGCCCAGGTGGGAGG - Intronic
1180359360 22:11873382-11873404 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1180648467 22:17359317-17359339 GTGCAGGAGGCTGAGGTGGGAGG - Intergenic
1180687059 22:17677486-17677508 GTGAGGGAGGCCAAGGTGGGCGG + Intronic
1180743142 22:18067627-18067649 GAGCAGAAGGCCAATGTGGTGGG - Intergenic
1181264095 22:21620176-21620198 ACTCTCAAGGCCAAGGTGGGAGG + Intronic
1182560812 22:31157596-31157618 CTGTAGAAGCCCAAGGTGGGAGG + Intergenic
1182607732 22:31519813-31519835 CTACAGGAGGCCAAGGTGGGTGG - Intronic
1183297441 22:37038932-37038954 CTTTGCAAGGCCAAGGTGGGCGG + Intergenic
1183510608 22:38232569-38232591 AGGCACAAGGCCAAGGGGAGGGG + Intronic
1183684436 22:39353420-39353442 GCTCACAAGGCTGAGGTGGGAGG - Intronic
1183717570 22:39542675-39542697 GTTTAGGAGGCCAAGGTGGGAGG - Intergenic
1183728674 22:39604819-39604841 CTTCAAGAGGCCAAGGTGGGAGG - Intronic
1183792944 22:40088696-40088718 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
1183846305 22:40543887-40543909 TTGAACAAGAACAAGGTGGGAGG + Intronic
1183863182 22:40684034-40684056 TTCCACGAGGCCAAGGTGGGAGG - Intergenic
1184051540 22:42009157-42009179 CAGCACAAGGCCAAGGTGGGTGG - Intronic
1184308085 22:43622319-43622341 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
1184348984 22:43930880-43930902 GAGTACCAGGCCGAGGTGGGTGG + Intronic
1184529514 22:45045938-45045960 GTTGGCGAGGCCAAGGTGGGTGG - Intergenic
1185020232 22:48370248-48370270 GTACTTAAGGCCATGGTGGGTGG + Intergenic
1185338732 22:50282383-50282405 GTGGTCAGGGCCAGGGTGGGCGG - Intronic
950312305 3:11969279-11969301 GAGGCCAAGGCCAAGGCGGGTGG - Intergenic
950344719 3:12282630-12282652 CAGCACTAGGCCAAGGTGGCCGG - Intergenic
950470931 3:13185916-13185938 GGGCACCTGCCCAAGGTGGGCGG + Intergenic
950627773 3:14260687-14260709 ATGCAGAAGGGCAAGGTTGGAGG + Intergenic
951849277 3:27120571-27120593 CTTCGGAAGGCCAAGGTGGGTGG - Intronic
952728990 3:36619529-36619551 GAGCACAAAGGCAGGGTGGGGGG - Intergenic
952877875 3:37962369-37962391 GGGAACAAGGCCAAGTTGGGAGG - Intronic
952890031 3:38033720-38033742 GAGGACAAGGCCAATGTGGCTGG + Intergenic
953139470 3:40214070-40214092 GTGCACATGGCTTATGTGGGAGG - Intronic
953394344 3:42555431-42555453 CTTTTCAAGGCCAAGGTGGGAGG - Intronic
953503947 3:43464434-43464456 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
953921899 3:46957696-46957718 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
953973965 3:47368851-47368873 GTTTATGAGGCCAAGGTGGGAGG - Intergenic
954400339 3:50316329-50316351 GTGCTCATGGCCATGGTGGGGGG - Intergenic
954774602 3:53005553-53005575 CTTCGGAAGGCCAAGGTGGGAGG - Intronic
955022316 3:55133041-55133063 GAGGCCAAGGCCAAGGTGAGTGG + Intergenic
955047626 3:55374933-55374955 GGGCAGAATGCAAAGGTGGGGGG - Intergenic
955310378 3:57880632-57880654 CTTCAAGAGGCCAAGGTGGGAGG + Intronic
955920161 3:63946947-63946969 GTGCCCAAGGTCAAGGTATGGGG - Intronic
956612716 3:71140868-71140890 ATTCAGGAGGCCAAGGTGGGAGG + Intronic
956835519 3:73093205-73093227 ATTCAGGAGGCCAAGGTGGGAGG + Intergenic
957334392 3:78808444-78808466 CTTTGCAAGGCCAAGGTGGGTGG - Intronic
957434407 3:80154916-80154938 GGGCACCAGGCAGAGGTGGGAGG - Intergenic
960420896 3:117444294-117444316 GTGCTCAAAGCCCATGTGGGAGG + Intergenic
960521006 3:118655166-118655188 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
961197537 3:125015383-125015405 TTGCACAAGGCCCAGAAGGGAGG + Intronic
961644789 3:128387118-128387140 GAGCACAGGGCCGAGGAGGGTGG - Intronic
961667641 3:128503626-128503648 CTTCAAGAGGCCAAGGTGGGTGG + Intergenic
961690478 3:128665954-128665976 CTCTGCAAGGCCAAGGTGGGCGG - Intronic
962249781 3:133828898-133828920 GTGCACAGGGCTAAGTGGGGTGG - Intronic
962507810 3:136065917-136065939 ACTTACAAGGCCAAGGTGGGAGG - Intronic
962577351 3:136767214-136767236 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
962968130 3:140372833-140372855 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
962982254 3:140501147-140501169 GAGAACAAGAGCAAGGTGGGTGG - Intronic
964215048 3:154270553-154270575 GTTTGGAAGGCCAAGGTGGGTGG - Intergenic
964288904 3:155153268-155153290 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
964850448 3:161090617-161090639 GTTTAGAAGCCCAAGGTGGGTGG + Intronic
964851330 3:161099422-161099444 CTGCACAAGGGCAGGATGGGGGG + Intronic
965420903 3:168456676-168456698 GGGCACAAGCCCAAGGGTGGAGG + Intergenic
966374399 3:179280688-179280710 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
966720063 3:183053561-183053583 GTTCGGGAGGCCAAGGTGGGCGG + Intronic
967116745 3:186347824-186347846 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
967199411 3:187058882-187058904 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
967341960 3:188408218-188408240 GAGCAGAAGGCAAAGGTGTGAGG + Intronic
967417406 3:189234164-189234186 ATGCACAAGGCCAAGCGTGGTGG - Intronic
967914609 3:194569348-194569370 GTGCAGGAGGCTGAGGTGGGAGG + Intergenic
968137453 3:196229163-196229185 GCTCACGAGGCCGAGGTGGGAGG + Intronic
968141819 3:196264330-196264352 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
968382673 4:109134-109156 GAGCACAGGGCCAGGGTGGCCGG - Intergenic
968675374 4:1875521-1875543 AGGCACAAGGCCGAAGTGGGAGG - Intronic
968981012 4:3849357-3849379 GAGGACAAGGCTAGGGTGGGAGG - Intergenic
969207509 4:5657885-5657907 GAGGACCAGGCCAGGGTGGGAGG - Intronic
969293058 4:6252869-6252891 GTGTGCATGGCCAAGGAGGGTGG - Intergenic
969579481 4:8055867-8055889 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
971175334 4:24277199-24277221 TTGCAGTAGGCTAAGGTGGGAGG - Intergenic
972016143 4:34248682-34248704 CTTCGGAAGGCCAAGGTGGGTGG - Intergenic
972471094 4:39405276-39405298 CTTTAGAAGGCCAAGGTGGGAGG - Intergenic
974435058 4:61846069-61846091 TTCCAGAAGGCCACGGTGGGAGG + Intronic
974676820 4:65101948-65101970 CTTTGCAAGGCCAAGGTGGGAGG - Intergenic
975174098 4:71267549-71267571 GAGGAAATGGCCAAGGTGGGTGG + Intronic
975665164 4:76727908-76727930 CTTTAGAAGGCCAAGGTGGGCGG + Intronic
975964485 4:79954260-79954282 TTTTAGAAGGCCAAGGTGGGAGG - Intronic
976393519 4:84531118-84531140 CTTCATGAGGCCAAGGTGGGAGG + Intergenic
976795637 4:88929844-88929866 ATTCAAGAGGCCAAGGTGGGAGG - Intronic
977109182 4:92930021-92930043 GTGGGCAAGGCCAAGATGGAGGG - Intronic
977351839 4:95898127-95898149 GCTCACAAGGCTGAGGTGGGAGG + Intergenic
977903130 4:102445569-102445591 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
978009841 4:103667012-103667034 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
978791156 4:112664823-112664845 CTTTACAAGGCCAAGATGGGAGG + Intergenic
979090110 4:116472325-116472347 CTTCAGAAGGCCAAGGTGGGCGG - Intergenic
979637034 4:122967744-122967766 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
980122957 4:128746426-128746448 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
980139063 4:128894183-128894205 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
980145126 4:128973408-128973430 GGGCAAAAGGAAAAGGTGGGGGG + Intronic
980979318 4:139640677-139640699 GTTCAGAAGGCTAAGGTGAGAGG - Intergenic
980983518 4:139673786-139673808 TTTCAGGAGGCCAAGGTGGGAGG - Intronic
981519739 4:145649043-145649065 GTTCAGGAGGCCAAGGTGGAAGG + Intronic
981524542 4:145696787-145696809 CTTCAGGAGGCCAAGGTGGGCGG + Intronic
982178538 4:152728851-152728873 GAGTACAAGGCCAATTTGGGTGG - Intronic
983162837 4:164438332-164438354 CTTCGGAAGGCCAAGGTGGGAGG + Intergenic
983200534 4:164856017-164856039 TTTCAGGAGGCCAAGGTGGGCGG - Intergenic
983253511 4:165372828-165372850 CTTGGCAAGGCCAAGGTGGGTGG - Intronic
983332496 4:166348437-166348459 CTGCGCAAGGCCAAGGCAGGGGG + Intergenic
983424763 4:167569339-167569361 GTTCAGGAGGCCACGGTGGGAGG - Intergenic
983493902 4:168421414-168421436 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
983560911 4:169100581-169100603 TTGAAGGAGGCCAAGGTGGGTGG - Intronic
983790514 4:171791998-171792020 TTGCACAAGGACAAGGTCAGGGG + Intergenic
984577947 4:181473342-181473364 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
985244377 4:187965078-187965100 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
985279727 4:188273813-188273835 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
985347657 4:189023591-189023613 CTCCAGCAGGCCAAGGTGGGCGG + Intergenic
1202769979 4_GL000008v2_random:194973-194995 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
985721994 5:1494359-1494381 GGGCACAAGGCCAATGTGCCCGG + Intronic
985809890 5:2075217-2075239 GTGGACAAGGCCTAGGCTGGCGG + Intergenic
986511117 5:8507083-8507105 AAGCACAATGCCAAGGTGTGTGG + Intergenic
987252786 5:16117643-16117665 ACGCAGGAGGCCAAGGTGGGAGG + Intronic
987477689 5:18411858-18411880 CTTCGGAAGGCCAAGGTGGGAGG - Intergenic
988247873 5:28711809-28711831 CTTTAGAAGGCCAAGGTGGGCGG - Intergenic
988856385 5:35231619-35231641 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
988966977 5:36429109-36429131 GTTTAGGAGGCCAAGGTGGGTGG - Intergenic
989336261 5:40320305-40320327 GCTCAGGAGGCCAAGGTGGGAGG + Intergenic
991599402 5:68337382-68337404 TTTCACCAGGCCAAGTTGGGTGG + Intergenic
992067271 5:73120077-73120099 GTGGCCAAGGCCAAGGCGGCCGG + Intergenic
992300488 5:75374067-75374089 GTACACAAGGCCAAGGTCTTGGG + Exonic
992800507 5:80291378-80291400 GTGCAGGAGGCTGAGGTGGGAGG - Intergenic
992952414 5:81873353-81873375 GCGTGGAAGGCCAAGGTGGGCGG - Intergenic
993915966 5:93742511-93742533 GTGCAGAAAGCTAAGGAGGGAGG + Intronic
994639851 5:102394010-102394032 CTGCACTAGGCCCAGGTTGGGGG - Intronic
996907577 5:128619242-128619264 GTGCACCAGGCCAGGATGAGGGG - Intronic
997160674 5:131606117-131606139 CTGTATGAGGCCAAGGTGGGTGG + Intronic
997843168 5:137260969-137260991 GTGGAAAAGGCAAAGGTGAGAGG + Intronic
997934449 5:138098151-138098173 CTTCATGAGGCCAAGGTGGGTGG + Intergenic
998117988 5:139553060-139553082 CTTCAGAAGGCCAAGGCGGGCGG - Intronic
998222586 5:140298992-140299014 CTGCAGGAGGCCAAGGTGGGTGG - Intronic
998246706 5:140513563-140513585 CTTCAGAAGGCCAAGGCGGGTGG + Intronic
998633692 5:143929136-143929158 GTTCGTGAGGCCAAGGTGGGCGG + Intergenic
998869149 5:146535276-146535298 AAACACAAGGCCAAGGTGGCTGG - Intergenic
999090092 5:148928442-148928464 TTGGACAAGGCTAGGGTGGGTGG - Intronic
999764209 5:154726081-154726103 CTGTGGAAGGCCAAGGTGGGCGG - Intronic
1000305508 5:159991095-159991117 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1000306782 5:160001906-160001928 GTCCAGAAGACCAAGGTGGAGGG + Intergenic
1001507449 5:172291097-172291119 CTGTAGGAGGCCAAGGTGGGAGG - Intergenic
1002147268 5:177194524-177194546 CTCCGGAAGGCCAAGGTGGGAGG - Intronic
1002641247 5:180631623-180631645 CTGCACAAGCCCAAGGCAGGAGG - Intronic
1002705456 5:181158386-181158408 GAGGCCAAGGCCAAGGTGGGAGG + Intergenic
1002924209 6:1595462-1595484 GCACACCAGGCCAGGGTGGGCGG + Intergenic
1003109765 6:3243762-3243784 GTTCAGAAGGCTGAGGTGGGAGG - Intronic
1003530525 6:6933750-6933772 CTTCAGAAGGCCGAGGTGGGAGG - Intergenic
1004094494 6:12539133-12539155 GAGCACAAGGGGAAGGTGGTTGG + Intergenic
1004178879 6:13364378-13364400 TTGCAGAAGGCCAAGGTGTGTGG + Exonic
1005098274 6:22142242-22142264 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1005289743 6:24367484-24367506 GTGCTAAAGGCCGAGGTGGGAGG + Intergenic
1005324743 6:24688429-24688451 GTGCAGGAGGCTAAGGTGAGAGG + Intronic
1005427950 6:25723570-25723592 TAGGATAAGGCCAAGGTGGGTGG + Intergenic
1006397140 6:33794929-33794951 GGGCACAAGGGCAGGCTGGGCGG + Intronic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006557712 6:34882746-34882768 CTTTAGAAGGCCAAGGTGGGAGG - Intronic
1006665800 6:35692221-35692243 GTTTAGGAGGCCAAGGTGGGAGG - Intronic
1006885772 6:37380924-37380946 CTTCGGAAGGCCAAGGTGGGTGG - Intronic
1007004921 6:38352131-38352153 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1007077429 6:39076792-39076814 GTGCAGAAGGCCATTGAGGGCGG + Intronic
1007182245 6:39937773-39937795 GTGGGCAAGGTTAAGGTGGGCGG - Intergenic
1007293386 6:40803382-40803404 GTGCTCAAGCCCAAGGGGAGGGG + Intergenic
1007309007 6:40930338-40930360 CTGCACAAGGGCAAAGAGGGAGG - Intergenic
1007435096 6:41804989-41805011 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
1007550261 6:42723761-42723783 GTTTGGAAGGCCAAGGTGGGTGG + Intergenic
1007800409 6:44387681-44387703 CTGCGCAAGCGCAAGGTGGGAGG - Exonic
1007839729 6:44705914-44705936 GCTCAGAAGGCCAGGGTGGGTGG + Intergenic
1007958675 6:45939433-45939455 CTGTAGGAGGCCAAGGTGGGTGG - Intronic
1008367801 6:50703308-50703330 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1008861626 6:56155844-56155866 ATTCACAAGGCTTAGGTGGGTGG - Intronic
1010239850 6:73605086-73605108 CTTCGGAAGGCCAAGGTGGGAGG - Intronic
1011170542 6:84499885-84499907 GAGCACAAGCCCAAGGAGAGTGG + Intergenic
1011839217 6:91475668-91475690 CTTCAGAAGGCCAAGGCGGGAGG + Intergenic
1013238175 6:108217509-108217531 CTTCAGGAGGCCAAGGTGGGTGG + Intronic
1013614068 6:111825190-111825212 GTGCACAAGCCCTTTGTGGGAGG + Intronic
1015261887 6:131247561-131247583 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
1015452180 6:133383269-133383291 ATGGCCAAGGCCAAGGTGGGTGG + Intronic
1016047073 6:139492263-139492285 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
1016643534 6:146378187-146378209 GTGCAGAAGGAAAATGTGGGGGG + Intronic
1016738101 6:147502049-147502071 GTTTAGGAGGCCAAGGTGGGAGG - Intergenic
1016808038 6:148232970-148232992 GTGAAGGAGGCCAAGGTGGGCGG + Intergenic
1017042088 6:150315760-150315782 CTTTAGAAGGCCAAGGTGGGAGG + Intergenic
1017293490 6:152768230-152768252 GTGCACACGGCTCAGGTGAGAGG + Intergenic
1017414733 6:154207644-154207666 TTCCACCAGGCCAAGGTGGGTGG - Intronic
1017486464 6:154906572-154906594 GTTTGGAAGGCCAAGGTGGGTGG + Intronic
1017525064 6:155235186-155235208 GTGCACAAGGCACAGTTGGGAGG - Intronic
1017643624 6:156518118-156518140 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
1017671243 6:156771392-156771414 CTGCTCAAGGCCAAGGAGGTGGG - Intergenic
1018211724 6:161488726-161488748 CTTCAGGAGGCCAAGGTGGGAGG - Intronic
1019723677 7:2588594-2588616 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
1019832475 7:3346619-3346641 GTGCAGAAGGCTAAGGTAGGAGG - Intronic
1019993028 7:4705423-4705445 CTGCGGGAGGCCAAGGTGGGAGG - Intronic
1020022651 7:4878298-4878320 CTTTAGAAGGCCAAGGTGGGAGG + Intronic
1020066904 7:5195241-5195263 CTATGCAAGGCCAAGGTGGGAGG + Intronic
1020083508 7:5298546-5298568 ATACAGGAGGCCAAGGTGGGAGG + Intronic
1021590954 7:22261346-22261368 GTGCAGGAAGCCAAGGTGAGAGG + Intronic
1022726961 7:32990073-32990095 CTTCAGAAGGCCAAGGTGGGAGG - Intronic
1022868943 7:34455729-34455751 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1023429938 7:40080229-40080251 GTTTAGGAGGCCAAGGTGGGTGG - Intronic
1024350169 7:48355391-48355413 GTGCACAAGGGCAAGAGGGTGGG + Intronic
1024515940 7:50256138-50256160 GGGCAGAAGGACAAGGTGGAAGG - Intergenic
1025046620 7:55697560-55697582 CTTCAGAAGGCCAAGGTGGGAGG + Intergenic
1025704419 7:63850107-63850129 GTTTAGGAGGCCAAGGTGGGTGG - Intergenic
1025937361 7:66047936-66047958 TTTCAGGAGGCCAAGGTGGGTGG + Intergenic
1026043161 7:66885911-66885933 CTTCAGAAGTCCAAGGTGGGTGG - Intergenic
1026102098 7:67391924-67391946 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1026157146 7:67836557-67836579 CTTCAAGAGGCCAAGGTGGGTGG - Intergenic
1026442380 7:70455676-70455698 CTTCAAGAGGCCAAGGTGGGAGG + Intronic
1026649733 7:72205444-72205466 GTTTGAAAGGCCAAGGTGGGTGG - Intronic
1026741759 7:72983285-72983307 CTGTAGGAGGCCAAGGTGGGCGG - Intergenic
1026801600 7:73403710-73403732 CTGTAGGAGGCCAAGGTGGGCGG - Intergenic
1026827044 7:73590883-73590905 AAGCCTAAGGCCAAGGTGGGAGG + Intergenic
1026929278 7:74214996-74215018 ATTCACCAGGCCACGGTGGGTGG + Exonic
1026958976 7:74396762-74396784 CTTCAGAAGGCCGAGGTGGGCGG - Intronic
1026960509 7:74404608-74404630 TTGCCCAAGGTCACGGTGGGAGG - Exonic
1027101976 7:75381792-75381814 CTGTAGGAGGCCAAGGTGGGCGG + Intergenic
1027855630 7:83507692-83507714 TTTTAGAAGGCCAAGGTGGGAGG + Intronic
1028194062 7:87884826-87884848 GTTCAGAAGGCCAAGGCGGGAGG + Intronic
1028844175 7:95461079-95461101 GTGCAAAAGGGAAATGTGGGGGG + Intergenic
1029207237 7:98877326-98877348 TTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1029568120 7:101352707-101352729 CTGTAGAAGGCCAAGGCGGGCGG + Intergenic
1029584086 7:101459055-101459077 CTTCGGAAGGCCAAGGTGGGAGG - Intronic
1030052527 7:105551274-105551296 CTCCAGGAGGCCAAGGTGGGTGG - Intronic
1030157750 7:106473269-106473291 CTTCAGAAGGCCAAGGTGAGTGG + Intergenic
1030868531 7:114729093-114729115 GTTCAAGAGGCTAAGGTGGGTGG - Intergenic
1031014514 7:116558502-116558524 CCTCAGAAGGCCAAGGTGGGTGG + Intronic
1031273213 7:119681556-119681578 GTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1032020847 7:128406345-128406367 GGGGAGAAGGGCAAGGTGGGTGG - Intronic
1032054049 7:128670481-128670503 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
1032157619 7:129481922-129481944 CTTCGGAAGGCCAAGGTGGGAGG + Intronic
1032189277 7:129754215-129754237 ATTCAGGAGGCCAAGGTGGGAGG + Intronic
1032327908 7:130949508-130949530 GTTTGGAAGGCCAAGGTGGGCGG - Intergenic
1032394147 7:131576869-131576891 GTGCTCACGACCAAGGTGGATGG + Intergenic
1033064132 7:138136651-138136673 GTGGCCCAGGCCAAGGTGGGTGG - Intergenic
1033272585 7:139946087-139946109 CTTCAAGAGGCCAAGGTGGGAGG + Intronic
1033329598 7:140407126-140407148 CTTCGGAAGGCCAAGGTGGGTGG - Intronic
1033397100 7:140985660-140985682 CTTCAGGAGGCCAAGGTGGGCGG + Intergenic
1034046320 7:147932127-147932149 GTTTGGAAGGCCAAGGTGGGTGG - Intronic
1034923003 7:155099089-155099111 GGTGGCAAGGCCAAGGTGGGAGG + Intergenic
1035180165 7:157083653-157083675 GTTCGGAAGGCCAAGGGGGGTGG + Intergenic
1035935016 8:3827023-3827045 CTTCAAAAGGCCAAGATGGGAGG - Intronic
1037032407 8:14125258-14125280 GTTCACAAGGTCGAGGTGGGTGG + Intronic
1037278874 8:17212969-17212991 ATCCAGAAGGCCAAGGTGAGAGG - Intronic
1037338474 8:17815102-17815124 ACTCAGAAGGCCAAGGTGGGAGG - Intergenic
1037406193 8:18545365-18545387 CATCACAAGGCCAAGCTGGGTGG - Intronic
1037445310 8:18959594-18959616 GGGCAGAAAGGCAAGGTGGGTGG - Intronic
1037512188 8:19594793-19594815 CTGTGGAAGGCCAAGGTGGGTGG - Intronic
1037613361 8:20495293-20495315 ATTCACAAGGCTGAGGTGGGAGG + Intergenic
1037812720 8:22096495-22096517 CTGGGCAAGGCCGAGGTGGGAGG + Exonic
1037932113 8:22887520-22887542 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1038850029 8:31266674-31266696 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1039597134 8:38800050-38800072 GCTCAGAAGGCTAAGGTGGGAGG + Intronic
1039939879 8:42081011-42081033 CTTCAGGAGGCCAAGGTGGGCGG - Intergenic
1040645029 8:49388106-49388128 GTGCAGAAGGAAAACGTGGGTGG + Intergenic
1041268413 8:56086762-56086784 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
1041667237 8:60457680-60457702 ATGCAGAAGGCTGAGGTGGGAGG - Intergenic
1041819362 8:62012284-62012306 CGGCAGAAGGCTAAGGTGGGAGG + Intergenic
1042247122 8:66718966-66718988 GTATACAAGGCTGAGGTGGGAGG + Intronic
1042549609 8:69982691-69982713 CTGTAGGAGGCCAAGGTGGGTGG - Intergenic
1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
1043544009 8:81294989-81295011 GGGGAGAAAGCCAAGGTGGGTGG + Intergenic
1044425236 8:92042420-92042442 GGTCAGAAGGCCGAGGTGGGAGG - Intronic
1044624771 8:94226392-94226414 CTGTAGGAGGCCAAGGTGGGCGG + Intergenic
1045272597 8:100674711-100674733 CTGCACCAGGCCAAGGCCGGAGG + Intergenic
1045512723 8:102825503-102825525 ACTCAAAAGGCCAAGGTGGGAGG - Intergenic
1048809776 8:138275439-138275461 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1049164028 8:141115803-141115825 GAGTGCAAAGCCAAGGTGGGCGG + Intergenic
1049533987 8:143169593-143169615 GTGCATAAGGACAGGCTGGGAGG - Intergenic
1049633347 8:143671894-143671916 GTTCAGGAGGCCGAGGTGGGTGG - Intergenic
1049755058 8:144307494-144307516 CTGCAGGAGGCCAAGGTGGGCGG + Intronic
1049818878 8:144622179-144622201 CTGCACAGGCCCAAGGTGAGGGG + Intergenic
1050550492 9:6744837-6744859 AGGCACCAGGGCAAGGTGGGGGG + Intronic
1050892042 9:10836239-10836261 GTGCAGGAGCCCATGGTGGGAGG - Intergenic
1051034499 9:12727109-12727131 CTTTACAAGGCCGAGGTGGGAGG + Intergenic
1051856710 9:21575701-21575723 TTGGGAAAGGCCAAGGTGGGCGG - Intergenic
1051909146 9:22132924-22132946 CTTCAGGAGGCCAAGGTGGGCGG - Intergenic
1052578201 9:30318331-30318353 ACTCAGAAGGCCAAGGTGGGAGG + Intergenic
1053018007 9:34675099-34675121 CTGCAGGAGGCCAAGGCGGGAGG - Intergenic
1053319624 9:37084309-37084331 GAGCACAGGGCCAAGGTCAGAGG - Intergenic
1053600901 9:39608612-39608634 GTTCTCAAAGCCGAGGTGGGTGG - Intergenic
1053658704 9:40248004-40248026 CTTTGCAAGGCCAAGGTGGGTGG - Intronic
1053782924 9:41629648-41629670 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
1053858552 9:42362420-42362442 GTTCTCAAAGCCGAGGTGGGTGG - Intergenic
1053909080 9:42877273-42877295 CTTTGCAAGGCCAAGGTGGGCGG - Intergenic
1054170876 9:61839788-61839810 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
1054252248 9:62730071-62730093 CTTCAGGAGGCCAAGGTGGGCGG - Intergenic
1054252633 9:62733826-62733848 GTTCTCAAAGCCGAGGTGGGTGG + Intergenic
1054370823 9:64394278-64394300 CTTTGCAAGGCCAAGGTGGGTGG - Intronic
1054525894 9:66128218-66128240 CTTTGCAAGGCCAAGGTGGGTGG + Intronic
1054566748 9:66768324-66768346 GTTCTCAAAGCCGAGGTGGGTGG + Intergenic
1054666660 9:67741019-67741041 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
1054678456 9:67884026-67884048 CTTTGCAAGGCCAAGGTGGGTGG - Intronic
1055220621 9:73926654-73926676 CTTTAGAAGGCCAAGGTGGGTGG - Intergenic
1055221226 9:73934348-73934370 CTTTGCAAGGCCAAGGTGGGAGG + Intergenic
1055306378 9:74933579-74933601 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
1055322985 9:75100348-75100370 GGGCACATGGACAAGGAGGGAGG - Intronic
1056619513 9:88199860-88199882 GCTCACGGGGCCAAGGTGGGTGG + Intergenic
1056741455 9:89259363-89259385 ATTCAGAAGGCCGAGGTGGGAGG - Intergenic
1057186899 9:93062125-93062147 GTACATAAGGCCAGGGAGGGAGG + Intronic
1057372559 9:94487323-94487345 CTTCAGAAGGCCAAAGTGGGCGG - Intergenic
1057408057 9:94791422-94791444 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1057411470 9:94819814-94819836 CTTCAGAAGGCCAAGGCGGGAGG - Intronic
1058137485 9:101323249-101323271 CTTCGGAAGGCCAAGGTGGGAGG + Intronic
1058935868 9:109768874-109768896 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1059146100 9:111901057-111901079 CTTCAGGAGGCCAAGGTGGGGGG - Intronic
1059174615 9:112158065-112158087 CTTTAGAAGGCCAAGGTGGGTGG - Intronic
1059791708 9:117647687-117647709 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1059872148 9:118589225-118589247 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
1060270357 9:122135830-122135852 CTTCGGAAGGCCAAGGTGGGAGG - Intergenic
1060395528 9:123313718-123313740 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1060654279 9:125358347-125358369 CTTCAGGAGGCCAAGGTGGGTGG - Intronic
1060898670 9:127238228-127238250 CTTCGGAAGGCCAAGGTGGGCGG - Intronic
1061021591 9:128019222-128019244 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
1061132551 9:128716061-128716083 CTTCAGGAGGCCAAGGTGGGAGG + Intronic
1061273337 9:129556389-129556411 GGGCAAAAGGCCGAGGCGGGTGG - Intergenic
1061563883 9:131424441-131424463 CTTCAGGAGGCCAAGGTGGGCGG + Intronic
1062388337 9:136323949-136323971 GAACACATGGCCAAGCTGGGAGG + Intergenic
1203694873 Un_GL000214v1:88650-88672 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1203704671 Un_KI270742v1:28784-28806 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1203559329 Un_KI270744v1:37029-37051 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1203627612 Un_KI270750v1:39343-39365 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1203641400 Un_KI270751v1:15413-15435 CTTTGCAAGGCCAAGGTGGGTGG - Intergenic
1185744794 X:2564065-2564087 ACGCAGGAGGCCAAGGTGGGAGG - Intergenic
1187009379 X:15264617-15264639 TTGCACAAGGCCAAGTTAGAGGG - Intronic
1187664136 X:21585132-21585154 ACTCAGAAGGCCAAGGTGGGAGG + Intronic
1187708451 X:22030256-22030278 AACCAAAAGGCCAAGGTGGGTGG - Intergenic
1187879178 X:23830607-23830629 ATGCAGGAGGCTAAGGTGGGAGG + Intergenic
1187925608 X:24247231-24247253 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
1188279495 X:28247141-28247163 CTTCAGGAGGCCAAGGTGGGCGG - Intergenic
1189289873 X:39877516-39877538 GGGAAGGAGGCCAAGGTGGGAGG - Intergenic
1189793529 X:44625645-44625667 CTTCGGAAGGCCAAGGTGGGCGG - Intergenic
1189988126 X:46571740-46571762 CAGCACAAGGCCGAAGTGGGAGG + Intergenic
1189991439 X:46599002-46599024 GAGGCCAAGGCCAAGGTGGGTGG - Intergenic
1190038785 X:47051983-47052005 ACTCACAAGGCTAAGGTGGGAGG + Intronic
1190085816 X:47394287-47394309 CTGTAGGAGGCCAAGGTGGGAGG - Intronic
1190176565 X:48155538-48155560 ATTCCCAAGGCCGAGGTGGGAGG + Intergenic
1190199254 X:48345924-48345946 GTTTAGGAGGCCAAGGTGGGAGG + Intergenic
1190658524 X:52634301-52634323 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1190914877 X:54803936-54803958 GTTCACAAGGAGAAGGTGGGAGG + Intergenic
1192133244 X:68572811-68572833 CTTCAGGAGGCCAAGGTGGGTGG - Intergenic
1192441361 X:71176834-71176856 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1192928228 X:75778725-75778747 TTGCAAAAGGCCTAGGAGGGAGG - Intergenic
1193767972 X:85555370-85555392 GTTTAGGAGGCCAAGGTGGGTGG - Intergenic
1194160982 X:90452085-90452107 GTTCAGGAGGCCAAGGTGGATGG + Intergenic
1195615086 X:106905777-106905799 GAACACAAGTTCAAGGTGGGAGG - Intronic
1195624926 X:106998050-106998072 GTGCGCAAGGCCACTGTGGTAGG - Intronic
1195657125 X:107342653-107342675 GTACAGAAGGCCAATATGGGTGG - Intergenic
1196075970 X:111576697-111576719 CTTCAGGAGGCCAAGGTGGGTGG + Intergenic
1196724366 X:118882979-118883001 CTTCAGAAGGCCAAAGTGGGTGG + Intergenic
1198069610 X:133135036-133135058 CTTCAGGAGGCCAAGGTGGGAGG + Intergenic
1198521754 X:137460274-137460296 CTTTACGAGGCCAAGGTGGGAGG - Intergenic
1198979287 X:142376642-142376664 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1199297559 X:146176535-146176557 GTGCCCAAGGCAAAGGTGCATGG - Intergenic
1199464291 X:148118238-148118260 GTTTAGGAGGCCAAGGTGGGAGG + Intergenic
1199766621 X:150946079-150946101 CTTTGCAAGGCCAAGGTGGGTGG + Intergenic
1200115154 X:153766762-153766784 GTGCTCAGGGCCAGGGAGGGAGG - Intronic
1200507272 Y:4029020-4029042 GTTCAGGAGGCCAAGGTGGATGG + Intergenic
1200736265 Y:6799459-6799481 CTACAGAAGGCCAAGATGGGAGG - Intergenic
1200745009 Y:6896590-6896612 CTTCAAGAGGCCAAGGTGGGAGG + Intergenic
1200808017 Y:7452445-7452467 ATTCACAAGGCTGAGGTGGGAGG - Intergenic
1201271022 Y:12253834-12253856 CTTCAGGAGGCCAAGGTGGGAGG - Intergenic
1201284149 Y:12364707-12364729 GGGGCCAAGGCCAAGGTGGGTGG - Intergenic
1201424546 Y:13833882-13833904 CTTGAAAAGGCCAAGGTGGGAGG - Intergenic
1201583427 Y:15534917-15534939 GTCCCCAAGGCTGAGGTGGGAGG + Intergenic
1201613721 Y:15872015-15872037 TTTTAGAAGGCCAAGGTGGGAGG - Intergenic